ID: 926294368

View in Genome Browser
Species Human (GRCh38)
Location 2:11558112-11558134
Sequence CTGTGATTTGGGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926294362_926294368 27 Left 926294362 2:11558062-11558084 CCTTAAAATCCACAAAGTGCTTT 0: 1
1: 0
2: 1
3: 31
4: 320
Right 926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 356
926294364_926294368 2 Left 926294364 2:11558087-11558109 CCTCACAAGCTGAAGTAATTGAA 0: 1
1: 0
2: 1
3: 26
4: 198
Right 926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 356
926294363_926294368 18 Left 926294363 2:11558071-11558093 CCACAAAGTGCTTTCACCTCACA 0: 1
1: 0
2: 4
3: 87
4: 716
Right 926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926294368 Original CRISPR CTGTGATTTGGGAAGATGGA AGG Intronic
902536274 1:17120684-17120706 ATGTGAGTGGGGAAGAGGGAAGG + Intergenic
903197953 1:21707505-21707527 CTGGGATTTTTGAAGATTGAAGG - Intronic
903817101 1:26072213-26072235 CTTTGAGTTGGAAGGATGGAAGG + Intergenic
903938263 1:26911453-26911475 CTGTCATTTGTGCATATGGAAGG - Intronic
903995147 1:27300838-27300860 GGGTGATTTGAGAAGGTGGATGG + Intronic
904492433 1:30869373-30869395 CTTTGATGGGGGAAGATGGCTGG + Intergenic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
908577151 1:65472296-65472318 CTGTCATTTGGGAAAACGGGTGG + Intronic
909110184 1:71465800-71465822 CTGTACTTTAGGAAGATGAATGG + Intronic
910039184 1:82827466-82827488 CTGTGATTTGGGTGGATGATTGG + Intergenic
910191345 1:84599100-84599122 TTTTGATTTGGGATGATTGATGG + Intergenic
910784956 1:90986820-90986842 CTGTGATTAGAGAAGATAGTTGG - Intronic
911210479 1:95133630-95133652 CTGAGAATGGGGTAGATGGATGG + Intronic
911450539 1:98054824-98054846 CTGTGAATTGGGGAGAGGGAGGG + Intergenic
911736988 1:101348033-101348055 CTGTGATTTGAGAGTATGGCTGG + Intergenic
912139945 1:106712260-106712282 CAGTGATTGGGGGAGGTGGAGGG + Intergenic
913187609 1:116383660-116383682 CTTTCAGTAGGGAAGATGGAAGG + Intronic
913396946 1:118381853-118381875 CTGTGGTTTGGTGAGAGGGAGGG - Intergenic
914841780 1:151254695-151254717 CTGTGATTGGTGAAGAGCGACGG + Exonic
915814136 1:158949163-158949185 CTGTGATTTGGGCTGATGGGGGG - Intronic
916593951 1:166224389-166224411 CTGTGGTCTGAGAATATGGATGG + Intergenic
917268047 1:173242714-173242736 ATGTGGTTTTTGAAGATGGAGGG + Intergenic
919061378 1:192638239-192638261 AAGTAATTTTGGAAGATGGAAGG - Intronic
919956674 1:202424272-202424294 GTGTGATTTTGGGAGATGGATGG - Intronic
920434819 1:205940924-205940946 CTGTGTTCTGGGAAGAGGAAAGG + Intronic
921136075 1:212260238-212260260 CTGTGACTAGGTAGGATGGATGG + Intergenic
922350979 1:224734430-224734452 CTGTGATTTGGGCAGAAGGCAGG + Intronic
923143303 1:231179827-231179849 GTGTGAGTTGGGGAGAAGGACGG + Intronic
923284047 1:232474073-232474095 CTGTGAATGGGGAAAAGGGATGG + Intronic
923729693 1:236538468-236538490 CTGTGCTTTGGGTAGCTGGATGG + Intronic
923924566 1:238610121-238610143 GTGTGATATGGGAAGATTGTGGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063608350 10:7542214-7542236 CTCTGTTTTGGGAAGTAGGACGG - Intergenic
1063724492 10:8621857-8621879 CTGGTATTTGGAAAGAGGGATGG - Intergenic
1066249905 10:33623196-33623218 ACGTGGTTGGGGAAGATGGAAGG + Intergenic
1066490757 10:35892213-35892235 CTGTCATTTAGCAAGAAGGAAGG - Intergenic
1068262026 10:54595043-54595065 GTATGGTTTGGGAAGGTGGAGGG - Intronic
1068754017 10:60630595-60630617 CAGTGATCTGGGAGGAAGGAAGG + Intronic
1068769811 10:60808532-60808554 CTGGCATTTGGGAAAATGGCTGG - Intergenic
1070542786 10:77428711-77428733 GTGTGATTGGGGAAGAAAGAGGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071019171 10:81031611-81031633 CTGTGATCTGAGAATATGGTTGG - Intergenic
1073002292 10:100294702-100294724 CTGTGATTAGGAAAGTGGGATGG - Intronic
1073011551 10:100363870-100363892 CTGTGATTAGAAAAGATGTAAGG - Exonic
1073560051 10:104488793-104488815 CTGTGAATTAGGAAGATTTAAGG - Intergenic
1073609826 10:104932083-104932105 CTGTGATTTGGGATCAAGGCAGG - Intronic
1073693163 10:105834257-105834279 CTGGGACTTGGGAGGATGAACGG + Intergenic
1073772691 10:106752684-106752706 CAGTGATATAGGAAGATGAATGG + Intronic
1073949198 10:108786578-108786600 TTGTGCTATGGGAAGAAGGAAGG - Intergenic
1074057078 10:109932250-109932272 CTGTGACTGGGGAGGATGGGAGG - Intergenic
1074967748 10:118507294-118507316 CTGTGATTTGGGGAGAGAAAAGG - Intergenic
1075292208 10:121240358-121240380 CCGTGATTTGGGAAGAGTGGAGG - Intergenic
1077472209 11:2769384-2769406 CTGTGAGTTGGGAGGATGGAGGG + Intronic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1077956071 11:7020847-7020869 CTGGGATTTGGCAAGAAGGCGGG - Intronic
1078741214 11:14067812-14067834 CTGCAAGTGGGGAAGATGGAGGG + Intronic
1079170356 11:18088315-18088337 CTGAGGTTTGGGAATATGGATGG + Intronic
1079181717 11:18199849-18199871 CAGGGATTTGGGAAGGGGGATGG - Intronic
1081576795 11:44323764-44323786 CTGGGAGTTGGTAAGAAGGAAGG - Intergenic
1081856110 11:46304933-46304955 CTGTAATTTGGGAAGATTGTGGG + Intronic
1082268468 11:50144282-50144304 CAGTGATTGGGGAAGCTTGAAGG - Intergenic
1082995211 11:59248787-59248809 CATTGATTTGGCAAGAAGGAAGG + Intergenic
1084002936 11:66307607-66307629 AGGTGCTTTGGGAAGATAGATGG - Intergenic
1084209622 11:67615004-67615026 CTGTGATGGGGGGAGCTGGAGGG - Intergenic
1087069608 11:94064743-94064765 CAGGGCTTTGGGAAAATGGAGGG + Intronic
1087143927 11:94793280-94793302 CTCTGATTTGGTAGGAGGGATGG + Intronic
1088771409 11:113039347-113039369 CTGTAATGCGGGAAGATGAAAGG + Intronic
1089124431 11:116166506-116166528 TTGAGCTTCGGGAAGATGGAAGG + Intergenic
1089419382 11:118319723-118319745 CTTTGATTTGGCAAGGAGGAGGG - Intergenic
1090413560 11:126525660-126525682 CTGTGATTTGGGAATAGCTAAGG - Intronic
1090418857 11:126559568-126559590 GTGTAATTTAGGTAGATGGAAGG + Intronic
1091708277 12:2715681-2715703 CTGTGGTCTGGGAAGATGATTGG - Intergenic
1092001243 12:5034046-5034068 CTGTGAGTTAGGAAGCTGTAGGG - Intergenic
1092783884 12:12010727-12010749 GTGTGTTTAGGGAAGATGGATGG - Intergenic
1093183521 12:15994076-15994098 CTGTGATTTTGGAATATGTTGGG - Intronic
1094450908 12:30582328-30582350 TTGTAATTTGGGGTGATGGATGG + Intergenic
1095313537 12:40729735-40729757 CAATGATTTGTGAAGGTGGATGG + Intronic
1095549009 12:43410637-43410659 CTATTATTTGGCAATATGGAGGG + Intronic
1095644748 12:44530384-44530406 CTGTTAATTGGAAAGTTGGAAGG + Intronic
1096576792 12:52557847-52557869 CTGAGATCTGGGAAGATTTAGGG + Intergenic
1097964308 12:65562679-65562701 CACTGTTTTGGGAAGAAGGAGGG + Intergenic
1097969147 12:65613693-65613715 CAGGGTTTTGGGAAGATGGAAGG + Intergenic
1098447054 12:70576646-70576668 CTGTGATTTTGAAAGGTGGGGGG + Intronic
1098567284 12:71950923-71950945 CTGGGACTTGGGAGGATGAAGGG - Intronic
1098597120 12:72286827-72286849 CCGTGTTTGAGGAAGATGGATGG + Exonic
1099207915 12:79749145-79749167 CTGTGATGGGGGAAGAGGAAGGG + Intergenic
1100797560 12:98198378-98198400 CTGAGATTTTGGAGGATGGAGGG - Intergenic
1101905320 12:108820437-108820459 CTGTGACTCGGGTAGATGGTGGG - Intronic
1102352028 12:112200091-112200113 CTGTGATTTGGGAGGACTGATGG - Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102746648 12:115254943-115254965 CTGGGATTTGGAAAGAGAGAAGG + Intergenic
1103659679 12:122503745-122503767 CTGTGCTCTGGGAAAATGAAAGG + Intergenic
1103842421 12:123875916-123875938 CTGGGTTTTGGGAGGATGAAAGG + Intronic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104630450 12:130397120-130397142 CTCTGATTTGGGAGGTGGGAGGG - Exonic
1106740784 13:32638798-32638820 CTGGTATTAGGGAAGAGGGAGGG + Intronic
1107671232 13:42748374-42748396 CTAAGATTAGGGTAGATGGATGG + Intergenic
1108513097 13:51172694-51172716 CTTTGAATTGGGAAGAAGGGCGG - Intergenic
1110155625 13:72313355-72313377 CTTTCTTTTGGGGAGATGGAAGG - Intergenic
1110941967 13:81362517-81362539 CTGTGGGTTGCGAAGATGGTGGG - Intergenic
1111302150 13:86361233-86361255 CTTTGAATTGGGAAGAAGGGCGG - Intergenic
1112547609 13:100386813-100386835 CTGTGAGTTGGGGAGCTGGAGGG + Intronic
1112795931 13:103056963-103056985 CTGTGATTTAGGGTGATTGAGGG - Intronic
1113228542 13:108186011-108186033 CTGTGTTTTGGAAAGCTCGAAGG + Intergenic
1113625421 13:111792772-111792794 CTTTGTTTGTGGAAGATGGAAGG - Intergenic
1114192937 14:20454492-20454514 CTAGTATTTAGGAAGATGGAAGG + Intronic
1114660876 14:24343459-24343481 GTTTAATTTGGGAAGATGAAAGG + Intergenic
1115396485 14:32914835-32914857 ATGTGACTTGGGCAAATGGAAGG - Intergenic
1115549189 14:34489774-34489796 CTGTGTTTTGGTTAGGTGGAGGG + Intergenic
1116062315 14:39939377-39939399 CTGGGATTTGTGAAGATTTATGG + Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118866744 14:69710361-69710383 CAGCCATTTGGGAAGATGGTGGG + Intronic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1119473780 14:74915353-74915375 CTTCCATTTGGGAAGATGGAAGG + Intronic
1120103625 14:80470839-80470861 CTGTGATTTGGGCCAATGGGGGG + Intergenic
1121559195 14:94862007-94862029 CTGTGGGTTGGTAAGAGGGAGGG + Intergenic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG + Intergenic
1124998397 15:34746370-34746392 ATGTGAGTTGGGGAGGTGGAAGG - Intergenic
1125055144 15:35350778-35350800 CTGTGGTTAGAGAAGATAGATGG + Intronic
1126649592 15:50908094-50908116 CTGGGATTTGGGGAGGTGGGCGG - Intergenic
1126667844 15:51091099-51091121 CTATGATTAGGGAAGAGGCAAGG - Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1127764131 15:62168038-62168060 GTGTGATTTAAGAATATGGAAGG - Intergenic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1129106028 15:73307904-73307926 ATGAGATTTGGGGAGCTGGAGGG - Intergenic
1129518094 15:76169122-76169144 CTGGGCCTTGGGAAGACGGAAGG + Intronic
1130123432 15:81071873-81071895 ATGTCATTTGGGAAGATGGATGG - Intronic
1131547248 15:93326200-93326222 TTGTGCTTTGGGAAGAAAGAAGG - Intergenic
1131635814 15:94231754-94231776 CTGGGAGTTGGGGAGCTGGAGGG + Intronic
1131684803 15:94757299-94757321 CTTTGGATTGGGAAGAAGGACGG - Intergenic
1132010779 15:98274435-98274457 CTGTGACTTTGGATGATGGCTGG - Intergenic
1133027050 16:2993063-2993085 CTGGGATTTGGGAATAGGAATGG + Intergenic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134253430 16:12591437-12591459 ATGTGCTTTGCAAAGATGGATGG + Intergenic
1135785837 16:25348098-25348120 CTGTGAATTAGGTAGAGGGATGG - Intergenic
1136045734 16:27613592-27613614 CTGTGTTCTGGGAAGATGCATGG + Intronic
1136376893 16:29871222-29871244 CTGTGGGTTGGGGAGATGGCAGG + Exonic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1137502725 16:49023934-49023956 CTTTCATTTGGGAAGGAGGAAGG + Intergenic
1137833010 16:51562317-51562339 CTTGGATATGGGAAGAAGGAGGG + Intergenic
1137919128 16:52468629-52468651 CTGTGATTTGGAAAGAATGCTGG + Intronic
1138597024 16:58034637-58034659 CAGTGATTGGGGAAGCTGGGGGG - Intronic
1140592160 16:76366434-76366456 GTCTGTTTTGGGAACATGGATGG - Intronic
1141425000 16:83939169-83939191 CTGTGAGTCGGGAGGATGAAGGG + Intronic
1142179191 16:88659031-88659053 CTTTTGTTTGGGAAGGTGGAGGG - Intronic
1143182012 17:4989240-4989262 CTGTAATATGGAAAGAAGGAGGG - Intronic
1143934661 17:10470422-10470444 CTGTGGATTGAAAAGATGGATGG + Intergenic
1144457372 17:15430218-15430240 CTGTGCTTTGGGAAGCTGCAGGG + Intergenic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1145904506 17:28508828-28508850 CTGTGATTTGGAAGGACAGAGGG - Intronic
1145997755 17:29114222-29114244 GTTTCATTTGGGATGATGGAGGG - Intronic
1146664453 17:34688352-34688374 TTGTAATTTGGAAAGAGGGAAGG + Intergenic
1146853461 17:36243451-36243473 ATGTGATGTGGGAAGATCCACGG - Intronic
1146869371 17:36367343-36367365 ATGTGATGTGGGAAGATCCACGG - Intronic
1147072245 17:37967967-37967989 ATGTGATGTGGGAAGATCCACGG - Intergenic
1147083770 17:38047504-38047526 ATGTGATGTGGGAAGATCCACGG - Intronic
1147099716 17:38171471-38171493 ATGTGATGTGGGAAGATCCACGG - Intergenic
1147214368 17:38890789-38890811 GTGTGAATGGGGAAGAGGGAGGG - Intronic
1147444134 17:40464481-40464503 CTTTCATTTGGGAGGAAGGAAGG + Intergenic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1151097232 17:71512144-71512166 CTATCATTTTGGAAGATGGCTGG - Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151873427 17:76851842-76851864 CTGAGATCTGGGATGATGGATGG + Intergenic
1151897042 17:76987447-76987469 CTCTGATGAAGGAAGATGGAGGG + Intergenic
1153799848 18:8659433-8659455 CTGTGAATTGGGACGATGCGCGG + Intergenic
1154063272 18:11083469-11083491 CTGTGGCTTGGGGAAATGGAGGG + Intronic
1154163478 18:11996915-11996937 GTGTGGTGTGGGAAGATGCAGGG - Intronic
1155750885 18:29421451-29421473 CTATGATTTGGGCTGATGGGGGG - Intergenic
1155780848 18:29832804-29832826 CTGAGAGTTGGGAGGATGAACGG + Intergenic
1155780895 18:29833967-29833989 CTGAGAGTTGGGATGATGAACGG - Intergenic
1157465944 18:47945074-47945096 GTGTGACTTGGTGAGATGGAGGG + Intergenic
1157535972 18:48457536-48457558 CTGTGATCTGAGAAGAGGGGAGG - Intergenic
1158603039 18:58871120-58871142 CTGTGCTTTAGCAAGTTGGAGGG + Intronic
1159892095 18:73962529-73962551 CTGTGAATTTGGAAGATGCTTGG + Intergenic
1160040481 18:75340394-75340416 ATGTGAACTGGGAGGATGGACGG + Intergenic
1160282112 18:77500707-77500729 ATTTGATTTGGGAAACTGGAAGG - Intergenic
1160944538 19:1635251-1635273 CTGTTCTTTGGGAGGAGGGAAGG - Intronic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1161712206 19:5855246-5855268 CTTTGGTTTGGGAAGAAGGGCGG - Intergenic
1161862656 19:6809770-6809792 CTAGGATTTGGGAACAGGGATGG + Intronic
1162087985 19:8260012-8260034 CTGTGAGATGGGGAGATGGTGGG + Intronic
1162158589 19:8696298-8696320 ATGTGTTTTGGGAAGATGGATGG + Intergenic
1162700683 19:12512659-12512681 CTGTGCCTAGGGAAGATGAAAGG + Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1163240330 19:16058857-16058879 CTGTGATTTGGGAGTGTAGAGGG + Intergenic
1166853123 19:45769711-45769733 CAGAGCTTTGGGCAGATGGAGGG + Exonic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
1168176272 19:54630222-54630244 CTTTGATTTGGGGAGTTGGGGGG - Intronic
1168531182 19:57130654-57130676 CTGTGATGTATGAAGATGGAGGG + Exonic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
929057173 2:37888411-37888433 ATGTGATGGGGGAAGATGGCGGG + Intergenic
929332164 2:40695210-40695232 ATCTGATTTGGGAAATTGGATGG + Intergenic
929565452 2:42981032-42981054 CAGGGATTTTGGAAAATGGAAGG + Intergenic
930058709 2:47271690-47271712 GTGAGGTGTGGGAAGATGGAGGG + Intergenic
932288386 2:70554779-70554801 CTGGAATTTGGGGAGGTGGAGGG + Intergenic
932441870 2:71742720-71742742 CAGTGAGTTGGGGAGATGGAGGG - Intergenic
933840498 2:86282462-86282484 CTGTGGTCTGGCAACATGGAAGG + Intronic
933854987 2:86404319-86404341 CACTGAGTTGGGAAGGTGGAGGG - Intergenic
933928939 2:87128167-87128189 CTGTGTTTTGGTAAGAAGGAAGG - Intergenic
934000273 2:87703953-87703975 CTGTGTTTTGGTAAGAAGGAAGG - Intergenic
935106017 2:100044435-100044457 CTATGACTTGGGTAGATAGATGG - Intronic
936364006 2:111835234-111835256 CTGTGTTTTGGTAAGAAGGAAGG + Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
937099190 2:119255567-119255589 CTGTTATTTGGAAAAAAGGAGGG - Intronic
937660888 2:124428453-124428475 TTGAGCTTTGGGAAGATGGTGGG + Intronic
938033412 2:128015380-128015402 CTGTGGTTTGGGAGAATGTAAGG - Intronic
938464846 2:131518778-131518800 CTGTGATCTGGCAGGAAGGAGGG + Intergenic
940799593 2:158118733-158118755 CTGAGATTTGGGAAGAGAAATGG + Intronic
943296869 2:186151443-186151465 CTTTAATTTGGAATGATGGAGGG - Intergenic
944093629 2:195942331-195942353 TTGTTATTTGAGAAGAAGGAAGG + Intronic
945294363 2:208156079-208156101 CTTGTATTTTGGAAGATGGATGG + Intergenic
945730357 2:213524931-213524953 CTGTGATTTGGGAAGGGTCAGGG + Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
1170898269 20:20436125-20436147 CTGTGATTTAGGCAGACAGACGG - Intronic
1173046533 20:39517933-39517955 GTGTGATTTGGGGGCATGGAGGG - Intergenic
1173290800 20:41713311-41713333 GTGTGTCTTGGGAAGAAGGAAGG - Intergenic
1173331147 20:42077391-42077413 CTCTGTTTGGGGAAGATGCAAGG - Exonic
1174494408 20:50930228-50930250 CTGAGATTGGGGAAAAGGGATGG + Intronic
1175451625 20:59073633-59073655 CTCTTTTTTGGGAAGATGGGTGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175967590 20:62667220-62667242 CTGTGAAGTGGGAAAAAGGAAGG + Intronic
1176175705 20:63722990-63723012 CTGTGCTATAGGAAAATGGAGGG - Intronic
1177119663 21:17124321-17124343 CTTTGGTTTGGGAAGAAGGGTGG - Intergenic
1177733342 21:25057897-25057919 ATGAAATTTGGGAAGAGGGAGGG + Intergenic
1178071321 21:28970668-28970690 CTGTGATTCGTGAAGGTGGTCGG - Exonic
1178584554 21:33861253-33861275 CTGTGATGAGGGGAGATCGAGGG + Intronic
1179361776 21:40716270-40716292 CTATTATTTAGGCAGATGGATGG - Intronic
1179387660 21:40957778-40957800 CTTTGAATTGGGAAGAAGGGTGG - Intergenic
1179893447 21:44349369-44349391 CTCTGATCTGGGAGGAGGGAGGG - Intergenic
1181913880 22:26263555-26263577 GTGTGATTTGAGAAGATAAAAGG - Intronic
949444057 3:4114897-4114919 TTGTGATATGGGAAGAAGGCAGG + Intronic
950158478 3:10741689-10741711 ATGTGCTTTGGGAATAGGGAAGG + Intergenic
950567938 3:13782302-13782324 CTGTGATTTGGGGAGAGCGGTGG + Intergenic
950685582 3:14616419-14616441 ATGGCCTTTGGGAAGATGGATGG + Intergenic
951457501 3:22908960-22908982 CTGTGATTTTGGAAGTGTGATGG - Intergenic
951777766 3:26328239-26328261 CTGTGGTCTGGGAAGATGCTTGG - Intergenic
951877112 3:27439784-27439806 CTGTGATTTGGGAAAAGGAAAGG - Intronic
954795582 3:53160010-53160032 TTGAGATTGCGGAAGATGGATGG - Intronic
955019227 3:55102671-55102693 CTGTGAGTTGGGGAGATTGATGG - Intergenic
955021796 3:55128880-55128902 GTGTCATTTTGGAAAATGGATGG - Intergenic
955787691 3:62557347-62557369 CATTGATTTGGGAAGGTTGAGGG + Intronic
956613722 3:71150571-71150593 TTGTGCTTTGGGAAGTTGGAGGG - Intronic
957007205 3:74963581-74963603 CTGTGCTTTAGGGAGCTGGATGG - Intergenic
957233012 3:77545271-77545293 GTGTAATTTGGCAGGATGGAGGG - Intronic
957413441 3:79870024-79870046 TTGTGTTTTAGGAAGATGGTAGG - Intergenic
957863981 3:85998720-85998742 CTGTGATATAGTATGATGGATGG + Intronic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
958969309 3:100593427-100593449 CTGTGATCTGGAAATCTGGAAGG + Intergenic
959372411 3:105544290-105544312 CTTTGATAGGGGAAGATGTAAGG - Intronic
960589799 3:119354288-119354310 GTTTCATTTAGGAAGATGGAGGG - Intronic
962425465 3:135265499-135265521 TTCTGATTTGGGAAAATGGGTGG + Intergenic
962471039 3:135709303-135709325 CTGTTTTTTGGGAGGAGGGATGG - Intergenic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
963642097 3:147873551-147873573 TTGAGATGTGGGAACATGGAGGG - Intergenic
965355617 3:167669486-167669508 TTGTATTTTGGGAGGATGGAGGG + Intergenic
965929094 3:174020143-174020165 CTGTAATTTGGGTAAATGAAAGG - Intronic
966569212 3:181422177-181422199 CTTTTATGGGGGAAGATGGAGGG - Intergenic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967871787 3:194235874-194235896 CTGATATTTGGGAGGCTGGATGG + Intergenic
971262489 4:25069797-25069819 CAGTGCTTTGTGAAGATAGATGG + Intergenic
972158035 4:36189110-36189132 CTGTGATTCAGGAAGATGAATGG + Intronic
972287016 4:37658967-37658989 CTGTGATTTGGGAGTTGGGAGGG - Intronic
972690662 4:41394723-41394745 CTGTAATTGGGGAATATGTAGGG + Intronic
973759917 4:54106126-54106148 CTGTGTTTGGAGAAGATGGGAGG - Intronic
975327221 4:73072138-73072160 CTGTGCTTTGGGAAGCTGAGTGG + Intergenic
976144737 4:82031529-82031551 GTGTGACTGGGGAAGATGGGGGG - Intronic
976147770 4:82059199-82059221 CTGTGATCTGAGAAAATTGAAGG + Intergenic
977171203 4:93765032-93765054 CAGTGCTTTGGGAAGATTGAAGG + Intronic
977265895 4:94853745-94853767 CAGTGATTTGGAGAAATGGAGGG - Intronic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
978160763 4:105545311-105545333 TTGTGATTTCAGAAGAGGGAGGG + Intergenic
979210053 4:118089718-118089740 CTTTCATTTGGGAAGATGTTGGG - Intronic
980845195 4:138315927-138315949 CTGTGATTAGGATAGATGGATGG - Intergenic
981092687 4:140747802-140747824 CTTTGGGTTGGGACGATGGAGGG + Intronic
985382314 4:189407430-189407452 CTGTGCTTTGGGCAGAAGGCAGG + Intergenic
985526304 5:404247-404269 CAATGATTTGGGAACATGCATGG - Intronic
986458084 5:7940516-7940538 ATCTGATTTGGGAGGATGGGAGG + Intergenic
987074209 5:14365599-14365621 TTGTGTTTTGGCAAGAAGGAGGG - Intronic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
988148217 5:27338774-27338796 CTGTAACTTGGGAAGTTTGATGG + Intergenic
988498291 5:31763137-31763159 CTGTGTTTTTGGAAGCTGCAGGG + Intronic
990825981 5:59898396-59898418 CTATAATTTGGGAAGATGGGGGG + Intronic
992023754 5:72650961-72650983 TTTTGATTTGGGAAGAAGAAGGG - Intergenic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
992974719 5:82103047-82103069 GGATGAGTTGGGAAGATGGAAGG - Intronic
993879237 5:93343498-93343520 CAGTGGTTTGAGAATATGGAGGG - Intergenic
994564856 5:101430729-101430751 GTCTTATTTGGGAACATGGATGG + Intergenic
994621982 5:102174622-102174644 TTTTAGTTTGGGAAGATGGAGGG + Intergenic
995238183 5:109854642-109854664 CTATCATTTGGTAACATGGATGG + Intronic
995535056 5:113127155-113127177 ATGTCTTGTGGGAAGATGGATGG - Intronic
996682194 5:126239603-126239625 CCCTGATGTTGGAAGATGGAAGG + Intergenic
997200564 5:132007613-132007635 CAGTGTTGTGGGAGGATGGAAGG + Intronic
997665241 5:135625298-135625320 CTGTGTGCTGTGAAGATGGAGGG + Intergenic
998227126 5:140335759-140335781 CCATGATTTGGAAAGATTGAGGG + Intronic
999591347 5:153150526-153150548 CTGTGATTTGAGAGTATGGTTGG - Intergenic
999659010 5:153839291-153839313 CTGTGAATTGGGGAGAATGATGG + Intergenic
999815005 5:155167329-155167351 CTGTGATCTCAGAAGAGGGAAGG + Intergenic
999987649 5:157019975-157019997 CAGGGATTTGGGGAGAGGGAAGG + Intergenic
1000892620 5:166817405-166817427 TTGTGATTTTGGAAGGTTGAGGG + Intergenic
1002096092 5:176831788-176831810 GTGGGCTTTGGGAAGATGGTGGG - Intronic
1002342913 5:178528375-178528397 CTGTGACCTGGGATGAGGGAAGG - Intronic
1002892256 6:1345484-1345506 CAGTGCTTTGGGAAGCTGAAAGG + Intergenic
1003162096 6:3644802-3644824 CTGTGACTTCTGAAGAAGGAAGG + Intergenic
1003170520 6:3718514-3718536 GGGTGATTAGGGTAGATGGATGG - Intergenic
1003257467 6:4487130-4487152 CTGTGATTTTGGCAGGTTGAAGG - Intergenic
1003439977 6:6131487-6131509 CTGGGCTCTGCGAAGATGGAGGG + Intergenic
1004011019 6:11687374-11687396 CAGGGATTTGGGGAGAGGGAAGG + Intergenic
1005400547 6:25428958-25428980 ATGTCATTTGTGAATATGGATGG + Intronic
1006188311 6:32192549-32192571 CTGGGATTTGGGAGGAGGGCTGG + Exonic
1007068592 6:39018103-39018125 CTGTGATTTGGGGACAGGGCAGG - Intronic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008632794 6:53379980-53380002 CTTTGATTTGCCAAGATGTAAGG - Intergenic
1009275880 6:61678889-61678911 ATGTGATTTGCTAAGAAGGATGG - Intergenic
1010626257 6:78139107-78139129 CTGTGATTTGGGCCAATGAAGGG + Intergenic
1013855074 6:114562739-114562761 CTGTGGTTTGAGAAGGTGCAGGG + Intergenic
1013883463 6:114933553-114933575 CTGTGATGTGGAAAGAAGAAGGG + Intergenic
1014754855 6:125291819-125291841 CTGTGGTTTGGGTTGATGGTGGG - Intronic
1015278255 6:131405641-131405663 CTTTGAATTGGGAAGAAGGGCGG - Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1015562341 6:134530116-134530138 CTGTGATGTGGGTAGGTTGATGG - Intergenic
1017673725 6:156793183-156793205 CTGTGATTGGAGAAGAAGCAAGG + Intronic
1018077706 6:160231323-160231345 CTTTGGGTTGGGAAGAAGGACGG - Intronic
1018237221 6:161738371-161738393 ATGTGAATTCAGAAGATGGAGGG - Intronic
1019299608 7:296501-296523 CTGTGCTCGGGGAGGATGGAGGG - Intergenic
1019620580 7:1989959-1989981 GTTTAATTTGGGAAGATGCAGGG + Intronic
1020763205 7:12292169-12292191 CTCTGATTAGGGAAGAAGGTAGG - Intergenic
1021205702 7:17777288-17777310 CAGGGACTTGGGAAGAGGGAAGG - Intergenic
1021622556 7:22563101-22563123 CTGTGATATTGGAATATGGAAGG + Intronic
1022062457 7:26811409-26811431 GTGTGGTTTGGGGATATGGATGG - Intronic
1022191535 7:28021013-28021035 CTGGGATTCTGCAAGATGGAGGG - Intronic
1022358474 7:29638052-29638074 CTGAGATCTGGGAACAAGGAGGG + Intergenic
1024124060 7:46273622-46273644 CTGGGATTTGGGTTGAGGGAGGG - Intergenic
1024440403 7:49409665-49409687 TTGTGATTTTGGCAGAGGGAAGG + Intergenic
1028953684 7:96665216-96665238 CTGGGATTTGGAAAGCTAGAGGG - Intronic
1029317266 7:99726095-99726117 CTTTGGGTTGGGAAGAAGGATGG - Intronic
1029707596 7:102283969-102283991 CTGTGCTCTGGGACGCTGGAGGG + Intergenic
1030106932 7:105995482-105995504 CTTTGATTTGGGCAGATGCTGGG + Intronic
1030246590 7:107389740-107389762 CTATGATTTGGGCCGATGGGGGG + Intronic
1031223993 7:119010939-119010961 TTGTGATTTGAGAAAATGGCAGG - Intergenic
1031999185 7:128253875-128253897 CAGTGCTGTGGGCAGATGGATGG + Intronic
1033179693 7:139163713-139163735 CAGGGCTTTGGGAAGATTGAAGG + Intronic
1033225228 7:139556498-139556520 TTGTGTTTTGGGTAGATGTAGGG + Intergenic
1033418584 7:141185812-141185834 CTGTGATATGGAAAGGGGGAAGG - Intronic
1033582582 7:142750790-142750812 CTGAGGTTGGGTAAGATGGATGG + Intronic
1033584139 7:142761710-142761732 CTGAGGTTGGGTAAGATGGATGG + Intronic
1034370834 7:150594899-150594921 CTGTGGGTTGTGAAGATGGTGGG + Intergenic
1035272828 7:157730554-157730576 ATGGGATTTTGGCAGATGGAGGG - Intronic
1037291031 8:17349589-17349611 ATGGGATTTGGGAAGGTGGAGGG - Intronic
1037422890 8:18722764-18722786 ATGAGATTTAGGCAGATGGAAGG - Intronic
1037964188 8:23120538-23120560 CTCTGATTGAGGGAGATGGAAGG - Intergenic
1038163058 8:25058863-25058885 AAATGATTTGGGAAGCTGGATGG - Intergenic
1038330240 8:26602492-26602514 CAGTGATGTGGGCTGATGGAGGG + Intronic
1039268852 8:35858453-35858475 CTGGCCTTTGAGAAGATGGATGG + Intergenic
1041354366 8:56984717-56984739 GTCTGATTTAGGAAGATGGCAGG - Intronic
1042779783 8:72478351-72478373 CTGTGATTTGAGCAGATGCTTGG - Intergenic
1046359630 8:113132773-113132795 CTGTGCATTGGGAATAGGGAAGG + Intronic
1046371894 8:113320523-113320545 CAGTGTTTTGTGAAGATGGCTGG - Intronic
1047423343 8:124725311-124725333 CTCTGGTTTCAGAAGATGGAGGG + Intronic
1047802634 8:128325821-128325843 CTGTGGTCAGGGAAGATGAATGG + Intergenic
1048637100 8:136308946-136308968 ATGTGATCTGGGAAGTCGGAAGG + Intergenic
1048782972 8:138021915-138021937 CTTAGATTTCGGAAGATGTATGG + Intergenic
1048899123 8:139021197-139021219 CTTTGATGTAGGAAGATGGCAGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1050093702 9:2041713-2041735 CTGAGATTTGGGAACAGGAAAGG + Intronic
1051365223 9:16317019-16317041 TTGTGATTTGGGGAGGAGGAGGG + Intergenic
1051684793 9:19646820-19646842 ATGTGTTTTGGGATGAGGGAAGG - Intronic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052557998 9:30044871-30044893 CTGTGAGTTGGGGAGAAGGAGGG + Intergenic
1052939525 9:34121607-34121629 GTGTGATTTGAGGAGAAGGATGG - Intronic
1057063885 9:92030087-92030109 CAGTGTTTTGGAAAGATGCATGG + Intergenic
1059715288 9:116907601-116907623 GTGTGATTAAGAAAGATGGATGG + Intronic
1060116999 9:120949830-120949852 CTGGGATTTGGGTAGGTGGGAGG - Intergenic
1060246151 9:121947929-121947951 CCGTGCTTTTGGAGGATGGAAGG + Intronic
1062249447 9:135587004-135587026 CTGGGATCTGGGCAGATGCATGG - Intergenic
1187706682 X:22016145-22016167 CAGACATGTGGGAAGATGGAAGG - Intergenic
1188029254 X:25246305-25246327 TTCTGATTTGAGAAAATGGATGG + Intergenic
1188085806 X:25899559-25899581 CTATGATTTGGGCTGATGGGGGG + Intergenic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1190026724 X:46930738-46930760 CTGTGATGGGGGCAAATGGATGG - Intronic
1190708596 X:53049662-53049684 TTGGGATTGGGGAAGATGGGGGG - Intronic
1191123457 X:56929400-56929422 CTGAGATTTGGTAAAATGTAAGG + Intergenic
1191146800 X:57174927-57174949 CTGTGATTTGAGAAGATGCTCGG + Intergenic
1192496999 X:71622792-71622814 CTGTGGTTTGAGGAGATGGGAGG + Intergenic
1192563096 X:72140333-72140355 CTGCCATCTGGGAAGCTGGAGGG - Exonic
1193188289 X:78539091-78539113 CTTTGATTTCAGAAGATGTATGG - Intergenic
1195608785 X:106839748-106839770 ATGTGATTTGGGGAGAATGATGG + Intronic
1195662126 X:107389398-107389420 CCCTGATTTGAGAAAATGGATGG + Intergenic
1196214131 X:113030385-113030407 CTGTCAGTGGGGCAGATGGAGGG + Intergenic
1196407383 X:115378767-115378789 CTGTGCTTTGGTCGGATGGATGG + Intergenic
1197770838 X:130088265-130088287 CTGTGAGTGGAGGAGATGGAGGG + Intronic
1199838571 X:151619673-151619695 ATTTGATTTGGCAATATGGAGGG + Intronic
1199862130 X:151810487-151810509 ATGTGATTAGAGAAGAGGGAGGG + Intergenic
1200823999 Y:7620330-7620352 CTGTAATTTGGGCCGATGGAGGG - Intergenic
1201743216 Y:17345112-17345134 GAGTAATTTGGGAAGGTGGAAGG + Intergenic
1202236056 Y:22710758-22710780 CTGTAATTTGGGCCGATGGAGGG + Intergenic
1202307107 Y:23485410-23485432 CTGTAATTTGGGCCGATGGAGGG - Intergenic
1202563698 Y:26185176-26185198 CTGTAATTTGGGCCGATGGAGGG + Intergenic
1202577869 Y:26346595-26346617 GTGTGATTTTGGGAGATGGATGG + Intergenic