ID: 926277799

View in Genome Browser
Species Human (GRCh38)
Location 2:11418074-11418096
Sequence CCTGCTAGTGAAAATGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926277794_926277799 4 Left 926277794 2:11418047-11418069 CCGGCAGCCTCAAAACCATCCTT No data
Right 926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG No data
926277792_926277799 22 Left 926277792 2:11418029-11418051 CCGTTTTTGATTTATAGCCCGGC No data
Right 926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG No data
926277793_926277799 5 Left 926277793 2:11418046-11418068 CCCGGCAGCCTCAAAACCATCCT No data
Right 926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG No data
926277790_926277799 23 Left 926277790 2:11418028-11418050 CCCGTTTTTGATTTATAGCCCGG No data
Right 926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG No data
926277795_926277799 -3 Left 926277795 2:11418054-11418076 CCTCAAAACCATCCTTTTTGCCT No data
Right 926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926277799 Original CRISPR CCTGCTAGTGAAAATGAATC TGG Intergenic
No off target data available for this crispr