ID: 926303034

View in Genome Browser
Species Human (GRCh38)
Location 2:11617871-11617893
Sequence TCACTGCTGTGCACAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926303034_926303041 16 Left 926303034 2:11617871-11617893 CCTGCGCCTGTGCACAGCAGTGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 926303041 2:11617910-11617932 TCCCTCCCAGATGCCCCCGATGG 0: 1
1: 0
2: 0
3: 15
4: 154
926303034_926303040 -9 Left 926303034 2:11617871-11617893 CCTGCGCCTGTGCACAGCAGTGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 926303040 2:11617885-11617907 CAGCAGTGAGCTGGTGGTTGGGG 0: 1
1: 0
2: 3
3: 35
4: 333
926303034_926303039 -10 Left 926303034 2:11617871-11617893 CCTGCGCCTGTGCACAGCAGTGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 926303039 2:11617884-11617906 ACAGCAGTGAGCTGGTGGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926303034 Original CRISPR TCACTGCTGTGCACAGGCGC AGG (reversed) Intronic
900400018 1:2469210-2469232 TGCCTGCTGTGGACAGGGGCTGG + Intronic
903310897 1:22454666-22454688 TCACTCCTGTGCTCAGTCCCTGG + Intronic
904300578 1:29550934-29550956 TCCCTGCTGTGCACGGGCAGAGG - Intergenic
904457628 1:30657110-30657132 TCCCTGCTGTGCACGGGCAGAGG + Intergenic
905887581 1:41499780-41499802 TCTCTGCTGTTCTCAGGCCCTGG - Intergenic
908340055 1:63168916-63168938 TCACTGCTGTGCACACACAGGGG - Intergenic
908429674 1:64043727-64043749 TCTCTGCTGTTCAAAGGCGTGGG + Intronic
909203601 1:72725343-72725365 CCACTCCTGTGCACATGCCCCGG - Intergenic
909717662 1:78728616-78728638 GAACTGGAGTGCACAGGCGCTGG - Intergenic
911715589 1:101128960-101128982 TCACTGATGTTCACAGGATCAGG + Intergenic
913379803 1:118197179-118197201 TCAGTGCTGAGCACAGGGCCTGG - Intergenic
916900255 1:169214882-169214904 ACACTGCTGTCCACAGGTGGTGG - Intronic
919351369 1:196458845-196458867 TCATTGCTGTGCACAGTTACTGG + Intronic
919645818 1:200093676-200093698 ACAATGCTGTGCACATGAGCAGG + Intronic
920785336 1:209035332-209035354 CCACTGCCCTGCACAGGCTCAGG - Intergenic
922570147 1:226629779-226629801 TGACATCTGTGCACAGGCTCAGG + Intergenic
924835712 1:247644985-247645007 TCACTGTGATGCACAGGAGCAGG - Intergenic
1062835034 10:629737-629759 TCACTGCTGGGCACAGCCTGAGG + Intronic
1062857068 10:784712-784734 TCACTGCTGTGTGCAGAGGCCGG - Intergenic
1063437270 10:6044486-6044508 TCACTGCTATGGAAAGGAGCAGG + Intronic
1063663704 10:8049916-8049938 TCTCTCCTTTGAACAGGCGCTGG + Intergenic
1063954549 10:11254329-11254351 GCACTTCTGTGCACACGCACAGG + Intronic
1064723919 10:18258105-18258127 TCAGTGCTGTGCTAAGGTGCTGG - Intronic
1065900009 10:30197939-30197961 TCAGTGATGTCCACAGGAGCTGG - Intergenic
1069984308 10:72273372-72273394 TCCCTGCTTTGCAAAGGCTCGGG - Intergenic
1072369647 10:94752309-94752331 TCAGTGATGAGCACAGGCACGGG - Intronic
1074698313 10:116071048-116071070 TCATTGCTGAGCTCAGGCTCTGG - Intronic
1075809449 10:125214368-125214390 TCCCTGCTATGCAGAGGCTCCGG + Intergenic
1076294669 10:129375311-129375333 CCCCTGCTCTGCACAGGTGCAGG - Intergenic
1076809758 10:132880362-132880384 GCACTGCTGTGAGCAGGGGCTGG + Intronic
1077044569 11:538765-538787 CCTCTGCTGTCCACAGTCGCAGG - Exonic
1080805675 11:35651068-35651090 GCACTGCTGGGCACAGGGGTAGG + Intergenic
1081854363 11:46294731-46294753 TCACTGCTGTGCCTAGGGGGCGG - Intronic
1083822779 11:65182175-65182197 TCACCGCTGTCCCCAGGGGCTGG + Intronic
1090255233 11:125279204-125279226 TCACTGCGGTTCACAGGCCATGG - Intronic
1094617331 12:32047519-32047541 TCACTGCTTTCCAGAGGTGCAGG + Intergenic
1097444429 12:59650699-59650721 TCCCTGCTGTGCTCAGGCGTGGG + Intronic
1097733214 12:63152049-63152071 TTACTCCTGAGCACAGGAGCCGG - Intergenic
1102521550 12:113480219-113480241 GCCCGGCTGTGCACCGGCGCCGG + Intergenic
1103919641 12:124392803-124392825 CCATTGCTGTGCACATGGGCTGG - Intronic
1104559328 12:129829700-129829722 TCACTGCAGAGCACAGGAGATGG + Intronic
1104689692 12:130816181-130816203 CCTCAGCTGTGCTCAGGCGCTGG - Intronic
1105070140 12:133229428-133229450 TCACTGAGATGCACAGGAGCTGG - Intronic
1105398190 13:20061074-20061096 TCACTGCTGTCCAATGGAGCAGG - Exonic
1109060068 13:57605064-57605086 TCTCTGGTGTTCACAGGCGCTGG + Intergenic
1111529483 13:89518284-89518306 TCATTACTTTGCACAGGCCCAGG - Intergenic
1113466863 13:110519082-110519104 TCTCGGCTGTGCACACGTGCAGG + Intergenic
1113888464 13:113724271-113724293 TGGCTGCTGTACACAGGCGCCGG - Intronic
1118770211 14:68937892-68937914 TCAACGCTGAGCACAGGTGCTGG - Intronic
1120011306 14:79418605-79418627 TGACTGCTGTGCTCAAGGGCAGG - Intronic
1121533708 14:94676710-94676732 TCACTGCTGGGCACTGGGGTGGG - Intergenic
1121837946 14:97108718-97108740 TACCTGCTATGCACAGGCTCGGG + Intergenic
1125230760 15:37452719-37452741 TCACTGCTGTGTGCAGCCTCAGG + Intergenic
1129460508 15:75698069-75698091 TCACTCCTGTGCACAGCAGCAGG - Intronic
1129724355 15:77893967-77893989 TCACTCCTGTGCACAGCAGCAGG + Intergenic
1130576740 15:85099614-85099636 TCACTGGTGGCCACAGCCGCGGG - Intronic
1132207616 15:99997431-99997453 TCACAGCTCTGCACTGCCGCCGG + Exonic
1137286065 16:47016779-47016801 CCATTGCTGTGCACAGGCTTAGG + Intergenic
1137580920 16:49632982-49633004 TCACAGCTGTGCTCAGGCTGTGG - Intronic
1138188515 16:54995665-54995687 TGAGTGCTTTGCACAGGCCCCGG - Intergenic
1139639648 16:68281904-68281926 TCTCAGCTGTGAGCAGGCGCTGG - Intronic
1141626795 16:85265739-85265761 TCTCTGCTGTGCTCAGGACCTGG + Intergenic
1144937386 17:18911124-18911146 TCACTGCAATTCCCAGGCGCAGG - Exonic
1148717101 17:49723551-49723573 TAACTTCTGTGCACAAGCACAGG + Intronic
1149308422 17:55371503-55371525 TCACTGCTGTCCACAAGCCCAGG + Intergenic
1149531500 17:57399190-57399212 TCAGTGCTGTGCACAGTGGTGGG + Intronic
1150218083 17:63481250-63481272 TCACAGATGGGCACAGGGGCGGG + Intergenic
1150634601 17:66904050-66904072 TCACTGCTGCCCCCAGGAGCTGG - Intergenic
1151045645 17:70917124-70917146 CCACTGCTCTGCACAGCCCCAGG + Intergenic
1152258039 17:79251746-79251768 TCACAGCTGCCCACAGGCTCAGG + Intronic
1152271291 17:79326419-79326441 ACACTGATGTGCACAGGGGAAGG + Intronic
1152289914 17:79434228-79434250 TTGCTGCTCTGCACAGGTGCAGG + Intronic
1153885956 18:9466611-9466633 TCTCTCCTGTGCACAGCCCCAGG + Intergenic
1154121666 18:11657397-11657419 GCATTGCTGCGCACAGGCTCTGG - Intergenic
1154427480 18:14283279-14283301 CCACTGCTGTGTACAGCCTCAGG + Intergenic
1154499107 18:14985719-14985741 TTACTGCTCTGCACAGCCTCAGG - Intergenic
1160497930 18:79386097-79386119 CCACTGGTGTGCACGGGGGCGGG - Intergenic
1160695950 19:484658-484680 GCACCGCTGTGCAAAGGCCCTGG + Intergenic
1162885691 19:13695285-13695307 TCCCTGCTCTGCTCAGGCCCGGG - Intergenic
1167641856 19:50686776-50686798 TCCATGCTGGGCACCGGCGCCGG + Exonic
925090504 2:1151323-1151345 CCTCTGCTGTGCACAGGAGTGGG - Intronic
925820208 2:7792589-7792611 ACACCTCTGAGCACAGGCGCTGG + Intergenic
926303034 2:11617871-11617893 TCACTGCTGTGCACAGGCGCAGG - Intronic
926467264 2:13206279-13206301 TCACTGCTGTTCTCAAGGGCTGG - Intergenic
932566686 2:72915569-72915591 TCACCGCAGAGCACAGGCCCAGG + Intergenic
933704838 2:85281905-85281927 GCTCTGCTGTGTACAGGAGCAGG - Intronic
934620622 2:95802041-95802063 TCACTTCCCTGCACAGGCGAAGG + Intergenic
934754839 2:96817594-96817616 TCACTGCTCTCCACAGGGGTGGG - Intronic
934773859 2:96924889-96924911 TCTCTGCTTGGCACTGGCGCTGG + Intronic
935201788 2:100863036-100863058 GCACTGCTGTGCACGGGCTAAGG - Intronic
936822757 2:116542805-116542827 CCACTGCTTTGCACAGCCTCAGG - Intergenic
938067873 2:128291803-128291825 TAACAGCTGTGCAGGGGCGCCGG + Intronic
938299997 2:130203642-130203664 TCACTATTTTGCCCAGGCGCTGG + Intergenic
938456717 2:131470847-131470869 TCACTATTTTGCCCAGGCGCTGG - Intronic
948121895 2:235536931-235536953 TCTCTGCTGTGGGCAGGTGCAGG + Intronic
1170422559 20:16207252-16207274 TCAGGGCTGTGCACAAGGGCAGG - Intergenic
1170673282 20:18454723-18454745 TCATTGCCTTGCACAGGAGCAGG - Intronic
1171108367 20:22457603-22457625 CCACTGCTGTGCTCTGGCACTGG + Intergenic
1172013390 20:31859435-31859457 CCAGTGCTGTGCAAAGGTGCAGG - Intronic
1172782236 20:37443713-37443735 GCACTTCTGTGCACAGGAGTTGG - Intergenic
1173083554 20:39892673-39892695 TCACTGCTGTGCACAGTGCTTGG + Intergenic
1173168901 20:40706432-40706454 TCAGCCCTTTGCACAGGCGCTGG - Intergenic
1173362301 20:42355579-42355601 TCACTGCTCTGCAGTGGCTCTGG - Intronic
1176128545 20:63486776-63486798 TCAGTGCTGTGTACAGGGTCAGG + Intergenic
1177599201 21:23288982-23289004 CCACTGCTGTGTACAGCCTCAGG + Intergenic
1178826129 21:36018307-36018329 ACACTGCTGTGCTCAGGCTGGGG + Intergenic
1182242537 22:28927644-28927666 TCGCTGTTGTGAACAGGAGCTGG + Intronic
1182299566 22:29330067-29330089 ACATTGCTGGGCACAGGCCCTGG - Intronic
1183057524 22:35315967-35315989 TCACGGCTGTGCCCCGGCTCGGG - Intronic
1183562199 22:38584038-38584060 TCACTGAGGGGCACAGGCACAGG - Intronic
1184859686 22:47166106-47166128 TCTCTGCTGTGCCCGGGAGCAGG + Intronic
949558567 3:5181853-5181875 TCACTGCTATGCACAGTTGAGGG - Intergenic
949768484 3:7552729-7552751 TCGCTGCTTTGCACAGTCTCAGG - Intronic
951499450 3:23367751-23367773 TGACTGTTGTGCAAAGGCGGAGG + Intronic
961140451 3:124551428-124551450 TCATTGCTGGGCACATGTGCTGG + Intronic
963006087 3:140727373-140727395 TCACTTCTGTGCAGAGGGGATGG - Intergenic
967853939 3:194102280-194102302 CCACTGCTGTGGACACGCTCAGG + Intergenic
967965805 3:194959475-194959497 TCACTGCTGCTCAGAGGCTCAGG - Intergenic
969503019 4:7565263-7565285 TCACTTCTGAGCCCAGGAGCAGG - Intronic
969514304 4:7638051-7638073 TCACTGGTGTGCAGGGGCGAGGG + Intronic
969629699 4:8329090-8329112 TCACTGCTGTGCAGAGGAACTGG + Intergenic
969643458 4:8412815-8412837 TCAGTGCTGTGGAGGGGCGCAGG - Intronic
969643543 4:8413128-8413150 TCAGTGCTGTGGAGGGGCGCAGG - Intronic
969643631 4:8413438-8413460 TCAGTGCTGTGGAGGGGCGCAGG - Intronic
971506305 4:27369939-27369961 TCCCTGCTGTGCTCAGTCACTGG + Intergenic
978273416 4:106918886-106918908 TCAGGGCTGTGCACAGTGGCAGG - Intergenic
978379877 4:108116060-108116082 TCACTGCTGTGCTCCCGCCCAGG + Intronic
979610191 4:122681788-122681810 CCACTGCTCTGCACAGCCTCAGG + Intergenic
980274267 4:130628487-130628509 TCACTTAGGTGCACAGGCGACGG + Intergenic
980905582 4:138945451-138945473 TCATTGCTTTGCACAGGAGCTGG - Intergenic
984214749 4:176896489-176896511 ACACTGATGTGCATAGGCACGGG - Intergenic
984930600 4:184843953-184843975 TCTCTCCTGTGCCCAGGCGGTGG - Intergenic
985929234 5:3043240-3043262 TCAGTGCTGGGCACAGGAGGTGG + Intergenic
985962141 5:3310764-3310786 TGTCTGGTGAGCACAGGCGCTGG - Intergenic
986733937 5:10654305-10654327 CCCCTGCTGTGCACAGGGGTGGG + Intergenic
986846733 5:11764776-11764798 TCAGTGCTGAGCACAGTAGCTGG - Intronic
995324321 5:110873236-110873258 CCACTGCTGCGCATAGGCCCAGG + Intergenic
995774648 5:115712120-115712142 TCCCTGCTGTGTACAGCCTCGGG - Intergenic
997467402 5:134097533-134097555 TCACAGATGAGCACAGGCGTAGG + Intergenic
998456866 5:142280457-142280479 TCACTGCAGTCCCCAGGGGCTGG - Intergenic
1001349596 5:170946986-170947008 TCACTGCTTTGCACATTAGCAGG + Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1003547897 6:7076109-7076131 TTACTGCTGTGCAGAGGTGAGGG + Intergenic
1006437387 6:34033076-34033098 TCCCTGCTGAGCGCAGGTGCAGG - Intronic
1007262731 6:40575186-40575208 TCACTGCTGTGCACTAGTGAGGG + Intronic
1012037723 6:94163913-94163935 TCAATACTGTGGACAGGGGCTGG - Intergenic
1014610215 6:123534054-123534076 TCACTGCTGTGGGCAGATGCAGG + Intronic
1017068192 6:150549337-150549359 GCACTGCCGTTCACAGGTGCCGG + Intergenic
1017889658 6:158627938-158627960 TCGCTGCTGTGCAAAGTCACTGG + Intronic
1018739790 6:166718721-166718743 TCACCTCTGTGCACATGTGCGGG - Intronic
1020000392 7:4752475-4752497 TAACTGCTGGGAACAGGAGCAGG + Intronic
1020721900 7:11755694-11755716 TTCCTGCTGTGCACAGTCACTGG + Intronic
1025615781 7:63114734-63114756 TCAGTGCTGGGCGCGGGCGCAGG + Intergenic
1027628542 7:80574693-80574715 TCAGTGGTGTGCACAGGTGGAGG + Intronic
1028153815 7:87406872-87406894 TCACTGCTGTGCATGGGGGAAGG - Intronic
1029196616 7:98810047-98810069 TCACTGCTGTGGACAGCCGTGGG - Intergenic
1029271870 7:99381854-99381876 TCACTGCCCTGCCCAGGGGCCGG - Intronic
1031867684 7:127056438-127056460 TCCCTTCTGTGTACAGGCCCTGG - Intronic
1032677087 7:134141068-134141090 TCACTGCTGACAACAGGAGCAGG + Intronic
1035665372 8:1376326-1376348 GGACTGCGGTGCACAGGAGCTGG - Intergenic
1040102456 8:43517852-43517874 TCACTGCTGTGTGCAGCCTCAGG + Intergenic
1045653717 8:104366213-104366235 TCACTGATGTGCAGAGGAACGGG - Intronic
1046996722 8:120531848-120531870 ACACTGCAGGGCACAGGAGCTGG - Intronic
1047304299 8:123640487-123640509 TCACTGCTTTGCACTGGCATGGG + Intergenic
1048266511 8:132992001-132992023 TCACTTCTCTCCACAGGTGCAGG + Intronic
1049189082 8:141276627-141276649 GCAGTGCTGTGCAGAGGCGTGGG - Intronic
1049246626 8:141566175-141566197 TCCCTGCTGGCCTCAGGCGCAGG + Intergenic
1050149342 9:2603731-2603753 TCACTGCTCTGCAAGGGCCCTGG - Intergenic
1055001691 9:71457917-71457939 GCACTGCTGTACACAGTCCCAGG + Intergenic
1057195720 9:93114874-93114896 TCACTGCTGGTCACAGGAACTGG - Intergenic
1060529649 9:124340726-124340748 TCACTGCTGTGGACTGTCACCGG - Intronic
1060992659 9:127857704-127857726 TCCCTGCTGGGCACAGGCCTTGG + Intergenic
1062512333 9:136913762-136913784 TCAGAGCTGTGCAGAGGCACAGG + Intronic
1193965128 X:87975773-87975795 CCACTGCCCTGCACAGGCTCAGG + Intergenic
1195032019 X:100935527-100935549 TCACTGCTGTGCTCAGTCACTGG - Intergenic
1198667946 X:139045257-139045279 TCACTGCTCTGCACACCCTCAGG - Intronic
1199744530 X:150763510-150763532 TGGCAGCTGTGCACAGGTGCTGG + Intronic