ID: 926297790

View in Genome Browser
Species Human (GRCh38)
Location 2:11581097-11581119
Sequence TGGGCTGCACAGCTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 2, 2: 10, 3: 60, 4: 465}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926297783_926297790 6 Left 926297783 2:11581068-11581090 CCTGTGGTAATGGCGAGTGACCT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG 0: 1
1: 2
2: 10
3: 60
4: 465
926297780_926297790 24 Left 926297780 2:11581050-11581072 CCAAGGAGCAGTGAGACACCTGT 0: 1
1: 0
2: 1
3: 18
4: 184
Right 926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG 0: 1
1: 2
2: 10
3: 60
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926297790 Original CRISPR TGGGCTGCACAGCTGGAGGA TGG Intronic
900119948 1:1044323-1044345 TGAGCCGCACACCTGGAGGGTGG - Exonic
900158014 1:1211300-1211322 TGGGCTGCACACCTGTGGCATGG - Intergenic
900161613 1:1226815-1226837 TGGGCTGCACGCCTGGGCGAGGG - Intronic
900650360 1:3727339-3727361 TGGGGTGTGCTGCTGGAGGAAGG + Intronic
900758057 1:4451226-4451248 GGGGCTGGAGAGCTGGAGGGAGG - Intergenic
900917672 1:5650081-5650103 TGGGCTGCAGTGCTGGAACAAGG + Intergenic
901053416 1:6437329-6437351 CGGTCTGCACAGCTGGTGGGGGG - Intronic
901685697 1:10942222-10942244 TGGGCCACCCAGCTGGAGAAGGG - Intergenic
902543772 1:17173326-17173348 AGGGCTGGACATCAGGAGGATGG - Intergenic
902584225 1:17428148-17428170 TGGGCTGCTCAGTTGAAGAACGG + Intronic
902617598 1:17632310-17632332 TGAGGTCAACAGCTGGAGGAGGG - Exonic
903125108 1:21242497-21242519 TGGGCTGAACACAAGGAGGAGGG + Intronic
903213411 1:21830764-21830786 TGGTCAGCAGGGCTGGAGGAGGG + Intronic
903309998 1:22447690-22447712 TGGGCAGCCCTGCTGGAGCAAGG + Intergenic
904411242 1:30326157-30326179 TCCTCTGCACAGCTGGAGGCCGG + Intergenic
904412314 1:30331890-30331912 GGGGCTGCTCAGCTGGAGAAGGG - Intergenic
904836553 1:33341296-33341318 TGGGCCACACAGGTGGAGGGAGG + Intronic
905007215 1:34719464-34719486 TGGGTAGCAAAGCTGTAGGAAGG - Intronic
905264325 1:36740500-36740522 TGGGGTGCAAAGGTGGGGGAAGG + Intergenic
905881534 1:41467317-41467339 TGGGGTGCACTTCTGGAGAAAGG + Intergenic
907310326 1:53535397-53535419 TGGGCTGGACCGGTGCAGGAGGG + Intronic
907333943 1:53688381-53688403 AGGACTGCACAGCTGCACGAGGG - Intronic
907424798 1:54372836-54372858 AGGGCCACACAGCTGGAGAACGG + Intronic
907474787 1:54698503-54698525 GGGGAGGCAGAGCTGGAGGAGGG - Intronic
907866884 1:58407220-58407242 TGTGCTGCAGAGCTGGGAGAAGG + Intronic
909547370 1:76862823-76862845 TGGACTGGGCAGCTGGAGAATGG - Intergenic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
912972150 1:114293684-114293706 GGGGGTGCACTTCTGGAGGAAGG - Intergenic
913378743 1:118185399-118185421 AAAGCTGCACAACTGGAGGAGGG + Intergenic
914702161 1:150144733-150144755 TGGACTGCACAGCCGAAGCAAGG + Exonic
914755812 1:150561120-150561142 TGGGTTCCAGAGCTGAAGGAAGG + Intergenic
915368149 1:155326767-155326789 TCTGCTGCAGAGCTGGAGGTGGG - Exonic
915914878 1:159934826-159934848 TGGGATGCACAAGGGGAGGAAGG + Intronic
916721461 1:167487447-167487469 AGGGATGCCCACCTGGAGGAAGG - Intronic
916885150 1:169060172-169060194 AGGGCCCCACAGCTGGCGGAAGG - Intergenic
917020701 1:170583126-170583148 TGGGCTGCTCAGAAGGAGAAAGG + Intergenic
917193588 1:172444000-172444022 AGGGTTGCGCAGCTGGGGGACGG + Exonic
917724299 1:177814283-177814305 AGGGCTGCCCAGGGGGAGGAGGG + Intergenic
917887223 1:179398571-179398593 GAGGCAGCACAGCTGGAAGAGGG + Intronic
918011669 1:180592633-180592655 TGGCCTGCAATGCTGAAGGATGG - Intergenic
919395064 1:197035825-197035847 TGGGCTTCACACCTGGGGAAGGG + Intergenic
920377812 1:205518793-205518815 TGGGTGGCACAGAAGGAGGAAGG - Intronic
922532420 1:226354576-226354598 TGTGCCCCACAGCTGCAGGAAGG - Intergenic
923491282 1:234486188-234486210 TGGGATGCAGAGGTGGAGGAGGG - Intergenic
1063198624 10:3766196-3766218 GGGACTGCACTGGTGGAGGAGGG + Intergenic
1064143084 10:12806562-12806584 TGGGCTGCAGAGCTGCAAAAGGG - Intronic
1064338896 10:14469130-14469152 TGGGCTGCTCATATGGAGTAGGG - Intergenic
1065024497 10:21527204-21527226 CGGGCCGGGCAGCTGGAGGAAGG + Intergenic
1065299488 10:24308436-24308458 TGGTCTGGACAACTGGACGAAGG + Intronic
1066659819 10:37728285-37728307 GGGCCTGCACTGCTGGAGGCAGG + Intergenic
1066706547 10:38185660-38185682 TGTGCTGAGCAGCTGGAGGTAGG + Intergenic
1067421838 10:46158959-46158981 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1067507144 10:46865048-46865070 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1067802636 10:49369660-49369682 TTGGCTGCACAACAGCAGGAAGG + Intronic
1068089321 10:52413186-52413208 AGGGCTTCACAGATGGTGGATGG - Intergenic
1069984365 10:72273588-72273610 AGGGTTGCATTGCTGGAGGAGGG - Intergenic
1070306511 10:75242673-75242695 TGGTGTGCACATCTGGAAGATGG - Intergenic
1070813344 10:79309341-79309363 TGGGCTGCACAGCTGGAGTGTGG + Intronic
1070859318 10:79638095-79638117 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1074150441 10:110755041-110755063 TGGGGTGCAAATCTGGATGAGGG + Intronic
1074735246 10:116424586-116424608 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1074853208 10:117455223-117455245 TGGGATGCCCAGCTTGAGGAAGG + Intergenic
1075744253 10:124715561-124715583 TAGGCTGCACACGTGGAGGGGGG - Intronic
1075748643 10:124744947-124744969 TGTGCTGCTCACCTGGGGGAGGG + Intronic
1075998510 10:126896719-126896741 GGGGCTGCAGAGCTGGGGGCTGG - Intergenic
1076048585 10:127314412-127314434 TGGGATGCTCATCTGGAGGCCGG - Intronic
1076340951 10:129744539-129744561 TGGGGTTCACAGCAGGGGGAAGG - Intronic
1076373953 10:129971503-129971525 TGGGCTGCGCACCCGGAGGCCGG + Intergenic
1077435271 11:2535922-2535944 TGGGATGCACAGCTGGGGGCAGG + Intronic
1077532488 11:3103746-3103768 GGGGCTGCAGAGCTGGAAGAGGG - Intronic
1078406132 11:11071428-11071450 TGGGGTGCACAGAAGGTGGATGG + Intergenic
1078786457 11:14499448-14499470 AGGGCTGCTTTGCTGGAGGAAGG - Intronic
1080279473 11:30539966-30539988 TGGGTTGCACAGGGGGAGGAAGG - Intronic
1080699801 11:34635215-34635237 GGGCCTGCTCAGCTGGAGGGAGG - Intronic
1081582931 11:44364960-44364982 TGGGCTGCCCAGCTGTGGGCCGG + Intergenic
1082793676 11:57364935-57364957 TGGGCTGTGCAGCTGAGGGAGGG - Intronic
1084328043 11:68413069-68413091 TGTGCTGCAGAGCTGGGTGACGG - Intronic
1084685861 11:70694870-70694892 TGGGCAGCACGGATGGAGGGTGG - Intronic
1084735781 11:71104368-71104390 TGGGCTTCAGAGATGCAGGATGG - Intronic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1088911106 11:114193138-114193160 GGGGCTCCTCAGCTGGAGGAGGG + Intronic
1089643639 11:119864017-119864039 TGGGCTGCACTCCTGGCGGGAGG + Intergenic
1089672162 11:120064057-120064079 TGGTCTGGACACCTGGAGCAGGG + Intergenic
1090261315 11:125322659-125322681 TTGGCTGCAGAGCTGGAAGGGGG + Intronic
1090619423 11:128548433-128548455 AGGGTTGCACAGCTGGTGGGTGG + Intronic
1091237972 11:134034295-134034317 GCTGCTGCAGAGCTGGAGGAGGG + Intergenic
1091621627 12:2093474-2093496 TGAGCTGCACAGATGGAAGTGGG + Intronic
1091663748 12:2403695-2403717 TGGACTGGAGAGATGGAGGAGGG - Intronic
1092173038 12:6385115-6385137 GGGGCGGCACAGCTGGCAGATGG - Exonic
1093957321 12:25236012-25236034 TGGGCTGCACAGCCGGAAGGAGG - Intronic
1096243971 12:49974225-49974247 TGGTCTCCTCAGCTGGAGGGGGG - Intronic
1096518898 12:52173254-52173276 TGGGCTGCAGAGTTGGAGATGGG - Intronic
1096546802 12:52345676-52345698 AGGGCTGGGCTGCTGGAGGAGGG + Intergenic
1097119667 12:56721448-56721470 TAGGTAGCACAGCTGGAGAAAGG + Exonic
1098311935 12:69157195-69157217 GAGGCTGCAAGGCTGGAGGAGGG - Intergenic
1098987276 12:77026102-77026124 TGGCCTGGTCAGCTGGGGGAAGG - Intronic
1101337247 12:103807537-103807559 GGGGTTGCCCAGCTGGAGGGTGG - Intronic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102952391 12:117039565-117039587 TGGGCGGCACAGGTTGGGGAAGG - Intronic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104200044 12:126579706-126579728 TGAGCTGCACATATGGAGGTAGG - Intergenic
1104360085 12:128124807-128124829 TGGCCTGGGCAGGTGGAGGAAGG - Intergenic
1104416270 12:128598815-128598837 TGCGCTGCTGAGCTGGAGGTGGG + Intronic
1104447286 12:128844704-128844726 TGTCCTCCAGAGCTGGAGGAAGG + Intergenic
1104447403 12:128845249-128845271 TGTGCTCCAGAGCCGGAGGAAGG + Intergenic
1104558791 12:129825378-129825400 TGCACTGCCCAGCTGGAGGACGG - Intronic
1105931446 13:25056539-25056561 TGGGCTCCCCAGCTGTAGCATGG + Intergenic
1106208541 13:27620960-27620982 TGCGCTGGACAGCTGGAGTCGGG + Exonic
1106426762 13:29637703-29637725 TGGGCTTAACAGCTAGATGATGG + Intergenic
1106937160 13:34735651-34735673 TGGCCTGAACAACTGGAGAATGG - Intergenic
1107564458 13:41587659-41587681 TGGGCTGCCAAGCTGAGGGAAGG + Exonic
1108369985 13:49759785-49759807 TGGGCTGCACAGTAGGAGGTAGG - Intronic
1111924436 13:94447464-94447486 TGGGCCACACAGCAGGTGGATGG - Intronic
1112022489 13:95383776-95383798 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1113679635 13:112234397-112234419 TGGGCTGCACAGAGGAAGGGAGG - Intergenic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1114223668 14:20719136-20719158 TGGGCTGCAGAACTGCAGAACGG + Intergenic
1114454388 14:22845807-22845829 TGGGCTGCCCATCGGGAGGCCGG + Exonic
1114645974 14:24256327-24256349 CAGGCTGCTCTGCTGGAGGATGG + Intronic
1115047799 14:29019031-29019053 TGGACTGCAGAGCAGCAGGAAGG - Intergenic
1115965902 14:38887916-38887938 GAGACTGCACAGCTGGTGGAGGG - Intergenic
1117620544 14:57581858-57581880 TGTGCTGCACAGATGTATGAGGG - Intronic
1118112733 14:62740432-62740454 GGGGCTGGACAGCAGGAGGAGGG - Intronic
1118550588 14:66945346-66945368 TGGCCTGCACACTGGGAGGATGG - Intronic
1119121599 14:72084332-72084354 TGGGCTGCATAGCAGGAGGTGGG - Intronic
1119191128 14:72682741-72682763 GGGGCAGCACAGCCTGAGGATGG + Intronic
1119565846 14:75628737-75628759 TGGGCAGCACAGATGGATGAAGG - Intronic
1119609539 14:76050087-76050109 TGGGCAGAAAAGCTGCAGGAGGG - Intronic
1119678877 14:76576872-76576894 TAGCCCTCACAGCTGGAGGATGG + Intergenic
1120792424 14:88597540-88597562 TGAGCTGGAAAGCTGGGGGAGGG - Intronic
1121665808 14:95671232-95671254 TGGGCTGGAGTGATGGAGGAGGG - Intergenic
1122355387 14:101120061-101120083 TGAGCTGGACAGCTGGTGGGTGG + Intergenic
1122782539 14:104149742-104149764 AGGGCTGCACAGCAGGAGGCAGG - Intronic
1122783588 14:104153890-104153912 TGGGCAGCCCTGCTGGTGGATGG + Intronic
1123004914 14:105316496-105316518 TGTGCTGCAGTGCTGGAGCAGGG - Intronic
1123679158 15:22745244-22745266 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1124130953 15:26985200-26985222 TGGGCAGGAATGCTGGAGGAAGG + Intronic
1124141848 15:27084137-27084159 TGAGCAGTTCAGCTGGAGGATGG - Intronic
1124331377 15:28819694-28819716 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1124719498 15:32099089-32099111 TGGGCAGTGCAGTTGGAGGAGGG + Intronic
1125749362 15:42018464-42018486 TGGGCTGCAGCCCTGGAGTAGGG + Intronic
1125896712 15:43308579-43308601 TGGCCTGGCCAGCTGGAGGGTGG - Intergenic
1125921332 15:43527564-43527586 AGGGCTGCATAGCTGAAGGTTGG - Exonic
1126025380 15:44441370-44441392 TGTGGTGCAGTGCTGGAGGAAGG - Intronic
1126692630 15:51299497-51299519 TGGTCAGGACAGCTGGAGAATGG + Intronic
1126705539 15:51401958-51401980 TGGTCTGGACAGCCCGAGGAAGG + Intronic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1129277697 15:74457954-74457976 TGGGCAGTCCAGGTGGAGGAGGG - Intronic
1129462107 15:75704670-75704692 TGGGGTGCACAGCTCGGGGCAGG - Intronic
1129581767 15:76819142-76819164 TGGGCTCCACATCTGGGGGCAGG + Intronic
1129788309 15:78323565-78323587 TGGGCTGCAAGGCTGGGGAACGG - Intergenic
1129987501 15:79931344-79931366 AGGGAGGCACATCTGGAGGAAGG - Intergenic
1130866887 15:87940742-87940764 TGTGCTGCACATCTGTAGGATGG + Exonic
1131050795 15:89346618-89346640 TGGGCTGGCCAGCTCGGGGAGGG - Intergenic
1131146950 15:90020343-90020365 TTGGTAGCAGAGCTGGAGGAGGG - Intronic
1132643925 16:990209-990231 TGGGGGGCACTGCTGGGGGAAGG - Intergenic
1132753437 16:1470034-1470056 GGGGCTGGGCAGCAGGAGGAAGG + Intronic
1133783884 16:8960576-8960598 GGGTCTGAACAGCTTGAGGAAGG - Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135954076 16:26940998-26941020 CGAGGGGCACAGCTGGAGGAGGG + Intergenic
1136350078 16:29701033-29701055 TGGGCAGGACAGCAGGTGGAAGG - Intergenic
1137325503 16:47431258-47431280 TGGGCCACACAGCAGGAGGTGGG + Intronic
1137754093 16:50887815-50887837 TTGGCTGCTAAGCTGGAGGCTGG + Intergenic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1140105343 16:71954833-71954855 TGAGCTCCAGACCTGGAGGAAGG + Intronic
1140298633 16:73734190-73734212 CGGGCTGCACAGCAGGAAGTGGG - Intergenic
1140871464 16:79110432-79110454 TGAGCTACACAGCTGGAGGCAGG - Intronic
1141699041 16:85634072-85634094 GCGGCGGCAAAGCTGGAGGATGG - Exonic
1141784218 16:86187721-86187743 TGGGCTCCACAGATGGGAGAAGG + Intergenic
1142007620 16:87697209-87697231 TGTGCTGCACACCTGAGGGAGGG + Exonic
1142100718 16:88269576-88269598 TGGGCAGCCCAGGTGGAGGCGGG - Intergenic
1142172229 16:88628814-88628836 TGGGCCGCTTGGCTGGAGGAGGG - Exonic
1142289250 16:89185245-89185267 GGGGCTGCCCTGCTGCAGGATGG - Exonic
1142358689 16:89616121-89616143 TGGGGTGCGCAGCAGGAGGCTGG + Intronic
1143161524 17:4874854-4874876 TGGGCGGCACTGAGGGAGGAAGG - Intronic
1143408092 17:6691290-6691312 TGGGCTGGATGGCTGGTGGATGG - Intronic
1143765232 17:9133374-9133396 TGGGCAGCCCAGCAGGAGCAGGG + Intronic
1144673339 17:17145431-17145453 TGGGCGGCACAGGTGGAGGAAGG + Intronic
1144708291 17:17384336-17384358 AGGACTGCCCTGCTGGAGGAAGG - Intergenic
1145303500 17:21656698-21656720 TGGGCTGAGCAGGTGGAGTAGGG - Intergenic
1145346544 17:22045151-22045173 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1145763978 17:27445316-27445338 TGGGGAGCATAGCTGCAGGAAGG + Intergenic
1147310192 17:39591452-39591474 TTGGCTGCATGGGTGGAGGAAGG + Intergenic
1147557618 17:41489368-41489390 TGGGCTGCTCAGCTGGAAAGGGG + Intronic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148251168 17:46082245-46082267 TCAGCTACACAGCTGCAGGATGG + Intronic
1148745204 17:49914208-49914230 AGGGCTGAGCAGCTGGAGGAGGG - Intergenic
1148793046 17:50184300-50184322 TGGGCTGCAGCTGTGGAGGAGGG + Exonic
1149000205 17:51749407-51749429 TGGGCTAGCCTGCTGGAGGATGG + Intronic
1149420611 17:56507531-56507553 TGGGTAGCAAAGCTGAAGGAAGG - Intronic
1149641580 17:58206253-58206275 TGGGGTGGCCAGCTGGGGGAGGG + Intronic
1150072535 17:62164023-62164045 TGGGCTGCACAGGTGCTGGGTGG - Intergenic
1150760861 17:67959678-67959700 TGTGTTGCACAGCAGGTGGAGGG - Exonic
1151356240 17:73560270-73560292 TGGGCTGCAGGGCTGGAGCTGGG + Intronic
1151578656 17:74965187-74965209 TGAGCTGCAGCGCTGGAGGTGGG - Intronic
1151680015 17:75618115-75618137 TGGGTAGAACACCTGGAGGAGGG - Intergenic
1151800321 17:76375703-76375725 TGGGCTGGACAGCTGGGGCTGGG - Intronic
1152034351 17:77862870-77862892 TGAGCTTCACACCTGGAGAAAGG - Intergenic
1152298198 17:79480570-79480592 GGGGCTGTGCAGGTGGAGGAAGG - Intronic
1152651376 17:81495028-81495050 CCTGCTGCACAGCTGGATGAGGG + Intergenic
1152685391 17:81691334-81691356 TGGGCCTCACAGGTGGGGGAAGG - Intronic
1153471053 18:5445721-5445743 AGGGCTGCACAGCAAGAGGTGGG + Intronic
1155362616 18:25017233-25017255 TGGGCTGGTCAACTGCAGGATGG - Intergenic
1156499838 18:37550708-37550730 TGGGCAACAGAGCTGGAGGCCGG + Intronic
1157072784 18:44428948-44428970 TGGGGTACTGAGCTGGAGGATGG + Intergenic
1157596955 18:48869867-48869889 AGGGCTGGGCACCTGGAGGAAGG - Intergenic
1158449469 18:57550909-57550931 TGACCTGGGCAGCTGGAGGAGGG - Intronic
1159251084 18:65877644-65877666 TGGGATGCACAGATGGAGGCAGG - Intronic
1160169519 18:76541338-76541360 CGGGCTGCACATCTGGCAGAAGG + Intergenic
1160517033 18:79484268-79484290 TGGGCTGCAGAGCCCCAGGAAGG + Intronic
1160517518 18:79486731-79486753 TGGGCTGCAGGGCTGCAGGCAGG - Exonic
1160950988 19:1667365-1667387 TGGCCAGCGCAGCTGGAGGGAGG - Intergenic
1161276586 19:3421541-3421563 GGGGCAGCCTAGCTGGAGGAAGG + Intronic
1161281623 19:3448794-3448816 AGGGCGGCACAGCCGGGGGATGG - Intronic
1161503076 19:4628197-4628219 TGGCCAGGACAGCTGGGGGAGGG + Intergenic
1162019374 19:7861754-7861776 TGGGCGGCTCAGATGGGGGAGGG - Intronic
1162440168 19:10687747-10687769 TGGGCTGCACTGCTGGGGCCTGG - Intronic
1162473716 19:10887527-10887549 TGGGCCACAAAGCTGCAGGAAGG - Intronic
1163498558 19:17661819-17661841 TGGGGCGCACAGCAGGAGGTGGG + Intronic
1163633418 19:18428059-18428081 GGGGCTGCACAGCCAGAGGAGGG + Intronic
1165639118 19:37369261-37369283 AGGACTGCAGAGCAGGAGGAAGG + Intronic
1165861840 19:38913153-38913175 TGGGCTGCACAGCTGGCACGTGG - Intergenic
1165871409 19:38975799-38975821 TGGGCCCCGCAGCCGGAGGAGGG - Exonic
1166111452 19:40625772-40625794 TGGGCTGCTCAGCAGGGGAAGGG + Intronic
1167802441 19:51753235-51753257 TGGGCTGCACAGCAGGTGACTGG + Intronic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
925154478 2:1639134-1639156 TGGGCAGCACAGCAGGACGCAGG + Intronic
925868332 2:8248032-8248054 TGGCCTGCACAGCAGGAGAGGGG - Intergenic
926229073 2:10989290-10989312 TGGGCTGGACAGATGGACCAAGG - Intergenic
926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG + Intronic
926817194 2:16810692-16810714 TGGGCTGAACACCCTGAGGAAGG + Intergenic
927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG + Intronic
928130179 2:28643346-28643368 TGGGCAGCCCTGCTGGAGGCAGG - Exonic
928417795 2:31111124-31111146 GGGGCTTCACAGCTGCAGCAGGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929104148 2:38347419-38347441 TGAGCTGAAGAGCTGGATGATGG - Intronic
929446002 2:42001921-42001943 CAGGCTGAACTGCTGGAGGAAGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929601482 2:43207388-43207410 TGGACTGCTCAGCTCTAGGAAGG - Intergenic
931282606 2:60807492-60807514 TGGTGTGCTCAGCTGGAGGCAGG - Intergenic
932144533 2:69306485-69306507 GGGCGTGCACAGCTGTAGGAGGG + Intergenic
934569896 2:95362746-95362768 TGGGCTGCACAGCAGGAGGTGGG - Intronic
934876090 2:97922273-97922295 AGGGCTGCACAGCAGGTGGTGGG - Intronic
936092518 2:109510561-109510583 TGGGCTGCAGAGGGTGAGGATGG - Intergenic
937091114 2:119206830-119206852 TGGCCTGGTCAGCTGGAGGCAGG + Intergenic
937449865 2:121993063-121993085 TGGCCCCTACAGCTGGAGGATGG - Intergenic
938404977 2:131027154-131027176 TTGGCTGTACTGCTGGAGCAGGG - Intronic
938406972 2:131038230-131038252 TGGGCTGCAAGGCTGCAGGAGGG - Intronic
938406979 2:131038259-131038281 AGGGCTGCAAGGCTGCAGGAGGG - Intronic
938406994 2:131038321-131038343 GGGGCTGCAAGGCTGCAGGAGGG - Intronic
938407005 2:131038352-131038374 TGGGCTGCAAGGCTGCAGGAGGG - Intronic
938407012 2:131038381-131038403 AGGGCTGCAAGGCTGCAGGAGGG - Intronic
938407026 2:131038443-131038465 TGGGCTGCAAGGCTGCAGGAGGG - Intronic
938407033 2:131038472-131038494 AGGGCTGCAAGGCTGCAGGAGGG - Intronic
938407051 2:131038534-131038556 GGGGCTGCAAGGCTGCAGGAGGG - Intronic
939392736 2:141589862-141589884 TAGGGTGCACATCTGGAGAAAGG + Intronic
939471711 2:142630682-142630704 TGGGCTTCAAATGTGGAGGAAGG - Intergenic
939723174 2:145680442-145680464 TGGGGTGGACACCTGGTGGAAGG + Intergenic
940341693 2:152588265-152588287 TTGGCTTTAAAGCTGGAGGAAGG - Intronic
940913297 2:159228011-159228033 TGGCCTTCACTGCTGGAGAAGGG - Intronic
942797872 2:179842696-179842718 TTTGCTGAACAGCTGGAGGGAGG - Intronic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
945049250 2:205807558-205807580 TGGGCTGGACAGTTCCAGGATGG + Intergenic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946168309 2:217878672-217878694 TGGGCAGCACGGCCTGAGGAAGG - Intronic
946197412 2:218043391-218043413 TGGGATGAACAGCTGCAGAAAGG - Intronic
947010278 2:225558456-225558478 TGGGCTTTAAAGATGGAGGACGG - Intronic
947658875 2:231851814-231851836 TGGGCTGCACAACTGGTGAGTGG - Intergenic
948505360 2:238424174-238424196 TGAGCTCCACAGCTGCAGGCTGG - Intergenic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
948830083 2:240594402-240594424 GGGGCTGCAGAGCTGGGGCACGG + Intronic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
949056575 2:241931237-241931259 TCGGCTCCACATCTGCAGGACGG + Intergenic
1168833119 20:858252-858274 TGGGCTGCAGGGCTGCAGGGAGG + Intergenic
1171521020 20:25774381-25774403 TGGGCTGAGCAGGTGGAGTAGGG - Exonic
1171555905 20:26082095-26082117 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1172482693 20:35280323-35280345 TGCCCTGAACAGCTGGAGGCTGG + Intronic
1173250869 20:41363649-41363671 GGGGCTGCTCTGCTGTAGGAAGG + Exonic
1173354437 20:42273896-42273918 TGGGTTGCAGACCTAGAGGATGG - Intronic
1173487858 20:43454925-43454947 TGGTTGTCACAGCTGGAGGAGGG - Intergenic
1173742059 20:45407999-45408021 TGGGCTGCAGCACTGGAGGAAGG + Exonic
1173977579 20:47198574-47198596 TGTGATTCACAGCTGGAGGCGGG + Intergenic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1174128343 20:48325127-48325149 TGGGCTGCACAGCTGGAAGAAGG - Intergenic
1175545212 20:59773505-59773527 TGAGCTGCACAGCCTGAGGCTGG - Intronic
1176103592 20:63375617-63375639 TGGGGTGCAGAGCTGGTGGCCGG - Intronic
1176447275 21:6831171-6831193 TTGGCTTCTCAGCTGCAGGAGGG - Intergenic
1176825443 21:13696197-13696219 TTGGCTTCTCAGCTGCAGGAGGG - Intergenic
1177538709 21:22463795-22463817 TGGGTGGCACAGCAGGAGGTGGG - Intergenic
1178297350 21:31421408-31421430 TGGGCCACACAGCAGGAGGTGGG + Intronic
1178520689 21:33286409-33286431 TGGCCAGGGCAGCTGGAGGAGGG + Intronic
1178581880 21:33844953-33844975 TGGGCCACACAGCAGGAGGCGGG - Intronic
1179004835 21:37504280-37504302 GGGGCAGTACAGCAGGAGGAAGG - Intronic
1179116082 21:38493890-38493912 TGGGCTTCACAGCTGAAGCTGGG + Intronic
1179146599 21:38773931-38773953 TGAGCTGCACACATGCAGGATGG + Intergenic
1179576256 21:42310246-42310268 TGCCCTGCACAGCTGGATTATGG + Intergenic
1179597165 21:42450669-42450691 TTGGCTGCCCAGCTTGAGGCCGG - Intergenic
1180046554 21:45308944-45308966 GGGGCGGCTAAGCTGGAGGAGGG - Intergenic
1180050628 21:45329508-45329530 TGAGCAGCGCACCTGGAGGAGGG - Intergenic
1180167226 21:46036439-46036461 TGGTCTGGAATGCTGGAGGAGGG - Intergenic
1181352478 22:22268452-22268474 AGGGCTGCTCAGCAGTAGGATGG - Intergenic
1181626821 22:24128013-24128035 TGGTCATCACAGCTAGAGGAAGG - Intronic
1181759441 22:25048106-25048128 TGGCCTCCCCAGCTGGGGGATGG + Intronic
1181766950 22:25099012-25099034 GGGGCTGCACAGCTGAGTGATGG + Intronic
1181786868 22:25233481-25233503 GGGGCTGCACAGCAGGAGGTGGG + Intergenic
1181818918 22:25460438-25460460 GGGGCTCCACAGCAGGAGGTGGG + Intergenic
1181843186 22:25682995-25683017 TCTGCTGCACAGCTACAGGAGGG - Intronic
1182103849 22:27675126-27675148 TGGGGTGAACAACTGGAGAACGG - Intergenic
1182300339 22:29333493-29333515 TGGGCTTCTCAGCTGGAGCAGGG + Intronic
1182622725 22:31626751-31626773 TGGCCTGCACAGATAGCGGAAGG + Intronic
1182951680 22:34381947-34381969 GGGGCTGCACGGCAGGAAGAAGG - Intergenic
1183102459 22:35592407-35592429 TGGGCAGCAGAGCTGGAGCCGGG - Intergenic
1183587193 22:38759724-38759746 TGTGCTGCCCACATGGAGGAAGG + Intronic
1183639716 22:39085440-39085462 GGGGCTGTAGAGCTGGGGGAGGG - Intronic
1183646835 22:39131965-39131987 AGGGCTCCACAGCTGGAGATGGG + Exonic
1184030996 22:41894658-41894680 TGTGCTAAACAGTTGGAGGATGG - Intronic
1184490052 22:44803251-44803273 TGGGCTCCACAGCTGGTACAGGG + Intronic
1184550720 22:45202964-45202986 AGGGCTGCACAGCTGGGGGCGGG - Intronic
1185206468 22:49541772-49541794 TGGGCTGGACACAGGGAGGATGG - Intronic
949156590 3:834246-834268 TGGGCTTAACACCTGGATGATGG + Intergenic
951405831 3:22296308-22296330 TGGTTTGAACAGCTGGAGGCTGG + Intronic
952314547 3:32221234-32221256 GAGGTTGCACAGCTGGTGGATGG - Intergenic
952314613 3:32221800-32221822 GAGGTTGCACAGCTGGCGGATGG + Intergenic
952489683 3:33855958-33855980 TGGGCTGCACAGTAGGAGGTGGG + Intronic
952789032 3:37184223-37184245 TGGCATGCACAGCTCCAGGATGG - Intergenic
952958679 3:38576451-38576473 TGGGCTGGACAGCTGCACCAAGG - Intronic
953146184 3:40277346-40277368 TGGGCTGCGGGGCTGGGGGAGGG + Intergenic
954711366 3:52506609-52506631 TGGGCTGCAGGGGTGGAGGTGGG + Intronic
955047834 3:55376597-55376619 TGGGCTGCACAGCAGGAGATGGG + Intergenic
956166001 3:66398700-66398722 TAGGCTGCGCAGCAGGAGGGGGG + Intronic
956955878 3:74339197-74339219 TTGCCTGGACAGCTGGAGGGAGG - Intronic
959179103 3:102955923-102955945 TTGGCTGCACACCTGGCTGATGG - Intergenic
959572939 3:107904906-107904928 TGGCCTGCACACTGGGAGGATGG - Intergenic
961328873 3:126127419-126127441 AGGGCCGCACAGCAGGAGAATGG - Intronic
961391578 3:126555445-126555467 TGGGCCGCACAGCAGGAGGTGGG + Intronic
961815605 3:129548610-129548632 TGTGGTACACGGCTGGAGGAGGG + Intronic
962110748 3:132444061-132444083 TGGGCCCCACAGCAGGAGGTAGG + Intronic
962247266 3:133806056-133806078 TTGGCTGCACCGCTGCAGGCCGG + Intronic
962398070 3:135034889-135034911 TAGGATGCACAGCCAGAGGAAGG + Intronic
963908165 3:150791314-150791336 TGGGCTGTTCACATGGAGGAGGG + Intergenic
965191528 3:165536289-165536311 TGGGCAGAATAGGTGGAGGAAGG - Intergenic
965240210 3:166187404-166187426 TGGCCTGCACACTGGGAGGATGG - Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
966925581 3:184642681-184642703 TGTGCTGCAGACCTGGGGGAGGG - Intronic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
967186596 3:186949500-186949522 TGGGCTGCAAATTTGGATGAGGG + Intronic
967534773 3:190589669-190589691 TTGGCTGCACATCTTGAGGCGGG + Intronic
967713579 3:192737734-192737756 TGGGCAGCACAGATGGAGGTGGG + Intronic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
967884119 3:194321840-194321862 TGGGGTGTACAGCGGGGGGAGGG + Intergenic
968279190 3:197462738-197462760 TGGCCAGCACAGCTGGAGCCAGG + Intergenic
968310902 3:197682366-197682388 TGGGAAGGACAGCTGGAGGCAGG + Intronic
968655263 4:1775821-1775843 TGGCCTGCCCAGCTGGAGCATGG - Intergenic
969514741 4:7640761-7640783 TGGGCTCCACAGTTGCAGGAAGG + Intronic
969577866 4:8046937-8046959 TGGGCTCCAGAGCTGTGGGAAGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970402571 4:15731867-15731889 GAGGCTGCAGGGCTGGAGGAGGG - Exonic
972399640 4:38688854-38688876 AGGGCTGCACGCCTGGAGAAGGG - Exonic
972558045 4:40200068-40200090 TGGGGTGCACAGGTGGAGGCTGG + Intronic
973159116 4:46993796-46993818 GGGGCTGCGAAGCCGGAGGAGGG - Exonic
973278763 4:48337394-48337416 AGGGAGGCACATCTGGAGGAGGG + Intergenic
973807480 4:54540016-54540038 TGAGGTGCACAGCTGCAGGATGG + Intergenic
973955612 4:56060227-56060249 TGGCATGAACAGCTGGAGTAGGG - Intergenic
974092197 4:57322713-57322735 TGGGCTCCAGAGCTGGGGGGAGG + Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
975978396 4:80126201-80126223 AGGACTGCTCAGCTGGAGGGTGG - Intergenic
976707652 4:88035802-88035824 TGGTGTGCACAGCAGGAGGGTGG + Intronic
977102141 4:92829983-92830005 GGGGCTGAAAAGCTGGAAGATGG + Intronic
977262439 4:94813876-94813898 TGGTCTGTACAACTGGAAGAAGG + Intronic
977870592 4:102085645-102085667 TGGGCTCCACTGCTGGTAGAAGG - Intergenic
977929400 4:102734772-102734794 TGGACTGCACAGCTGGAGCCTGG - Intronic
978328515 4:107586489-107586511 TGGCCTGCACACTGGGAGGATGG - Intergenic
978347229 4:107784438-107784460 TGGATTGCACAGCAGGAGGTAGG + Intergenic
979636612 4:122962190-122962212 TGGGCTTCACAGCAGGAGGTGGG - Intronic
980326441 4:131352934-131352956 TAGGCTCCACATCTGGGGGAAGG + Intergenic
980988763 4:139719754-139719776 TCGGCTGCCCAGCTTGAAGAGGG + Exonic
981106894 4:140891761-140891783 TGGGCCACACAGCAGGAGGTGGG + Intronic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982146826 4:152403769-152403791 TGGGCCTCACAGCAGGAGGCGGG - Intronic
982943239 4:161585205-161585227 TGGGTTTCCCAGCTGGAGCATGG + Intronic
983275059 4:165606905-165606927 TGGGCTTAACAGCTGGATGATGG - Intergenic
984487439 4:180388780-180388802 TGAGGGGCAGAGCTGGAGGAAGG + Intergenic
985551769 5:537394-537416 TGGCCAGCACGGCTGGAGAACGG - Intergenic
986319503 5:6616810-6616832 GGGGCTGAACAGCTGGCTGAAGG - Exonic
986626912 5:9731099-9731121 TGGTGTGCTCAGCTGGTGGAGGG - Intergenic
986972653 5:13355113-13355135 TAGGCTGCACAGCTGCTAGATGG + Intergenic
988965377 5:36411512-36411534 GGGGCTGGAGAGCTGGGGGAGGG - Intergenic
989790835 5:45399336-45399358 TGAGCAGCAGAGCTGCAGGATGG - Intronic
990330368 5:54719653-54719675 TGGGCTGAGCAGCAGGAGGTGGG + Intergenic
990730483 5:58803614-58803636 TCTGCTGCACAGCTTGAGGTGGG + Intronic
991478491 5:67050077-67050099 TGGGCTACTAAGCTGGAGGCAGG - Intronic
994048273 5:95333230-95333252 TTGGCTCTACAGATGGAGGAAGG + Intergenic
995490569 5:112686994-112687016 TGGGCTGAAAAGCTTGAAGAAGG - Intergenic
995993393 5:118269941-118269963 TGGACTGGACAGCTAGAGAAAGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
997142290 5:131395381-131395403 TGGTCATCACAGCTTGAGGAGGG + Intronic
997670170 5:135664340-135664362 TGGGCTAGAGAGCTGGAGGTAGG - Intergenic
999182331 5:149678581-149678603 GGGACAGCGCAGCTGGAGGAGGG + Intergenic
999594263 5:153184684-153184706 GGGACTCCAAAGCTGGAGGAAGG + Intergenic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001679284 5:173544331-173544353 TGGGAGGCACTGCTGGGGGATGG + Intergenic
1001910829 5:175516133-175516155 AGGGCTGCCCAGCAGGAGGAGGG - Intronic
1002381379 5:178832084-178832106 GGTGCTGCACTGCTGGGGGAGGG - Intergenic
1002514805 5:179749776-179749798 TGGGTTGCACTGCTGCAGTATGG - Intronic
1002602549 5:180362219-180362241 GGGGGTGCCCAGCTGGAGAAAGG - Intergenic
1003151056 6:3549212-3549234 TGGCCAGCAGAGTTGGAGGATGG + Intergenic
1003962539 6:11222157-11222179 TGGGCTGCATAGCTTGGTGAAGG - Intronic
1004353614 6:14912475-14912497 TGGGCTGCGCAGTGGGAGGTGGG - Intergenic
1005320213 6:24646093-24646115 AGGGCAGCACAGGTGGAGCAAGG + Exonic
1006116961 6:31780650-31780672 TGGGCCTCACAGAAGGAGGAAGG + Intronic
1006427662 6:33976324-33976346 GGGCCTCCAGAGCTGGAGGAGGG - Intergenic
1006604428 6:35245858-35245880 TGGGCTGTACAGCTGGTGGTGGG - Intronic
1007091303 6:39186407-39186429 TGGGCTGCACAGCTCTGGGTGGG - Intergenic
1007229708 6:40339764-40339786 TGTGCAGAACTGCTGGAGGAGGG + Intergenic
1007634223 6:43288147-43288169 TGGGGTGGACAGGTGCAGGATGG - Exonic
1009621010 6:66077457-66077479 AGGGTTGCACAGCGGGTGGAGGG - Intergenic
1010682398 6:78811930-78811952 TGGGGAGCACAGCCGGAGGCAGG + Intergenic
1014661251 6:124175277-124175299 TAGGCTGCACATCTGTATGAAGG + Intronic
1015234347 6:130953517-130953539 TGGGGTGCGCAGATGGGGGAGGG + Intronic
1015788939 6:136947098-136947120 TGGGCTGAATACCTGGGGGATGG - Intergenic
1018702150 6:166435830-166435852 AGGGCTGGAAAGGTGGAGGAAGG + Intronic
1018798877 6:167207596-167207618 AGGGCTGCAGAGTTGGGGGAGGG + Intergenic
1019057052 6:169231529-169231551 GGAGCTGCTCAGCTGGAAGAAGG - Intronic
1019564349 7:1672030-1672052 GGGGCTGCACAGCTGGCTGTAGG - Intergenic
1020435854 7:8161616-8161638 TGGGCTGACCAGCTGGAGGGGGG + Intronic
1020904709 7:14050916-14050938 TGGGCTGAATACCTGGATGATGG + Intergenic
1021205299 7:17772838-17772860 AGGTCTGAACAGCTGGAAGAAGG + Intergenic
1022479271 7:30732673-30732695 TGGCGTGCACAGCTTTAGGAAGG - Intronic
1022679050 7:32526943-32526965 TGGCCTGCACACTGGGAGGATGG - Intronic
1022983448 7:35626336-35626358 TGGGCTGCACAGCAAGAGATGGG + Intergenic
1023642827 7:42277917-42277939 TGTGCTCCACAGCTGTAGAATGG + Intergenic
1024758700 7:52568168-52568190 CGGGCTGCACAGCAGAAGGTGGG - Intergenic
1025281496 7:57629331-57629353 TGGGCTGAGCAGGTGGAGTAGGG - Intergenic
1025303234 7:57836184-57836206 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1026869618 7:73842328-73842350 GGGGCTGCAGGGCTGGGGGAAGG + Intronic
1027355304 7:77348483-77348505 GGGCCTGGACAGCTGGGGGAAGG - Intronic
1029524261 7:101085583-101085605 GGGGCGGCACAGCTATAGGAAGG + Intronic
1029861853 7:103581002-103581024 AGGGGTGCACAGCTGGAGATGGG + Intronic
1030058840 7:105607151-105607173 TGAGCTGCACAGCTGGACAGTGG + Exonic
1030319927 7:108155524-108155546 TGGGCAGCATAGGAGGAGGATGG - Intronic
1031202057 7:118700707-118700729 TGGGCAGTACAGCTGGAGTCTGG - Intergenic
1032114169 7:129102905-129102927 TGGCCTGCACTGGGGGAGGATGG - Intergenic
1032580090 7:133096304-133096326 TGGCCTGCACACTGGGAGGATGG - Intergenic
1033710247 7:143935509-143935531 TGGGCTGCACAGCTCTGGAATGG - Exonic
1033712271 7:143960247-143960269 TGGGCTGCACAGCTCTGGAATGG - Exonic
1033756166 7:144399471-144399493 TCAGCTGCAGAGCTGGAGGCAGG + Exonic
1034007723 7:147492316-147492338 TGGGCCTCACAGCAGGAGGCAGG - Intronic
1034226366 7:149486959-149486981 TGGACTGCACAGCAGGGGGTGGG + Intronic
1034234752 7:149557889-149557911 TGAGCTGCAGAGCTGAGGGAAGG + Intergenic
1034330692 7:150279689-150279711 TGGCCTGCAGAGCTGGGGGTGGG - Intronic
1034667351 7:152830160-152830182 TGGCCTGCAGAGCTGGGGGTGGG + Intronic
1034859978 7:154586539-154586561 TGGGCAGCACAGCTTCATGAAGG - Intronic
1034885493 7:154795292-154795314 TGTGCTGCACAGCTTGAGTTTGG + Intronic
1034932499 7:155173695-155173717 GGGTCTGCACAGCAGGAAGAAGG + Intergenic
1035245210 7:157558746-157558768 TGGGCTGTGCACCTGCAGGAGGG - Intronic
1035296629 7:157871046-157871068 TGAGCTGCACAGCTGGGGTAGGG + Intronic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1036190762 8:6668777-6668799 TGGGCTGCACAGCAAGAGTTAGG + Intergenic
1036206983 8:6812762-6812784 TGGGTTACAAAGCTGGGGGAAGG + Intronic
1036382833 8:8249485-8249507 TGGGTTCCACATCTGGAGCAGGG + Intergenic
1036610134 8:10342622-10342644 TGAGCAGCACAGCTGGGGCAGGG + Intronic
1037333232 8:17765257-17765279 AGGGCTGCACAGCAGGAGGTAGG - Intronic
1037690374 8:21176836-21176858 TGGGCTGCACAGCAGGAGGTGGG - Intergenic
1037690385 8:21176884-21176906 TGGGCTCCACAGCAGGAGGTGGG - Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1038401512 8:27287921-27287943 GGGGCTGCAGAGCTGGAGGGTGG - Exonic
1040915445 8:52563777-52563799 TGGGCTGCCCAGCTGGTGTGTGG - Intronic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1045083193 8:98650890-98650912 TAGGCTGCACCTCTGGAGGAAGG + Intronic
1045215644 8:100145878-100145900 AGCGCTGCAGAGCCGGAGGAAGG - Intergenic
1046019026 8:108641485-108641507 TGGACTGCACAGCAGGAGAGAGG - Intronic
1047174358 8:122526602-122526624 TGGGCTGTTCACCTGGAGCAGGG - Intergenic
1047301613 8:123618319-123618341 TGGGCGGCACAGCAGGAGGTGGG + Intergenic
1048306799 8:133290132-133290154 TGGGTGGCAGAGCTGGAGCAAGG - Intronic
1049056893 8:140243888-140243910 TGAGCCGCACAGCAGGAGGTGGG + Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1049715357 8:144087228-144087250 GGGGCTCCACAGTTGGGGGATGG + Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1052059776 9:23946026-23946048 TGGACTCCTCGGCTGGAGGAGGG + Intergenic
1052247085 9:26348882-26348904 TGGGCTTCCCAGGTCGAGGAGGG + Intergenic
1053029972 9:34767294-34767316 TGGGCTCCACCTCTGGGGGAAGG - Intergenic
1054968569 9:71058381-71058403 ACAGCTGCACAGCTGCAGGAGGG + Intronic
1055499603 9:76889766-76889788 GGGGCTGCACAGCTGGGAGAAGG - Intronic
1057604242 9:96487922-96487944 TGGGCTGCAGAGCTGGACAAAGG - Intronic
1057911455 9:99023153-99023175 TGGGCTGCACAGCTGGGAGGCGG + Intronic
1059115778 9:111599274-111599296 TGGACTGCACAACTGGGGGAGGG - Intronic
1060494919 9:124111544-124111566 TGGGCTGCTCCCCTGGAGGAGGG - Intergenic
1060612976 9:124985324-124985346 TGGGCTGCAAATATGCAGGAGGG - Intronic
1061036808 9:128118768-128118790 AGGGATGCAGAGATGGAGGATGG + Intergenic
1061499892 9:130995789-130995811 TGGGCTCCAAAGCTGCAGGGTGG + Intergenic
1061541905 9:131282035-131282057 TCTGCTGCTGAGCTGGAGGAAGG + Intergenic
1061859812 9:133462143-133462165 TGGGTTGGACAGCTGGGGTAGGG + Intronic
1062088709 9:134662651-134662673 TGGGCTGCAGAGCATGAGGGTGG - Intronic
1062325876 9:136012273-136012295 TGAGCCTCACAGCTGGCGGACGG - Intronic
1062480316 9:136748002-136748024 AGGGCTGCAGAACTGGAGGCTGG - Intronic
1062551692 9:137090424-137090446 TGGGCTGGGGAGCTGGAGGCAGG + Intronic
1062598811 9:137311074-137311096 GGGGCTGCAATGCTGGAGGCAGG - Intronic
1062616326 9:137398096-137398118 TGTGCTTCACAGCAGGTGGATGG + Intronic
1203521915 Un_GL000213v1:53360-53382 TTGGCTTCTCAGCTGCAGGAGGG + Intergenic
1185508208 X:644256-644278 TGGTCTCCACGGCTGGAGAAGGG + Intronic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186827476 X:13354774-13354796 TGGCCTCCACAGCAAGAGGAAGG - Intergenic
1187257849 X:17657673-17657695 TGGGCTGCAAGGCTGGAGGATGG + Intronic
1187386211 X:18851142-18851164 TGGTCCGCACAGCAGGAGGTGGG + Intergenic
1187740990 X:22355362-22355384 GGGGATGCAGCGCTGGAGGAAGG + Intergenic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1188625251 X:32276429-32276451 TGGGCTGCACTGCTTGAGGTGGG - Intronic
1189334747 X:40164248-40164270 TGGACTCAACAGCTGGAGGCTGG - Intronic
1189717718 X:43882532-43882554 TGGGCTGCAGAGCTGCGGGCGGG - Intergenic
1191136521 X:57070329-57070351 TGGGCTGCGGAACCGGAGGATGG - Intergenic
1191601968 X:63018300-63018322 TGGGCAGCAAGGCTGGGGGAGGG + Intergenic
1192588173 X:72337244-72337266 TGAGCAGCATAGCTGTAGGATGG - Intronic
1193278504 X:79620460-79620482 TGGGCTGCAGAGCAGGAGGTAGG + Intergenic
1193919455 X:87407248-87407270 TGGGATGCACAGCTGCAGTTTGG + Intergenic
1194869210 X:99107205-99107227 GGGGGTGCAGGGCTGGAGGAGGG + Intergenic
1195165216 X:102213276-102213298 TGGGCTGCACAGCTGCTGCCAGG + Intergenic
1195193642 X:102473815-102473837 TGGGCTGCACAGCTGCTGCCAGG - Intergenic
1195411067 X:104567941-104567963 TGGGCGGCACAGATGGAGAGGGG - Intronic
1195870350 X:109479129-109479151 AGTGCTGCACAGCTGGGGGTGGG + Intronic
1196510227 X:116500324-116500346 TGTGCTGCATGGCTGGGGGATGG + Intergenic
1197972489 X:132129931-132129953 TGGGAAGCACTGCTGGAGGCTGG + Intergenic
1198033184 X:132775149-132775171 TGCTCTGCTCAGCTGGTGGAGGG - Intronic
1198276021 X:135097210-135097232 TGGGCAGAGCAGATGGAGGAGGG - Intergenic
1198310492 X:135423522-135423544 TGGGCAGAGCAGATGGAGGAGGG + Intergenic
1199966302 X:152823791-152823813 TGGACTGGAGAGCTGCAGGAGGG - Intergenic
1200035105 X:153321595-153321617 TGGGCTCCACAGCTTGAAGGCGG - Intergenic
1200052565 X:153442780-153442802 TCGGCTGCCCAGCTGGAGCCTGG + Intergenic
1200157607 X:153985573-153985595 TGGACTGCAGAGCTGGAGGGAGG - Intergenic
1200209624 X:154341532-154341554 TGCGCTGCACCGCGGGAGGGAGG + Intergenic
1200221252 X:154390596-154390618 TGCGCTGCACCGCGGGAGGGAGG - Intronic
1202304743 Y:23456693-23456715 TGAACTTCACAGCTGGAGGTGGG - Intergenic
1202566067 Y:26213898-26213920 TGAACTTCACAGCTGGAGGTGGG + Intergenic