ID: 926301268

View in Genome Browser
Species Human (GRCh38)
Location 2:11604837-11604859
Sequence GCTTCTTGCCACCATGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926301268 Original CRISPR GCTTCTTGCCACCATGTGTG TGG Intronic
900995058 1:6117821-6117843 CATTCTTACCAGCATGTGTGAGG - Intronic
901171263 1:7259362-7259384 GCTTCTTGCTACCCTCAGTGTGG + Intronic
901217566 1:7563199-7563221 GCCGCTTGCCCCCATGTGTGAGG - Intronic
901990947 1:13113505-13113527 GATGCATGCCACCATGTGTAGGG + Intergenic
903656755 1:24954120-24954142 GTCTCTTTCCTCCATGTGTGAGG - Intronic
910608857 1:89117668-89117690 GCTTTTTTCCAGCATTTGTGTGG - Exonic
912757534 1:112336879-112336901 AGCTCTTGACACCATGTGTGAGG - Intergenic
916280863 1:163049602-163049624 GCTTCATGAGAACATGTGTGCGG + Intergenic
916531196 1:165658299-165658321 GCTTCCTACCACAATTTGTGTGG - Intronic
917721367 1:177789427-177789449 GCTTCTGGACACCAGGAGTGGGG + Intergenic
918780551 1:188694343-188694365 CCTTTTTGCCACCTTTTGTGAGG - Intergenic
920228429 1:204454742-204454764 GCTCCTTGCCGCCATGGCTGAGG + Exonic
923889527 1:238197056-238197078 GCTTAAAGCCACCAAGTGTGCGG + Intergenic
1062882983 10:993605-993627 GCCTTATGACACCATGTGTGGGG + Intronic
1063088621 10:2841855-2841877 GCTCCTTGACACCATCTGGGAGG - Intergenic
1063388818 10:5635131-5635153 GCATCTGGCCTCCAGGTGTGCGG - Intergenic
1063762550 10:9096594-9096616 GTTTCTGGACATCATGTGTGAGG - Intergenic
1066242908 10:33555280-33555302 GCTTCTTGCCACCATTTTGCAGG + Intergenic
1069566369 10:69466012-69466034 GCCGGTTGCCACCTTGTGTGGGG + Intronic
1077030365 11:462782-462804 CCTTCTGGACACCCTGTGTGGGG - Intronic
1078458717 11:11496614-11496636 CCTTCTTCCCACCCTCTGTGTGG - Intronic
1082870460 11:57939848-57939870 GCTTGTTGTCACCAGGTGTGTGG - Intergenic
1083623955 11:64062453-64062475 GCTTCCTGCAGCCCTGTGTGAGG - Intronic
1087135713 11:94716832-94716854 GCGGCTTGCCAGCATGTGTGGGG + Intronic
1088416177 11:109591273-109591295 GCTTCTTCCCACCCCGAGTGCGG - Intergenic
1089181220 11:116584142-116584164 TCTTCTCGCCAACCTGTGTGTGG - Intergenic
1089195272 11:116690751-116690773 CCTTCCTGCCACCGTGTGAGGGG - Intergenic
1090324517 11:125873627-125873649 TCTCCTTGTCGCCATGTGTGTGG + Intergenic
1091114778 11:133003188-133003210 GCTTTCAGCCACCATGTTTGTGG - Intronic
1091485958 12:888621-888643 CCTCCTTGCCACCATCTGTAGGG + Intronic
1092781854 12:11994956-11994978 CCACCTTGCCAGCATGTGTGAGG - Intergenic
1101010296 12:100442666-100442688 GCTTATCACCACCATGTGTTAGG - Intergenic
1102560539 12:113758997-113759019 GCTTCAAGCCACCCAGTGTGTGG + Intergenic
1102787937 12:115619422-115619444 GCTTCCTGCCACCTTGCCTGGGG + Intergenic
1102991656 12:117320582-117320604 GCTTTCAGCCACCAAGTGTGGGG + Intronic
1103393871 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG + Intergenic
1104737182 12:131142955-131142977 GGCTCCTGTCACCATGTGTGCGG - Intergenic
1111236058 13:85409728-85409750 GATACTTGCCATCATGTATGCGG + Intergenic
1112750898 13:102582427-102582449 ACTTCCTGCCACCATGTAAGAGG - Intergenic
1113020308 13:105877665-105877687 GCCTCCTGCCACCATGTAAGAGG - Intergenic
1113519214 13:110926884-110926906 GCATTTTGCCACCCTGGGTGGGG - Intergenic
1116353979 14:43904092-43904114 GTTTCTTGAAACCATCTGTGAGG + Intergenic
1118362224 14:65066188-65066210 TCCACTTGCCACCAAGTGTGTGG + Intronic
1118696306 14:68389058-68389080 ACTTCTTGACAATATGTGTGAGG + Intronic
1120841171 14:89086262-89086284 ACTCTCTGCCACCATGTGTGAGG - Intergenic
1122080249 14:99262195-99262217 GGTCCTTGGCACCCTGTGTGTGG - Intronic
1126794214 15:52246576-52246598 GCCTCATGCCATCATGTCTGAGG + Intronic
1131333578 15:91525538-91525560 GGTTCTATCCACCCTGTGTGGGG + Intergenic
1131798355 15:96043875-96043897 CTTTCTTGCCACTGTGTGTGTGG + Intergenic
1132011076 15:98277168-98277190 TCTTCTTGCCACCATCTGGGAGG - Intergenic
1135563705 16:23495837-23495859 GCTCTTGGCCACCATGTGTATGG - Intronic
1142597764 17:1037821-1037843 GCTTCTGGCCACCATGAGCTCGG - Intronic
1143296027 17:5872801-5872823 CCTTCCTTCCACCATATGTGTGG + Intronic
1143720793 17:8807685-8807707 GGCTCTTCCCACCATGTGTTGGG - Intronic
1143909120 17:10233366-10233388 CCATCTTGCCACCATGAGGGAGG - Intergenic
1146177839 17:30677990-30678012 GCTTCAAGCCACCAAGTTTGTGG - Intergenic
1147494771 17:40905264-40905286 GCTTCTTGCCCCCATTCGGGAGG - Intergenic
1149564520 17:57631462-57631484 GCCACTTGCCACCAGCTGTGTGG - Intronic
1151201147 17:72468865-72468887 TCTTCTTGCCACTCTGGGTGTGG + Intergenic
1158405461 18:57155809-57155831 GCTTCCAGCCAGCATGTGTTTGG + Intergenic
1158571763 18:58602340-58602362 GCTTTTTGCCACCCAGTTTGCGG - Intronic
1160808737 19:1003710-1003732 GCTTCTTGGCACGGTGAGTGGGG + Exonic
1161138556 19:2634967-2634989 GCTTCTTGCCTCACTGAGTGCGG - Intronic
1161631523 19:5359033-5359055 GATTCTTGCCAGCCTGAGTGGGG + Intergenic
1161845503 19:6709828-6709850 GCTTTTTACCACCAGCTGTGGGG + Exonic
1162534179 19:11253413-11253435 GCTGCTTGTCACCCTGTGGGTGG - Intronic
926301268 2:11604837-11604859 GCTTCTTGCCACCATGTGTGTGG + Intronic
927004570 2:18834619-18834641 GCATCTTCCCAACATGTGTCAGG + Intergenic
927172358 2:20380841-20380863 GCTTCTTGCCAGGGTGTGTGAGG + Intergenic
927310419 2:21624778-21624800 GCTTCTTGTCACCAGGTGATGGG - Intergenic
928420433 2:31134314-31134336 GCATCTTCCCAGCATGGGTGAGG - Intronic
930225398 2:48787136-48787158 GCTTCTTTCCTCCATGTATAGGG - Intergenic
931158756 2:59665139-59665161 GCTTCTAGCTAGCATGTTTGTGG - Intergenic
934655417 2:96114722-96114744 GCTTCTTGCCCTGCTGTGTGTGG - Exonic
935581788 2:104761953-104761975 GCATTTGGCCACCATTTGTGGGG - Intergenic
936268461 2:111029713-111029735 GCCTCTTGCCAGCAGGGGTGAGG + Intronic
936875414 2:117183787-117183809 GCTTCTGGCCATCTTGTGGGAGG + Intergenic
937030932 2:118739788-118739810 TCTTCTTGCCAGCGTCTGTGTGG - Intergenic
937876598 2:126830623-126830645 GCTGCCTGCCACCAAGTGCGAGG + Intergenic
939541957 2:143505037-143505059 GCTTCTTTCCACTGTGTCTGAGG + Intronic
941424237 2:165322117-165322139 ACATCTTGCCACCATGTGGGAGG - Intronic
942564925 2:177256861-177256883 GCTTGTTCCCACCATCTGTGGGG + Intronic
943181326 2:184545857-184545879 GCTTTATGCCACCAAGTTTGTGG - Intergenic
944053233 2:195495555-195495577 GCATCCTTCCACCATGTGTGTGG + Intergenic
947537118 2:230947140-230947162 GCTCCTTTCCACTATGGGTGTGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948489106 2:238300317-238300339 GCTTCTTCCCTCCATGCATGTGG - Intergenic
948941910 2:241201003-241201025 GCTTCCCCCCACCCTGTGTGTGG + Intronic
1171207998 20:23296082-23296104 GCTCCTGACCCCCATGTGTGTGG + Intergenic
1173902130 20:46598634-46598656 CCCTCTTGGCACCATGTTTGGGG - Intronic
1174034639 20:47661124-47661146 GCATCGGGCCACCCTGTGTGGGG - Intronic
1174931793 20:54824246-54824268 GAGTCTTGCCACCATCTCTGAGG - Intergenic
1175146673 20:56901725-56901747 GCTTTAAGCCACCAAGTGTGTGG + Intergenic
1176306320 21:5125271-5125293 GCTGCTAGCCCCCAGGTGTGGGG + Intronic
1178869416 21:36360447-36360469 GCTTATTGCTGCCATATGTGCGG + Intronic
1179227073 21:39463876-39463898 GTTTTTAGCCACCGTGTGTGTGG - Intronic
1179850738 21:44136759-44136781 GCTGCTAGCCCCCAGGTGTGGGG - Intronic
1184128333 22:42502664-42502686 GCTTCTTCCCACCAGTTGGGGGG - Intergenic
1184137125 22:42555979-42556001 GCTTCTTCCCACCAGTTGGGGGG - Intronic
952014107 3:28936683-28936705 GATGCTTTGCACCATGTGTGTGG + Intergenic
953062073 3:39435479-39435501 GCTTCTTGCACCAGTGTGTGGGG + Intergenic
954760428 3:52869986-52870008 GCTTCTTGCTAGCATGTGCATGG - Intronic
956031375 3:65041422-65041444 GCTTCATGCAGCCATGTGGGGGG - Intergenic
956429825 3:69175273-69175295 ACTTCTTGGTACCATGGGTGTGG + Intronic
957541161 3:81570881-81570903 TCTACTTGCCAGCATGTATGGGG - Intronic
957731716 3:84147428-84147450 AGTTCTTGCCACCATGAGAGTGG - Intergenic
961458953 3:127038249-127038271 GCTGCTTACCACCATGTGGCTGG - Intergenic
963780331 3:149480202-149480224 GCTTCTTGGCAGCATGTCGGTGG + Intronic
963828694 3:149983811-149983833 GCTTTATGCCACCAAGTCTGTGG - Intronic
965991723 3:174827253-174827275 GCTTTAAGCCACCATGTTTGTGG - Intronic
968680500 4:1915652-1915674 GCTGCCTGCAACCATGGGTGGGG + Intronic
971261732 4:25063422-25063444 GCTTTAAGCCACCATGTTTGAGG + Intergenic
978445271 4:108774413-108774435 GCCTCTTCCCACCATGTGATTGG + Intergenic
979297954 4:119054300-119054322 GCCTCTTGCCTCATTGTGTGGGG + Intronic
981366349 4:143907971-143907993 GCTTCCTCACACCCTGTGTGAGG - Intergenic
981386967 4:144143092-144143114 GCTTCCTCACACCTTGTGTGAGG - Intergenic
986383806 5:7211295-7211317 GCTTTATGCCACCAAGTTTGTGG - Intergenic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
997473336 5:134128803-134128825 GCTCCCTGGCCCCATGTGTGAGG - Intronic
998087964 5:139342115-139342137 GCCTCTTTCCACCAAGTCTGAGG + Intronic
999912252 5:156215716-156215738 TTTTATTCCCACCATGTGTGGGG - Intronic
1002298752 5:178246054-178246076 TCTCCTTGCCCCCATGTCTGTGG - Intronic
1002650972 5:180693403-180693425 GCTTCTTGCTATCATGGCTGTGG - Intergenic
1002667614 5:180837439-180837461 GCTTCTTCCTACCGAGTGTGAGG - Intergenic
1003904217 6:10684160-10684182 GCTGCATGCCACCATGCCTGCGG - Intronic
1005677848 6:28174108-28174130 GTTTCATGCCACCAAGTTTGTGG - Intergenic
1005811136 6:29517425-29517447 GCTTCTGTCCACCAGGTGTCAGG - Intergenic
1007309836 6:40936557-40936579 ACTTCTTCCCACCCTGTGTTTGG + Intergenic
1007854986 6:44846372-44846394 GCCTCTTGTCACTATCTGTGTGG - Intronic
1012376825 6:98572022-98572044 TCTTCTTTCCACCATATCTGTGG - Intergenic
1012431388 6:99167255-99167277 GCTTATTGCCAGGATCTGTGTGG + Intergenic
1012460860 6:99458408-99458430 CCTTCTTGCCACTATGTCTCAGG - Intronic
1013472432 6:110476877-110476899 GGCTCTTGGCACCATGTCTGCGG + Intergenic
1014014852 6:116518351-116518373 ACTCCTTGCCACCAACTGTGTGG - Exonic
1020496865 7:8865014-8865036 ACTTCTTTCCCCCAGGTGTGAGG + Intergenic
1024600482 7:50976147-50976169 GTTTTAAGCCACCATGTGTGTGG + Intergenic
1026375615 7:69747383-69747405 ACTTATTAACACCATGTGTGAGG - Intronic
1030937095 7:115598104-115598126 GATTCTTCCTACCATGAGTGTGG - Intergenic
1032305497 7:130730116-130730138 TATTCTTGCCTCCATGGGTGGGG + Intergenic
1034117517 7:148597111-148597133 GCTGCTTACCAACATCTGTGTGG + Intronic
1034943313 7:155245991-155246013 GGTCCTTCCCACCATGCGTGGGG + Intergenic
1035041510 7:155931554-155931576 GTTTCAGGCCGCCATGTGTGCGG - Intergenic
1038632389 8:29258432-29258454 GCTTCTTGGGACCTTGTATGGGG - Intronic
1043926308 8:86040857-86040879 GCTTCTGTCCAGCGTGTGTGTGG + Intronic
1045785868 8:105919359-105919381 GGTTCTTCCCACGATATGTGGGG - Intergenic
1046194073 8:110835714-110835736 TTCTCTTGCCACCATGTGTGCGG - Intergenic
1048709763 8:137195984-137196006 GAATCTGGCCACCATGTTTGGGG + Intergenic
1051468978 9:17413001-17413023 GATTAATGCCACCATCTGTGGGG - Intronic
1053472493 9:38356940-38356962 TCTTCTTGCCACCAGGTTTAGGG - Intergenic
1054986787 9:71270914-71270936 GCTTCTTGCCAACAGTTGTTTGG + Intronic
1055485284 9:76750451-76750473 ACTTCTGGCCACCAAATGTGTGG - Intronic
1055878962 9:80975470-80975492 ACTTCTGGCCACCAAATGTGTGG - Intergenic
1061925056 9:133801965-133801987 GTTTCAAGCCACCATGTTTGCGG + Intronic
1062336801 9:136074842-136074864 GCTTCCTGCCGCTCTGTGTGAGG - Intronic
1188448914 X:30288291-30288313 GCTTCTTGCCTCAATAAGTGTGG + Intergenic
1192521973 X:71810100-71810122 TCTGCTTGGCACCACGTGTGCGG - Intergenic