ID: 926274762

View in Genome Browser
Species Human (GRCh38)
Location 2:11395499-11395521
Sequence ATGTGTTGTGTGGGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926274757_926274762 -6 Left 926274757 2:11395482-11395504 CCTGGGTTCCATCGGGAATGTGT No data
Right 926274762 2:11395499-11395521 ATGTGTTGTGTGGGGAAAGCTGG No data
926274752_926274762 22 Left 926274752 2:11395454-11395476 CCAGATTCAAATTTAGAATTCTC No data
Right 926274762 2:11395499-11395521 ATGTGTTGTGTGGGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926274762 Original CRISPR ATGTGTTGTGTGGGGAAAGC TGG Intergenic
No off target data available for this crispr