ID: 926291520

View in Genome Browser
Species Human (GRCh38)
Location 2:11534939-11534961
Sequence GTGCTCAGGACAGAATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926291513_926291520 17 Left 926291513 2:11534899-11534921 CCACAGGGGGCGCTGGTGTCTGG 0: 1
1: 0
2: 3
3: 16
4: 213
Right 926291520 2:11534939-11534961 GTGCTCAGGACAGAATCAGCTGG 0: 1
1: 1
2: 2
3: 23
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926291520 Original CRISPR GTGCTCAGGACAGAATCAGC TGG Intronic
900011641 1:116394-116416 GGGCTCATGGCAGAATCAGAGGG - Intergenic
900238852 1:1605349-1605371 CTGCTCAGCACAGGGTCAGCTGG + Intergenic
901455130 1:9358763-9358785 GAGCTCATGACAGCATCAGGGGG - Intronic
901739984 1:11335431-11335453 CAGCTCAGGACTGAATGAGCAGG - Intergenic
902582517 1:17417262-17417284 GTTCTCAGGACTGGAGCAGCCGG - Intronic
903857985 1:26348206-26348228 GTGCTCTGGAGACCATCAGCAGG - Intronic
905607480 1:39315620-39315642 GCGCTCAGAACTGAATCTGCTGG + Exonic
905828491 1:41045649-41045671 CTGCTCAGGACACAATCTGCAGG + Intronic
907804001 1:57800279-57800301 GTGCTGGAGACACAATCAGCAGG + Intronic
907923592 1:58935454-58935476 GTGCTTAGAACAGTATCAGTCGG - Intergenic
908921810 1:69203419-69203441 GAGCTCAGGAAAAAATTAGCTGG + Intergenic
909426747 1:75534362-75534384 GAGCCCTGGACAGAATCAGGAGG - Intronic
911050685 1:93668431-93668453 GTGCTGAGGACAGGAGCAGCTGG - Intronic
911871965 1:103109345-103109367 AGGATCAGAACAGAATCAGCTGG - Intergenic
921692925 1:218173372-218173394 GTGCTCACATCAGGATCAGCAGG - Intergenic
921887590 1:220322013-220322035 GTGGTCAGGGCAAAATAAGCAGG + Intergenic
1062828519 10:588971-588993 GTGGTGAGGACAGAGGCAGCCGG - Intronic
1062893468 10:1084517-1084539 GTGCTCGGGACTGCATCAGCCGG + Exonic
1063464694 10:6235155-6235177 GGTCTCAGGACAGAATAAGGAGG - Exonic
1064292662 10:14050254-14050276 GTCCTCAGGACAGCAGCACCTGG - Intronic
1067740345 10:48890746-48890768 GGGCTCAGGGAAGAATCTGCTGG - Intronic
1067838199 10:49654542-49654564 CTGCTCAGGACACAGTCATCAGG + Intronic
1069601232 10:69709507-69709529 GTCTTGAGAACAGAATCAGCAGG + Intergenic
1069867804 10:71514464-71514486 GTCCTCAGGCCAGGAACAGCAGG + Intronic
1070628206 10:78066230-78066252 GTGCCCAGGACAGGAACAACTGG + Intergenic
1070681281 10:78451159-78451181 GTGTGCAGGAGAGAATAAGCAGG + Intergenic
1073063129 10:100744034-100744056 GAGCTCAGGCCAGGCTCAGCGGG - Intronic
1078895313 11:15592202-15592224 GTGCTCAGTACACACTCAGGTGG - Intergenic
1079066312 11:17296963-17296985 GTTCTCAGGACAGAGTCAAATGG - Intronic
1079080121 11:17408196-17408218 GTGCCCAGGGCAGAATCAGGTGG - Intronic
1079510901 11:21208936-21208958 GAGCTTAGCAGAGAATCAGCAGG + Intronic
1090414597 11:126531961-126531983 GTGCTCTGAACAGTATCTGCCGG - Intronic
1091118719 11:133039302-133039324 GTGCTCAAGACAACCTCAGCAGG + Intronic
1097059381 12:56271179-56271201 GATCTCAGGACAGAATCATCTGG + Intergenic
1098885079 12:75952749-75952771 GTGCAGAGGACAGAACCAGATGG - Intergenic
1100274006 12:93054814-93054836 AAGCTCAGGACAGCATAAGCTGG + Intergenic
1101741066 12:107500423-107500445 CTGCTCAGGAGAGAATCAAAGGG - Intronic
1104118939 12:125779192-125779214 GTTCTCAAGACAGAATCAAGTGG + Intergenic
1104892432 12:132147044-132147066 GTGCTCACGACAGAGTCTGGCGG - Intronic
1106305371 13:28504612-28504634 GTGCTCAAGACAGAAGCAAGAGG - Intergenic
1106420038 13:29578540-29578562 GGGCTCTGGGCAGACTCAGCTGG - Intronic
1110395766 13:75028145-75028167 GTGCTCAGCACACAATCAACTGG + Intergenic
1112050464 13:95640330-95640352 TTGCTCAGGACTGACCCAGCAGG - Intronic
1113406518 13:110045948-110045970 GGCCTCAGGACAGAATCAGCAGG - Intergenic
1114736322 14:25047647-25047669 GTTCTCAGATCAGAATCATCTGG - Intronic
1114917392 14:27285716-27285738 ATGCTCAGGACAGAAGCTGTTGG - Intergenic
1118944238 14:70368925-70368947 TTGCTCAGGTTAGAATCATCTGG - Exonic
1120291176 14:82572734-82572756 CTTCTCTGGACAGAATCATCAGG + Intergenic
1120964181 14:90153009-90153031 GTGCTCAGGCAAGTGTCAGCAGG - Intronic
1122247710 14:100415999-100416021 GTGCTCAGTAAAGATTCAGGTGG - Intronic
1122480839 14:102046392-102046414 GTTAACAGGACAGAATCAGGAGG + Intronic
1122859635 14:104576777-104576799 GGGCTCAAGACAGCCTCAGCTGG + Intronic
1122859659 14:104576875-104576897 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1122859667 14:104576924-104576946 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1122859676 14:104576973-104576995 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1122859684 14:104577022-104577044 GGGCTCAGGACAGCCTCAGCTGG + Intronic
1123205475 14:106708756-106708778 GTGCTCACTACAGAACCTGCAGG + Intergenic
1123210522 14:106756023-106756045 GTGCTCACTACAGAACCTGCAGG + Intergenic
1127473368 15:59310081-59310103 GTGCACAGGACCTAAGCAGCAGG - Intronic
1130003967 15:80076568-80076590 ATGTTTAGCACAGAATCAGCTGG - Intronic
1130651800 15:85766331-85766353 GGGCCCAGGACAGCATGAGCCGG + Intronic
1131668164 15:94591916-94591938 GTCCTCAGGCCAGAAGCATCAGG + Intergenic
1132118963 15:99159999-99160021 GTGCTCAGGTCAGAATAATGGGG - Intronic
1132125880 15:99223744-99223766 TTGCTCCGCACAGCATCAGCTGG - Intronic
1137066853 16:35855726-35855748 GTTTGCAGGACAGACTCAGCAGG + Intergenic
1137387103 16:48051751-48051773 GTGGTCTGGATAGAATCACCTGG - Intergenic
1138117489 16:54372183-54372205 TTCCTCAGGGCAGATTCAGCAGG + Intergenic
1138933917 16:61695521-61695543 GTGCTCAGGACAGAATCTGCAGG - Intronic
1139593352 16:67945009-67945031 GTGCCCAGGAGAGAAGCCGCTGG + Intronic
1140681781 16:77392409-77392431 GTGTTTAGGGCAGAATAAGCAGG - Intronic
1141382051 16:83585524-83585546 GTGCTCGTGACACATTCAGCTGG + Intronic
1142991226 17:3732408-3732430 ATGATCAGGACAGAAGCAACCGG + Exonic
1143039429 17:4022608-4022630 GTGCACAGGGCAGAAGCAGCTGG + Intronic
1143153002 17:4818661-4818683 GGGATCAGGACAGAATCAGGAGG - Intronic
1144051003 17:11497093-11497115 GTCCTCAGGAGAGAATCTACAGG - Intronic
1144535855 17:16090788-16090810 GTGATCTGGGCAGAGTCAGCAGG + Intronic
1147426142 17:40346769-40346791 GAGGTCAGGAGAGAATCTGCTGG + Intronic
1148468737 17:47880318-47880340 TTACTCAGGACAGAACCAACTGG + Intergenic
1151927896 17:77212248-77212270 CTACTCAAGACAGAATCACCTGG - Intronic
1152497831 17:80686786-80686808 GTGCTCAGGACTCACACAGCTGG - Intronic
1152535976 17:80950586-80950608 GAGATCAGGACAGAAGCAACAGG - Intronic
1152748742 17:82052834-82052856 CTGCTCAGGACAGATTCCGGGGG + Intronic
1155528687 18:26743820-26743842 GTTCTCAAGCCAGAATCACCTGG + Intergenic
1159473579 18:68888614-68888636 CTCCTCAGGACAAAATCATCAGG + Intronic
1159854073 18:73563451-73563473 GAGCTCATGGCAGAATCAACTGG - Intergenic
1160415167 18:78705001-78705023 GTGCTCAGGGCAGAATGCGATGG - Intergenic
1161653331 19:5498416-5498438 GGGCTCAGGCCAGGGTCAGCAGG - Intergenic
1162535592 19:11261718-11261740 GGGCTGGGGACAGAACCAGCTGG - Intronic
1163405292 19:17118261-17118283 GCGCTCTGGACAGAATCTGCAGG + Intronic
1166040254 19:40198122-40198144 AAGCCCAGGACAGAATCAGGAGG + Intronic
1167322329 19:48804913-48804935 GTGCTCTGTACAGAATCGACTGG + Intronic
1167794125 19:51698218-51698240 GTGCTCAAGACGGAAGCACCAGG + Intergenic
1168102405 19:54148238-54148260 GTGCTCAAGGCAGAGGCAGCAGG - Exonic
925406759 2:3610695-3610717 GTTCTGAGGACAGGGTCAGCAGG - Intronic
926291520 2:11534939-11534961 GTGCTCAGGACAGAATCAGCTGG + Intronic
933128936 2:78648308-78648330 GTGCTCAGTAAAGAATTAACAGG + Intergenic
935640809 2:105288304-105288326 GTGCTGAGGACAGCACGAGCAGG + Intronic
936484468 2:112914459-112914481 CTTCTCAGGACAGAGTCAGGAGG + Intronic
936772946 2:115936950-115936972 ATGCTCAGGAGGGAATCAGGTGG - Intergenic
938321664 2:130370336-130370358 TTGTTCAGCACAGACTCAGCTGG + Intronic
938574763 2:132593629-132593651 GTGCTGAGGAAGGAAACAGCAGG + Intronic
940975853 2:159943508-159943530 GTTCTCAGGATAGAAGCAGTGGG + Intronic
942933779 2:181529018-181529040 GTGCTAAGGGGATAATCAGCAGG - Intronic
942969016 2:181934473-181934495 CTGCTCTTGATAGAATCAGCAGG + Intergenic
944637569 2:201689673-201689695 GTGCTCAGGCCAGAATCTTAGGG - Intronic
944884765 2:204051026-204051048 ATGCTTAGGACATAATGAGCTGG - Intergenic
947714633 2:232333428-232333450 GTGCTCAGCAGTGACTCAGCAGG + Intronic
1176213264 20:63935896-63935918 GTGCTCGAGCCAGGATCAGCCGG - Exonic
1177033352 21:16011063-16011085 GAATTCAGGAAAGAATCAGCTGG + Intergenic
1181408725 22:22703275-22703297 GTGCTCAGGGGAGATTCAGGTGG + Intergenic
1182393221 22:30016834-30016856 TTCCTCAGGACAGAATCATGGGG - Intronic
1182480756 22:30607252-30607274 GTGGTCAGGAGAGCCTCAGCAGG + Exonic
1184317374 22:43706381-43706403 GTGCTCTGGAAAGAATCAGCAGG - Intronic
1185124722 22:49002472-49002494 GTGCTCAGAATAGCATCAGAGGG - Intergenic
1185415209 22:50705755-50705777 GTGCTCAGGCCAGAGCCAGCCGG + Intergenic
949295786 3:2520808-2520830 GTGCAGATGACAGAATCACCAGG + Intronic
950613537 3:14141112-14141134 GTGCCCAGCACTGAACCAGCAGG - Intronic
952327260 3:32332607-32332629 GTGCTAAGGACAGCATTAGAAGG - Intronic
953355702 3:42254742-42254764 GAGCTGAGGACACAAACAGCAGG + Intergenic
953544542 3:43854728-43854750 ATCCACAGGACAGAAGCAGCGGG - Intergenic
953813956 3:46138314-46138336 GTGCTCACCCCAGACTCAGCTGG - Intergenic
954858386 3:53666291-53666313 CCGCTCAGGACAGAAACATCAGG - Intronic
956428259 3:69158966-69158988 GTGCTCAGCACAGAAATGGCAGG + Intergenic
960156580 3:114302477-114302499 GTGCCCAGGAGAGATACAGCTGG - Intronic
960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG + Exonic
962128184 3:132644822-132644844 GTGCTCAGGAAAAAACCACCAGG - Exonic
965350579 3:167607255-167607277 TGGCTCAGGAAAGAATAAGCAGG + Intronic
968001189 3:195207974-195207996 GTGCCCAAGACAGAAGCAGCAGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969133620 4:5011925-5011947 GTGCTCAGGACTCAATCTTCTGG - Intergenic
976778021 4:88727742-88727764 GTGTTCAGGAAAGAATCTCCAGG + Exonic
977296618 4:95216846-95216868 GAGCTCAGGTCAGAACCACCTGG + Intronic
978850389 4:113328981-113329003 CTGCTCAGCACAGAACCAACTGG - Intronic
979858473 4:125664352-125664374 GTGTGAAGGCCAGAATCAGCTGG + Intergenic
980985122 4:139687598-139687620 ATGCTGAGGGCAAAATCAGCAGG - Intronic
981497067 4:145405782-145405804 GGGCTCAGGAAAGAATGGGCTGG + Intergenic
983670042 4:170226338-170226360 GTGCTCATTACAGACTAAGCAGG - Intergenic
985089908 4:186351844-186351866 GTGCTCAGCACAGGCTCAGTGGG + Intergenic
985523222 5:388869-388891 ATGCTCATGACAAAAGCAGCAGG + Intronic
986677372 5:10197962-10197984 ATGTTCAGGAAAGAATCAGCTGG - Intergenic
987113290 5:14707138-14707160 GTGCCCAGGACAGCATGTGCCGG - Exonic
989111150 5:37907640-37907662 ATGCTCAGGAGAGCTTCAGCAGG + Intergenic
989152792 5:38316905-38316927 GGGCCAAGGACAGAATGAGCAGG + Intronic
989217329 5:38918568-38918590 GTGCTCAGGTCAGAATCACAAGG - Intronic
990312385 5:54552486-54552508 GTCCACAGGACAGAATATGCTGG - Intergenic
990322518 5:54643922-54643944 GTGCTCAGGCCGAAATCAGTGGG + Intergenic
991356752 5:65776581-65776603 GGACTCTGGACAGATTCAGCAGG - Intronic
997112050 5:131086027-131086049 CTGCACAGTAAAGAATCAGCAGG - Intergenic
1001495556 5:172185814-172185836 GTGCTGAGGACAGGGTGAGCTGG + Intronic
1002863342 6:1099471-1099493 CTGCTAAGAACAGAACCAGCCGG + Intergenic
1003372821 6:5545183-5545205 GTGCTCAAGACCGAATCGGCTGG + Exonic
1004133096 6:12939944-12939966 GTCCTGAGGACAGAAGCATCTGG - Intronic
1006213793 6:32421021-32421043 GGGCTCAGGAGGGAATCTGCTGG + Intergenic
1006626895 6:35404021-35404043 GTGTTCTTGACAGAAACAGCTGG + Intronic
1011143498 6:84187877-84187899 GAGCTCAACACAGAATGAGCTGG + Intronic
1017926227 6:158913786-158913808 GTGCAGAGGGCAGAATCTGCTGG + Intergenic
1021462199 7:20901066-20901088 ATGCTGAGGACTGCATCAGCTGG + Intergenic
1022277163 7:28866676-28866698 AAGGTCAAGACAGAATCAGCTGG + Intergenic
1022333563 7:29401943-29401965 GGGCTCAGCACAGACTCTGCAGG - Intronic
1023128983 7:36983700-36983722 ATGCTCAGGACAGATTGAGATGG + Intronic
1023494733 7:40783046-40783068 TTCCTCAGCACAGAATCAACTGG - Intronic
1024973498 7:55092152-55092174 CTGCTCAGGACAGAATGGGGAGG + Intronic
1025085911 7:56023121-56023143 GTGCTAAGGACAGAGCCTGCAGG + Intronic
1030315352 7:108108553-108108575 GTGATAAGTACAGAATTAGCGGG - Intronic
1034558849 7:151866940-151866962 GTGCTCTGGACAGAGGGAGCAGG + Intronic
1035690717 8:1557702-1557724 GTGCCCAGGAGAGGCTCAGCAGG - Intronic
1036286538 8:7448254-7448276 GGGCTAAGGACAGGAGCAGCTGG - Intronic
1036334939 8:7863274-7863296 GGGCTAAGGACAGGAGCAGCTGG + Intronic
1038146539 8:24902045-24902067 GTGAACAGGACAGCATCAGAAGG - Intergenic
1038324951 8:26566089-26566111 TTATTCAGGACATAATCAGCTGG - Intronic
1038780683 8:30566473-30566495 GAGCTCCGGGCAGAATCACCTGG - Intronic
1042097030 8:65227879-65227901 ATGCTCAGGAAAGTATCATCTGG + Intergenic
1043573411 8:81630483-81630505 GTGACCAGGACAGAAACAGCAGG - Intergenic
1043578445 8:81685800-81685822 GTGACCAGGACAGAAACAGCAGG - Exonic
1044578929 8:93802916-93802938 GTGCTGTGAAGAGAATCAGCAGG + Intronic
1047022887 8:120795423-120795445 GTGGTCAGGACAGAGAGAGCTGG - Intronic
1051149409 9:14064133-14064155 GTGAGCAGGACAGAACAAGCAGG + Intergenic
1051717320 9:19998723-19998745 GTGCTCTGGACAGAATGGTCTGG + Intergenic
1053466461 9:38312133-38312155 GTGCTCAGCACTGAACCAGCAGG + Intergenic
1055397850 9:75892456-75892478 GGGCTCAGGCGAGAATCCGCTGG + Intronic
1060414611 9:123421513-123421535 GTGGTCAGAACAGACTTAGCAGG - Intronic
1062053835 9:134460600-134460622 GTGTTCATGACAGCACCAGCTGG - Intergenic
1062258903 9:135647816-135647838 GTGCTCATTACAGATTAAGCAGG - Intergenic
1062358582 9:136176855-136176877 GGACTCAGAACAGAAGCAGCAGG - Intergenic
1185761932 X:2695089-2695111 GTGCTCAGAACATTTTCAGCAGG - Intronic
1188612828 X:32120395-32120417 GTACTCACGTCAGAATCAGCTGG - Intronic
1190127975 X:47722918-47722940 GTGGTCAGGGCAGGATCAGGAGG - Intergenic
1190701112 X:52990450-52990472 GGGCTGAGGACAGAATGAGCAGG + Intronic
1190781129 X:53596566-53596588 GAGCTCACCACAGTATCAGCAGG - Intronic
1195175025 X:102306296-102306318 GGGCAGAGGACAGAATCACCTGG - Intergenic
1195183840 X:102380797-102380819 GGGCAGAGGACAGAATCACCTGG + Intronic
1198708936 X:139480246-139480268 GTCAACAGGACTGAATCAGCAGG - Intergenic
1200080605 X:153574514-153574536 GTGCCCAGCACAGAGGCAGCAGG + Intronic