ID: 926278618

View in Genome Browser
Species Human (GRCh38)
Location 2:11425739-11425761
Sequence ACTTATTAGCAGAAGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926278612_926278618 20 Left 926278612 2:11425696-11425718 CCAAATGCACGCGGCAATTTATC No data
Right 926278618 2:11425739-11425761 ACTTATTAGCAGAAGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926278618 Original CRISPR ACTTATTAGCAGAAGAGGGT GGG Intergenic
No off target data available for this crispr