ID: 926292428

View in Genome Browser
Species Human (GRCh38)
Location 2:11541506-11541528
Sequence CATAGAGAAGAGTAGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926292428_926292434 21 Left 926292428 2:11541506-11541528 CCCATGCACTACTCTTCTCTATG 0: 1
1: 0
2: 2
3: 10
4: 163
Right 926292434 2:11541550-11541572 CCGACTCTTTCCAAAGCCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 96
926292428_926292435 30 Left 926292428 2:11541506-11541528 CCCATGCACTACTCTTCTCTATG 0: 1
1: 0
2: 2
3: 10
4: 163
Right 926292435 2:11541559-11541581 TCCAAAGCCCGAGGTCAGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926292428 Original CRISPR CATAGAGAAGAGTAGTGCAT GGG (reversed) Intronic
904564172 1:31417705-31417727 CATAGAGAAAAGCAGTGAATTGG - Intronic
907980630 1:59477272-59477294 CAGAGTGAAGAGTACTGCAGAGG - Intronic
910079358 1:83322912-83322934 CATTGAGAAGAGAAGTGGAGTGG - Intergenic
911824627 1:102466017-102466039 GATAAAGAAGAATAGTGAATGGG + Intergenic
916948435 1:169755042-169755064 CATAGAGCAGAGTAGGACACAGG + Intronic
918848198 1:189646222-189646244 AATAGGGAAAAATAGTGCATTGG + Intergenic
1063226825 10:4023365-4023387 GATAGAGAAGACTAGTGCTCAGG + Intergenic
1064111979 10:12547337-12547359 CAGAGAGAAGAGTGGGGCACGGG + Intronic
1065846890 10:29751914-29751936 CATGGAGAATAGTGGGGCATGGG + Intergenic
1066046526 10:31600228-31600250 AATAGAGAAGAGTAGTTGAGTGG - Intergenic
1066484847 10:35833419-35833441 CATAGTGAAAAGTGGAGCATAGG + Intergenic
1067167285 10:43875405-43875427 CAGAGATAAGAGTATTACATTGG + Intergenic
1067232835 10:44424287-44424309 CATACAGCAGAGAAGTGCAAAGG + Intergenic
1067920374 10:50449694-50449716 AATAAAGAAGAGAAGTGGATGGG - Intronic
1069533847 10:69238932-69238954 CTTAGAGAAGAGAAGGCCATGGG + Intronic
1073982074 10:109165600-109165622 CTCAGAGAGGAGTAGTTCATGGG - Intergenic
1084130821 11:67133018-67133040 GATAGAGAAGAGTACTTAATTGG + Intronic
1085256371 11:75175896-75175918 CACAGAGAAGAGCAGGACATGGG + Intronic
1086203566 11:84232621-84232643 CATAGAGAAGAGCAGAGAGTGGG - Intronic
1087592033 11:100201918-100201940 CATAGAGATGATTAGTGTACAGG + Intronic
1088646539 11:111921145-111921167 GATAGACAAGTGAAGTGCATTGG + Intronic
1091416299 12:288569-288591 CTTAGAGAATAGTACTGCACTGG + Intronic
1095914075 12:47458391-47458413 CATAGGGAGGAGTAGCCCATAGG - Intergenic
1097832912 12:64244431-64244453 AAAAGAGAAGAGAAGTGGATGGG + Intergenic
1097972156 12:65645553-65645575 TATAGAGAGGAGTATTGTATTGG - Intergenic
1099497650 12:83371470-83371492 CATTGAGTAGAGTTGTGCAGTGG + Intergenic
1100585276 12:95973659-95973681 CATAGTAAAGAGTAGTCAATAGG - Exonic
1103124860 12:118412692-118412714 CATAGAGGAGAATAATGCACTGG - Intronic
1104148498 12:126058597-126058619 CTTTAAGAAGAGGAGTGCATTGG + Intergenic
1104160436 12:126174533-126174555 CATAGCCAAGAGAAGTACATGGG - Intergenic
1105797390 13:23868857-23868879 CAGAGAGAAGAGTACTGCTTAGG - Intronic
1106738310 13:32611307-32611329 CATAGAGAAGAGAAGGGTTTGGG - Intronic
1107586051 13:41849586-41849608 CATTGAAAACAGAAGTGCATAGG + Intronic
1110808039 13:79780893-79780915 CATAGAGAAGTGAAGTGGCTAGG + Intergenic
1111722399 13:91963181-91963203 TATAGAGCTGAGTAGTGCTTAGG + Intronic
1114889515 14:26900325-26900347 CATAGAGACAATTAGTGAATTGG + Intergenic
1115590401 14:34858898-34858920 CAAAGAGAAGAGTAATGCAAAGG + Intronic
1116472851 14:45305841-45305863 CACAGAGAAGAGTGTGGCATAGG - Intergenic
1117195725 14:53338292-53338314 CAGAGGGAAGAGTAGAGCGTAGG + Intergenic
1117706733 14:58477733-58477755 AATGGAGAAGAGAAGGGCATAGG - Intronic
1118617240 14:67582474-67582496 CATAGAGAAGTGAAGTGACTTGG - Intronic
1120251750 14:82067288-82067310 CAAAGAGAAAAGTGGTGCTTGGG - Intergenic
1121398142 14:93646115-93646137 CATTGAGAAGAGAAATGTATTGG - Intronic
1126296388 15:47141436-47141458 CATATAAAACAGTAGTGTATTGG + Intergenic
1127344123 15:58077493-58077515 CATAGGCAAGACTAGTGTATTGG + Intronic
1133146454 16:3790718-3790740 CATAGAGAAGAGAAATGCCAGGG - Intronic
1136866380 16:33759722-33759744 CTTACAGAAGAGAAGTGTATAGG - Intergenic
1138158498 16:54729514-54729536 AAGAGAGAAGAGTACTGGATAGG - Intergenic
1139048729 16:63096693-63096715 AATATAGATGAGTAGGGCATGGG + Intergenic
1139175100 16:64677913-64677935 CTCAGTGAAGAGTTGTGCATTGG + Intergenic
1203105779 16_KI270728v1_random:1356478-1356500 CTTACAGAAGAGAAGTGTATAGG + Intergenic
1203127735 16_KI270728v1_random:1605890-1605912 CTTACAGAAGAGAAGTGTATAGG - Intergenic
1143275211 17:5705287-5705309 CACAGAGAAGAGTGCTGCAGGGG - Intergenic
1146851625 17:36226861-36226883 CAAAGGGAAGAGAAGTGCAATGG + Intronic
1146867534 17:36350738-36350760 CAAAGGGAAGAGAAGTGCAATGG + Intronic
1147070410 17:37951352-37951374 CAAAGGGAAGAGAAGTGCAATGG + Intergenic
1147081934 17:38030877-38030899 CAAAGGGAAGAGAAGTGCAATGG + Intronic
1147097883 17:38154842-38154864 CAAAGGGAAGAGAAGTGCAATGG + Intergenic
1147370661 17:39990387-39990409 CATAGAGAAGAGAACTGAAGTGG - Intronic
1149148929 17:53535773-53535795 GATAGAGAAGAGAAATGTATGGG + Intergenic
1150079584 17:62224939-62224961 CAAAGGGAAGAGAAGTGCAATGG + Intergenic
1153086665 18:1296427-1296449 CATAGAGATGGGCAGTGCAGAGG + Intergenic
1153181848 18:2444325-2444347 CATAGAGTAGAGTAGAGCAAGGG + Intergenic
1156896344 18:42250801-42250823 CATCGAGAATGGTATTGCATAGG + Intergenic
1157757015 18:50227886-50227908 CATAGAGAAGAGTAAGGGAAGGG - Intronic
1158895824 18:61911965-61911987 TATATAGCAGAGTAGTGCAGTGG + Intergenic
1160248237 18:77178079-77178101 CATAGAGAAGAGGAGGGGAGGGG - Intergenic
1161066475 19:2240961-2240983 CAGAGAGAAGAGCAGTGGGTGGG - Intronic
1163752225 19:19084644-19084666 CAAAGAGTAGAGTAGGGAATGGG + Intronic
1165098976 19:33427187-33427209 CCTTGAGAAGAGGAGTGCCTTGG + Intronic
925055818 2:856540-856562 CAGAGAGAAGAGAAGAGCCTGGG - Intergenic
926292428 2:11541506-11541528 CATAGAGAAGAGTAGTGCATGGG - Intronic
926966599 2:18421342-18421364 AATGGAGAACAGAAGTGCATGGG + Intergenic
929576754 2:43057046-43057068 CATAGGGCAGGGTAGGGCATGGG - Intergenic
932529413 2:72512020-72512042 CCTAAAGAACAGTAGTGCAAGGG - Intronic
932785662 2:74600104-74600126 TATAGAGAAGAGTTAAGCATGGG + Intronic
932861881 2:75302638-75302660 CATACAGAAGAGTAGAGTAGTGG + Intergenic
933046658 2:77546412-77546434 CCTAGAGGAGGGTAGAGCATAGG + Intronic
934635071 2:95978298-95978320 CTTACAGAAGAGAAGTGTATAGG - Intronic
940322825 2:152395286-152395308 TAAAGAGATGAGTAGTGCTTAGG + Intronic
940565673 2:155357058-155357080 CACAGAGAAGAGTGTGGCATGGG - Intergenic
946045707 2:216819268-216819290 TAGAGAGAACAGAAGTGCATAGG + Intergenic
1170023098 20:11857840-11857862 CATAGAGAAGTGTACAGAATAGG + Intergenic
1170935204 20:20803912-20803934 AATAGAGAAGAGTACTGCATTGG + Intergenic
1173737915 20:45374845-45374867 CATACAGAAGGGTAGTGACTAGG - Intronic
1173927481 20:46791753-46791775 CCCAGAAAAGAGTAGTGCATTGG - Intergenic
1174039746 20:47690518-47690540 CATAAAGCAGAGAAGTGGATAGG + Intronic
1175378946 20:58549305-58549327 CATAGAGAAGAGTTGTCCATGGG - Intergenic
1176152770 20:63601092-63601114 CATAGAGAGAAGTAAAGCATGGG - Intronic
1177083328 21:16669694-16669716 CAAAGAGTAGAGTAGGGAATGGG + Intergenic
1177661764 21:24093377-24093399 CATTGAGAAGAGTACTGTATTGG + Intergenic
1180865481 22:19116481-19116503 CATTGAGCAGAGTGATGCATGGG - Intronic
1184863705 22:47191140-47191162 CAAAGAGCAGAGTAGGACATTGG + Intergenic
1203301424 22_KI270736v1_random:79869-79891 TGTAGTGAAAAGTAGTGCATTGG + Intergenic
949347028 3:3085861-3085883 CATAGAGATGTGTTGTTCATAGG - Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
953156476 3:40379646-40379668 AATACAGAGGAGTAGGGCATAGG + Intergenic
956260973 3:67340987-67341009 CATAGAGAAGGGTATTTCCTAGG - Intergenic
956985571 3:74695536-74695558 GACAGAGATGAGTATTGCATTGG - Intergenic
957258646 3:77871720-77871742 AATAGAGAAGAGTAGAGGAAAGG + Intergenic
957847905 3:85762581-85762603 GAGAGAGAGGAGTAGTGCAGTGG - Intronic
958041592 3:88232443-88232465 CATAGAGAATAGTGGGGAATTGG + Intergenic
959207393 3:103327546-103327568 CATTGAGAAGAGTATTTCCTAGG - Intergenic
959632976 3:108529891-108529913 TATAGAGCAGAGTACTGGATAGG + Intergenic
959748088 3:109800905-109800927 AATAGAGAAGAGGTGTGAATAGG + Intergenic
960912466 3:122663066-122663088 CATAAAGAATAGGACTGCATTGG + Intergenic
965536179 3:169825902-169825924 CATTGAGGAGAGAAATGCATTGG - Intronic
965754406 3:172010837-172010859 CCTAGGGAAGTGTAGTACATTGG - Intergenic
966753816 3:183349341-183349363 TATAGATAAAAGTAGTGCTTAGG - Intronic
967316960 3:188158785-188158807 CATAGAAAAGAGTGGTGAAGAGG - Intronic
967342922 3:188420972-188420994 CATAGAAATGAATAGGGCATGGG + Intronic
967601748 3:191398778-191398800 TATAGTGCAGAGTTGTGCATGGG - Intergenic
967673432 3:192267365-192267387 CATTGAAAAGCGTAATGCATGGG - Intronic
969962864 4:10963336-10963358 TAAAGGGAAGAGTAGTGCATTGG - Intergenic
971573897 4:28249968-28249990 CATAGAGAAAAGGAGTGCCATGG - Intergenic
974731250 4:65869081-65869103 CATAGAGAAGAATATAACATGGG + Intergenic
975282965 4:72584353-72584375 CATAGAGGAGTGTAGTGAGTTGG - Intergenic
976837895 4:89396601-89396623 CACAGAGAAGAGTACTGGAAAGG - Intergenic
977764731 4:100783598-100783620 AATAGAGAAGAGTAGTTAGTAGG + Intronic
979456599 4:120932704-120932726 CACAGAGAACAGCAGTGCAAAGG - Intergenic
980263105 4:130479650-130479672 CAGAGAGAAGATTCATGCATTGG - Intergenic
980671935 4:136020692-136020714 CATAGAAAAGAGTATTGCTAAGG + Intergenic
982293544 4:153804079-153804101 CTTAAAGCAGAGAAGTGCATAGG + Intergenic
982837658 4:160142440-160142462 TATAGGGAAGAGTAGAGAATGGG - Intergenic
983882933 4:172953214-172953236 CATAGAAAAGACTATTGCACTGG + Intronic
985449316 4:190050471-190050493 CAAATAGAAGAGTAGTTCTTAGG - Intergenic
986128594 5:4906276-4906298 CATAGAGAAGGCCAGTGCCTTGG - Intergenic
994787846 5:104187068-104187090 CAAAGTTAAGAGTAGTTCATTGG - Intergenic
996879635 5:128281307-128281329 CATAGGGAAAAGGAGGGCATAGG - Intronic
999487102 5:152007919-152007941 CTTTGAGAAGAATAGTGCCTAGG + Intergenic
1001022042 5:168191310-168191332 CATAGAAAAGAGGAGGGGATGGG - Intronic
1005511330 6:26514294-26514316 CATGGAGGAGAGCACTGCATAGG + Intergenic
1005723998 6:28631110-28631132 GATAGGGGAGAATAGTGCATGGG - Intergenic
1006503744 6:34474938-34474960 CATAGGGAATAGGAGTGCAAAGG - Intronic
1008203358 6:48620243-48620265 CATAGATAAGAGTCATGTATTGG - Intergenic
1010847862 6:80732926-80732948 CATACAGAAGAGTAGTGGGTGGG + Intergenic
1013914590 6:115320344-115320366 CATAGAAAATAGAAATGCATGGG + Intergenic
1015100864 6:129478340-129478362 CAAAGAGAAGATAATTGCATAGG - Intronic
1021743643 7:23715135-23715157 CATAGAGAAGACTAGAGATTTGG + Intronic
1024135835 7:46407039-46407061 CAGTGAGAAGAGAAGAGCATGGG + Intergenic
1024715673 7:52077065-52077087 CAAAGAAGAGAGTAGTGCCTTGG + Intergenic
1027297126 7:76788198-76788220 CATGGAGAAGAGAAGTGGAGTGG - Intergenic
1027364104 7:77439675-77439697 CATAGAGAAGAGTAGTTCCAGGG + Intergenic
1029188901 7:98758340-98758362 CAGAGAGAACAGCAGTGCAAAGG + Intergenic
1029215106 7:98942369-98942391 CAGAGAGAAGAGGAGGGCAAAGG - Intronic
1030922443 7:115408539-115408561 CAGAAAGGAGAGTAGGGCATTGG - Intergenic
1030993491 7:116329722-116329744 TACAGAGAAGATTACTGCATTGG - Intronic
1035148049 7:156840423-156840445 CAGAGAGAACAGTAGTGCCAAGG + Intronic
1035672272 8:1427866-1427888 TATGGAGAAGAGTACTGTATTGG - Intergenic
1036439535 8:8768233-8768255 CATAGAGAATGATTGTGCATGGG - Intergenic
1037837418 8:22222271-22222293 CAGAGGGAAGAGTCCTGCATAGG - Intronic
1038881860 8:31623410-31623432 GACAGAGAAGGGCAGTGCATAGG - Intergenic
1039518465 8:38152131-38152153 CAGAGAGAAGAGGAGGGCCTGGG + Intergenic
1043603022 8:81963594-81963616 TAGAAAGTAGAGTAGTGCATTGG + Intergenic
1044497522 8:92905632-92905654 CCTAGAGTTGAGTAGAGCATGGG + Intronic
1044915257 8:97106746-97106768 CATAGAGAAGAGAAGAGCCCTGG + Intronic
1048187902 8:132261172-132261194 CATTGAGAAAAGTAGGGCATTGG + Intronic
1051284833 9:15485042-15485064 CATAGGCTAGAGTAGTGCAGTGG - Intronic
1052346549 9:27415507-27415529 CACAGAGAAGAATAATGAATGGG - Intronic
1052659914 9:31415893-31415915 CATTGAGAAAAGAAGGGCATAGG + Intergenic
1055746130 9:79447415-79447437 CAAAGAAAAGAGTACTGCAGTGG + Intergenic
1057899056 9:98933530-98933552 CATAGAAAAGAGCATTGGATAGG + Intergenic
1203466421 Un_GL000220v1:92777-92799 CATTGAGAAGAATACTCCATTGG - Intergenic
1186233814 X:7485314-7485336 AATAGAGAAGGGAAGTGCTTGGG + Intergenic
1186930165 X:14380572-14380594 CATAGACAAGAATAGGGGATAGG + Intergenic
1188280494 X:28262133-28262155 CATAGAGAAAGGAAGAGCATTGG + Intergenic
1195111971 X:101658390-101658412 CAGAGACAAGAGTAGAGTATGGG - Intronic
1196156756 X:112438659-112438681 CATAGAGATGAGTAGGACAGGGG - Intergenic
1197456744 X:126685394-126685416 CAGAGAGAAGAGCAGAGAATTGG + Intergenic
1197868458 X:131043482-131043504 CAAAGAGAATAGCAGTGAATGGG - Intergenic
1200078516 X:153564134-153564156 CCTAGAGAAGACCTGTGCATTGG - Intronic
1200385142 X:155882621-155882643 CAGAGAGAAGAGTGGGGGATTGG + Intronic
1200801501 Y:7391367-7391389 CAAAGAGAGGAGTAGAGGATAGG - Intergenic
1202585608 Y:26422850-26422872 CTTACAGAAGAGAAGTGTATAGG + Intergenic
1202608901 Y:26662406-26662428 CAAAGCGGAGTGTAGTGCATTGG + Intergenic
1202610169 Y:26671983-26672005 CAAAGCGGAGTGTAGTGCATTGG + Intergenic