ID: 926292428

View in Genome Browser
Species Human (GRCh38)
Location 2:11541506-11541528
Sequence CATAGAGAAGAGTAGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926292428_926292434 21 Left 926292428 2:11541506-11541528 CCCATGCACTACTCTTCTCTATG 0: 1
1: 0
2: 2
3: 10
4: 163
Right 926292434 2:11541550-11541572 CCGACTCTTTCCAAAGCCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 96
926292428_926292435 30 Left 926292428 2:11541506-11541528 CCCATGCACTACTCTTCTCTATG 0: 1
1: 0
2: 2
3: 10
4: 163
Right 926292435 2:11541559-11541581 TCCAAAGCCCGAGGTCAGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926292428 Original CRISPR CATAGAGAAGAGTAGTGCAT GGG (reversed) Intronic