ID: 926286111

View in Genome Browser
Species Human (GRCh38)
Location 2:11489445-11489467
Sequence TTTTCCCCCAAGACGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926286111_926286113 25 Left 926286111 2:11489445-11489467 CCAGACTCCGTCTTGGGGGAAAA No data
Right 926286113 2:11489493-11489515 GAAGTCTTGCCCCCAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926286111 Original CRISPR TTTTCCCCCAAGACGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr