ID: 926287704

View in Genome Browser
Species Human (GRCh38)
Location 2:11503067-11503089
Sequence GACCAATGTTCTAGTTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926287699_926287704 8 Left 926287699 2:11503036-11503058 CCTGGTAAAAGTGACTTTCAGAG No data
Right 926287704 2:11503067-11503089 GACCAATGTTCTAGTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926287704 Original CRISPR GACCAATGTTCTAGTTGTGT GGG Intergenic
No off target data available for this crispr