ID: 926283056

View in Genome Browser
Species Human (GRCh38)
Location 2:11465957-11465979
Sequence CCCCACGCGCCGATTTCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 6, 1: 0, 2: 0, 3: 4, 4: 27}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926283042_926283056 30 Left 926283042 2:11465904-11465926 CCCTCGCACCCCACGAGCTCTCC 0: 4
1: 0
2: 2
3: 5
4: 128
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283044_926283056 22 Left 926283044 2:11465912-11465934 CCCCACGAGCTCTCCCGCCCTCT 0: 6
1: 0
2: 0
3: 13
4: 262
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283050_926283056 4 Left 926283050 2:11465930-11465952 CCTCTCGCGCTCAGCTCGAGCAC 0: 6
1: 0
2: 0
3: 2
4: 34
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283046_926283056 20 Left 926283046 2:11465914-11465936 CCACGAGCTCTCCCGCCCTCTCG 0: 6
1: 0
2: 0
3: 16
4: 190
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283049_926283056 5 Left 926283049 2:11465929-11465951 CCCTCTCGCGCTCAGCTCGAGCA 0: 6
1: 0
2: 0
3: 1
4: 37
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283045_926283056 21 Left 926283045 2:11465913-11465935 CCCACGAGCTCTCCCGCCCTCTC 0: 6
1: 0
2: 1
3: 8
4: 241
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283047_926283056 9 Left 926283047 2:11465925-11465947 CCCGCCCTCTCGCGCTCAGCTCG 0: 6
1: 0
2: 2
3: 7
4: 176
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283043_926283056 29 Left 926283043 2:11465905-11465927 CCTCGCACCCCACGAGCTCTCCC 0: 4
1: 0
2: 4
3: 15
4: 208
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27
926283048_926283056 8 Left 926283048 2:11465926-11465948 CCGCCCTCTCGCGCTCAGCTCGA 0: 6
1: 0
2: 0
3: 1
4: 61
Right 926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG 0: 6
1: 0
2: 0
3: 4
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926283056 Original CRISPR CCCCACGCGCCGATTTCCAA GGG Exonic
911127404 1:94353248-94353270 CCCCAAGCCCCGATTCCCACAGG - Intergenic
921538483 1:216382764-216382786 CCCCAAACCCCTATTTCCAAGGG - Intronic
1072269368 10:93760790-93760812 CCCCATGCTCCGAGTTCCTATGG + Intronic
1085041347 11:73328238-73328260 CCCCACGGGCAGCTGTCCAAAGG + Intronic
1093255814 12:16866743-16866765 CCCTACCCTCCCATTTCCAAAGG - Intergenic
1102903720 12:116658927-116658949 CCCCCGGCTCCGATTTGCAATGG - Intergenic
1109969086 13:69741562-69741584 CCCCACGCCCCAATTCCCATAGG + Intronic
1113453000 13:110425560-110425582 ACCCACGAGCAGATTTCCCAGGG + Intronic
1113910017 13:113837260-113837282 CCCCATCCCCCGATTTCAAAAGG - Intronic
1130912053 15:88277514-88277536 CCCTACGCTCAGATTTCCAAGGG + Intergenic
1133347659 16:5081227-5081249 CCCCAGGGGCCGTTTACCAAGGG + Intronic
1135182690 16:20289481-20289503 CCCCACGCCCAGTTTTCCGATGG + Intergenic
1142046260 16:87927065-87927087 CCCCACGCGCCCGTTTCCCGTGG - Intronic
1142956883 17:3528633-3528655 CCCCAGGTGCCGAGTCCCAAGGG - Intronic
1144742287 17:17590821-17590843 CCCCAGGCTCCCAATTCCAATGG - Intronic
1151020992 17:70617307-70617329 CACCATGTGCAGATTTCCAATGG + Intergenic
926283056 2:11465957-11465979 CCCCACGCGCCGATTTCCAAGGG + Exonic
928769364 2:34687936-34687958 CCCCACTCTCCAATTTCCATTGG + Intergenic
939297165 2:140282171-140282193 CCTCACCCACCAATTTCCAATGG + Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1180821743 22:18833596-18833618 CCCCACGCGCCGATTTCCAAGGG - Intergenic
1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG + Intergenic
1181207963 22:21268061-21268083 CCCCACGCGCCGATTTCCAAGGG - Intergenic
1185004635 22:48268548-48268570 CCCCAAGGGCCAATTTGCAAGGG - Intergenic
1203218957 22_KI270731v1_random:27355-27377 CCCCACGCGCCGATTTCCAAGGG + Intergenic
1203271868 22_KI270734v1_random:59472-59494 CCCCACGCGCCGATTTCCAAGGG - Intergenic
960734845 3:120767541-120767563 CCCCATGCCCCAATTTCCATGGG - Intronic
967920984 3:194614253-194614275 CATCACAAGCCGATTTCCAAAGG + Intronic
968459965 4:719866-719888 CCCGACGCTCCGACTGCCAAGGG - Intronic
1008897186 6:56569702-56569724 CCCCATGCCATGATTTCCAAAGG + Intronic
1035192494 7:157183511-157183533 CCCCACGCACCAACTTCCAAGGG - Intronic
1060376066 9:123116029-123116051 CCCCAGGTGCCAATTTCCATAGG + Intronic
1061200997 9:129138521-129138543 CCCCATGCCCCAGTTTCCAAAGG + Intronic
1061882349 9:133574654-133574676 CCCCACGTGCCGTTTTCCAGGGG - Intronic
1062112114 9:134787849-134787871 CCCCACGCGCCCATATCCATAGG - Intronic
1062264742 9:135681826-135681848 CCCCTGGCGCCGGTTCCCAAGGG - Intergenic
1199879404 X:151961316-151961338 CCACATGCTCAGATTTCCAATGG - Exonic