ID: 926303340

View in Genome Browser
Species Human (GRCh38)
Location 2:11619059-11619081
Sequence GGGGTGGACCGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1835
Summary {0: 1, 1: 0, 2: 4, 3: 107, 4: 1723}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926303326_926303340 5 Left 926303326 2:11619031-11619053 CCCGTGGTGGAATCTTCTCCAAT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG 0: 1
1: 0
2: 4
3: 107
4: 1723
926303324_926303340 10 Left 926303324 2:11619026-11619048 CCCTTCCCGTGGTGGAATCTTCT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG 0: 1
1: 0
2: 4
3: 107
4: 1723
926303320_926303340 29 Left 926303320 2:11619007-11619029 CCCACGTCTTCACTTTTCACCCT 0: 1
1: 0
2: 0
3: 16
4: 222
Right 926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG 0: 1
1: 0
2: 4
3: 107
4: 1723
926303327_926303340 4 Left 926303327 2:11619032-11619054 CCGTGGTGGAATCTTCTCCAATG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG 0: 1
1: 0
2: 4
3: 107
4: 1723
926303325_926303340 9 Left 926303325 2:11619027-11619049 CCTTCCCGTGGTGGAATCTTCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG 0: 1
1: 0
2: 4
3: 107
4: 1723
926303321_926303340 28 Left 926303321 2:11619008-11619030 CCACGTCTTCACTTTTCACCCTT 0: 1
1: 0
2: 0
3: 24
4: 261
Right 926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG 0: 1
1: 0
2: 4
3: 107
4: 1723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926303340 Original CRISPR GGGGTGGACCGGAGGGAGGA GGG Intronic
900391497 1:2435937-2435959 GAGGAGGAGAGGAGGGAGGAAGG - Intronic
900554040 1:3270879-3270901 GAGGAGGACCGTTGGGAGGAGGG + Intronic
900681707 1:3920234-3920256 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
900820810 1:4886516-4886538 GGGGTCTATCGGAGGGTGGAGGG - Intergenic
900859074 1:5212230-5212252 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
900969200 1:5980186-5980208 GGGTTGGTCAGGAGGCAGGAGGG - Intronic
900993092 1:6106877-6106899 GGGGTGGAGCAGTGGAAGGATGG + Intronic
900993123 1:6106957-6106979 GGGGTGGAGGGGTGGAAGGATGG + Intronic
901001409 1:6150689-6150711 GGGGGTGACTGAAGGGAGGATGG + Intronic
901018488 1:6244635-6244657 GGGGAGGGCTGGAGGGAGGAGGG + Intronic
901058989 1:6463014-6463036 GGGATGGACCGAGGGGAGGCGGG - Intronic
901240772 1:7691950-7691972 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
901306441 1:8236367-8236389 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
901399450 1:9005978-9006000 GTGGTGGACAGGAGGAAGGCAGG - Intronic
901636445 1:10672472-10672494 GGGGCGGGCCGGCGGGCGGAGGG - Intronic
901671866 1:10860776-10860798 GAGGTGGAGAGGCGGGAGGAGGG + Intergenic
901678339 1:10899591-10899613 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
901690518 1:10970119-10970141 GGTGGGGAAGGGAGGGAGGAAGG + Intronic
902055679 1:13598707-13598729 GCGCTGCACGGGAGGGAGGATGG - Intronic
902239840 1:15081133-15081155 AGGGAGGAACGGAGGGAGGGAGG - Intronic
902286578 1:15411432-15411454 GGGATGGGCCGGAGGGAGCTGGG - Intronic
902620187 1:17646288-17646310 GGGCTGGACATGAGTGAGGAAGG - Intronic
902722476 1:18313158-18313180 AGGGAGGACCGCCGGGAGGAAGG + Intronic
902770436 1:18642727-18642749 GGGGTGGAGCAGGGGGAGGGAGG + Intronic
902773208 1:18658231-18658253 GGGGAGGGCAGGAGCGAGGAGGG - Intronic
903125676 1:21245890-21245912 GGGGAGGGCAGGAGAGAGGAGGG - Intronic
903190603 1:21653635-21653657 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
903416590 1:23187677-23187699 GAGGTGGACTGAGGGGAGGAAGG - Intergenic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
903572855 1:24319222-24319244 GGGGTGGAGATGAGGGAGGAGGG - Intergenic
903737805 1:25541402-25541424 GGGGAGGAAAGGAGGGAGGAAGG + Intergenic
903743943 1:25574196-25574218 AGGCTGGAGAGGAGGGAGGAAGG + Intergenic
903762887 1:25711650-25711672 GGGCGGGGCCGCAGGGAGGAGGG - Intronic
903777206 1:25800528-25800550 GGACTGGACGGGAGGGAGCACGG + Intronic
904277487 1:29393922-29393944 GGGGAGGAGGGGAGGGAGGGAGG - Intergenic
904373655 1:30066289-30066311 GGGGTGTAGTGGAGGGAGGCTGG - Intergenic
904451855 1:30618346-30618368 GGAGTGGAGAGGAGGCAGGAAGG + Intergenic
904625610 1:31800224-31800246 AGGGTGGACTGGAGGAGGGAGGG - Intronic
904679099 1:32216383-32216405 GGGGTGGAACCGAGGGAAGAAGG - Exonic
904717747 1:32481760-32481782 GGGGTCTACCGGAGGGTGGGAGG - Intronic
904938996 1:34151796-34151818 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
905223655 1:36465937-36465959 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
905734778 1:40317368-40317390 GGGGTTGCCGGGAGGGAGGCCGG + Intronic
905753411 1:40486393-40486415 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
906191861 1:43904184-43904206 GGGCTGGACCGTAGGGCAGATGG + Intronic
906810798 1:48825121-48825143 GGGGTAGCTTGGAGGGAGGAGGG + Intronic
906993021 1:50759291-50759313 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
907553002 1:55319891-55319913 AGGGTGGAAAGGAGGGAGCAGGG + Intergenic
907560797 1:55385700-55385722 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
908014208 1:59814823-59814845 GGGCAGGACGGGTGGGAGGAGGG + Intronic
908095963 1:60738877-60738899 GGGGTGGGGGGGAGGGGGGAAGG + Intergenic
908096401 1:60743317-60743339 GGGGTGGGGGGGAGGGGGGAAGG + Intergenic
908330093 1:63062755-63062777 GGGGTGGAGGGGAGGGGGGTGGG + Intergenic
908605439 1:65792860-65792882 GGGGTGGACAGTAGGGAGAGGGG + Intronic
908796170 1:67833196-67833218 GGGAGGGAGCGGAGGAAGGAAGG - Intronic
909164120 1:72195967-72195989 TGAGTGAACCTGAGGGAGGAAGG - Intronic
909550371 1:76893236-76893258 AGGGTGTGCAGGAGGGAGGAAGG + Intronic
909738755 1:79001176-79001198 GGGGGGGGAGGGAGGGAGGAAGG + Intronic
909897740 1:81094085-81094107 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
910586963 1:88891136-88891158 GGGGAGGAGAGGAGGGAGGGTGG + Intronic
910751820 1:90639057-90639079 AGGGTGGAAGGGAGGGAGGGAGG + Intergenic
910847899 1:91621415-91621437 GTGGTGGAAAGGAGGAAGGAGGG - Intergenic
910937344 1:92495241-92495263 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
911095060 1:94048143-94048165 GGGGTGGGCTGGAGGGATAAAGG + Intronic
911099646 1:94084942-94084964 AGGGGAGACAGGAGGGAGGACGG - Intronic
911613000 1:99977557-99977579 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
911644781 1:100326582-100326604 AGGGTGGAAGGGAGGGAGGGAGG - Intergenic
911834371 1:102597048-102597070 GGAGGGGAGGGGAGGGAGGAAGG + Intergenic
911995299 1:104758241-104758263 GGGGGGGAATGGGGGGAGGAGGG + Intergenic
914137813 1:144917395-144917417 GAGATGGCCCGGAGGCAGGAGGG - Intronic
914197842 1:145459137-145459159 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
914401181 1:147321936-147321958 GGGGTGGGGGGGAGGGGGGAAGG - Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914476945 1:148032261-148032283 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
914692370 1:150042166-150042188 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
914825137 1:151134124-151134146 GGGTTCCACAGGAGGGAGGAAGG - Intronic
914869299 1:151459374-151459396 GGGGGGGCCCCGAGGGAGGGGGG + Exonic
915040683 1:152965946-152965968 GGGAGGGAGCTGAGGGAGGAGGG - Intergenic
915268240 1:154733814-154733836 GGGGATGAAGGGAGGGAGGAAGG - Intronic
915311230 1:155006789-155006811 GGGGAGGAAAGGAGGAAGGAAGG - Intronic
915322342 1:155062699-155062721 GGGTTGGACGGGATTGAGGAAGG + Exonic
915355842 1:155254952-155254974 GGGGTGGAGAGGAGAAAGGACGG - Exonic
915599395 1:156913071-156913093 GGAGTGGGGAGGAGGGAGGAAGG + Intronic
915931155 1:160061757-160061779 GGGGTGGGGTGGAGGGAGGGTGG + Intronic
916400247 1:164439983-164440005 GGAGAGGAGAGGAGGGAGGAGGG + Intergenic
916512142 1:165481874-165481896 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
916844828 1:168639238-168639260 AGGGTGGGTGGGAGGGAGGAAGG - Intergenic
916992661 1:170261000-170261022 GGGGTGGCGGGGAGGGGGGAGGG + Intergenic
917149875 1:171932003-171932025 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
917154742 1:171984387-171984409 GGTGTGGAGGGGAGGGAGGTGGG - Intronic
917157378 1:172019016-172019038 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
917253562 1:173089339-173089361 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
918246201 1:182661534-182661556 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
918273316 1:182924838-182924860 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918469918 1:184861535-184861557 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
919019950 1:192092704-192092726 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
919020442 1:192098452-192098474 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
919194052 1:194260563-194260585 GGGGGGGGCGGGAGGGGGGAGGG + Intergenic
919235239 1:194832357-194832379 GGGGTCTACCAGAGGGTGGAGGG + Intergenic
919760687 1:201096232-201096254 GGGTTGGGCTGGAGGGAGTATGG - Intronic
919965087 1:202515131-202515153 GGGGTCTACTTGAGGGAGGAGGG + Intronic
920094248 1:203475703-203475725 GGGGAGGAGAGGAGGGAGGAGGG - Intergenic
920194011 1:204214045-204214067 GGGGTGGAGCGGGGGCTGGAGGG - Exonic
920281005 1:204843659-204843681 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
920308229 1:205032481-205032503 GGGGTGGTGGGGAGGGAGGATGG - Intergenic
920487141 1:206381350-206381372 GAGATGGCCCGGAGGCAGGAGGG + Intronic
920547672 1:206832075-206832097 GGGGTGGGATGGAGGGAGGTGGG - Intronic
920646231 1:207806338-207806360 AGGGTGGAGCAGAGGGAGCATGG + Intergenic
920679327 1:208060515-208060537 AGGGTGGAGGTGAGGGAGGAGGG + Intronic
920881057 1:209880851-209880873 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
921006515 1:211099543-211099565 GGGGCGGAGGGGAGGAAGGAGGG - Intronic
921130263 1:212213830-212213852 GGTGTGGAACTGAGGAAGGAGGG - Intergenic
921292120 1:213668387-213668409 GGGGTGGTGCGGCGGGGGGAAGG - Intergenic
921327834 1:214005090-214005112 GGTGGGGACTGGAGGGAGGGAGG + Intronic
922022111 1:221715986-221716008 GGAGGGGAGGGGAGGGAGGAGGG - Intronic
922053773 1:222020814-222020836 GGAGTTGAACTGAGGGAGGATGG - Intergenic
922129065 1:222758720-222758742 GGGGTGGAAGTGAGGGAAGAGGG + Intergenic
922129464 1:222762574-222762596 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
922723213 1:227909606-227909628 GGGAAGGAGGGGAGGGAGGAGGG + Intergenic
922804517 1:228378475-228378497 GGGGCGGGACGGAAGGAGGAGGG - Intronic
922917597 1:229271232-229271254 GCGGGGGACCGGAGGAGGGAGGG - Exonic
923039326 1:230308597-230308619 GGGGTGGGGAGGCGGGAGGAAGG + Intergenic
923222916 1:231912869-231912891 GGGGTGGAAGGAAGGAAGGAAGG - Intronic
923309836 1:232725308-232725330 GGGGGGGAGGGGAGGGGGGAGGG + Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923608189 1:235464468-235464490 GGGGAGGAAGTGAGGGAGGAAGG - Intronic
924202627 1:241675251-241675273 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
924332342 1:242952875-242952897 GGGGCCGACTGGAGGGTGGAGGG + Intergenic
924436667 1:244048855-244048877 GGGGGGGCCGGGAGGGAGGGGGG + Intergenic
924939798 1:248805079-248805101 GGGGTGGCCTGGAAGGAGCATGG + Intergenic
1062926363 10:1318410-1318432 GGGCTGGGCCGGAGGGATGTGGG + Intronic
1062942676 10:1435741-1435763 GGGGTGGCCAGCAGGGAGGCAGG - Intronic
1063025963 10:2178922-2178944 GGAGGGGAGGGGAGGGAGGAAGG - Intergenic
1063278554 10:4598615-4598637 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1063309694 10:4940612-4940634 GGGGTGAAGGGAAGGGAGGAAGG + Intronic
1063317596 10:5021489-5021511 GGGGTGAAGGGAAGGGAGGAAGG - Intronic
1063534184 10:6866931-6866953 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1063536622 10:6890557-6890579 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1063595975 10:7435971-7435993 AGGGTGGACCAGATGGAGGGGGG + Intergenic
1063598765 10:7461462-7461484 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1064121437 10:12623124-12623146 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1064306368 10:14170773-14170795 GGAGTGGAAGGGAGGGAAGATGG - Intronic
1064332880 10:14410249-14410271 GGGGAGGACGGAAAGGAGGAAGG + Intronic
1064490603 10:15851704-15851726 GGACTGGACAGGAGGGAGGAAGG - Intronic
1064686489 10:17867223-17867245 GGGGGAGAGAGGAGGGAGGATGG - Intronic
1064826632 10:19410629-19410651 GGGGAGGAGGGGAGGGAGGGAGG - Intronic
1065046639 10:21752160-21752182 GGGGAGGAGTGGAGGGAGGGAGG - Intergenic
1065141730 10:22724994-22725016 GGAGTGGAGGAGAGGGAGGAGGG - Intergenic
1065497229 10:26341848-26341870 GGGGAGGAGTGGAGGGAGGAAGG + Intergenic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065818290 10:29501450-29501472 GGTGAGGAGTGGAGGGAGGAAGG + Intronic
1065862685 10:29885108-29885130 GGGGTTTACTGGAGGGTGGAGGG - Intergenic
1065905628 10:30248539-30248561 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1065954621 10:30683051-30683073 GGTGAGGAGTGGAGGGAGGAAGG - Intergenic
1065993691 10:31036556-31036578 GGGGTGGAGGGAAGCGAGGAGGG + Intergenic
1066314267 10:34228247-34228269 GGGGCTTACTGGAGGGAGGAGGG + Intronic
1066696930 10:38087426-38087448 GGGGTGGAAGGGTGGGAGGGTGG - Intergenic
1067229648 10:44397412-44397434 GGGGAGGACAGGAGAGGGGAGGG + Intergenic
1067319340 10:45202978-45203000 GGGGTCTACTGGAGGGTGGAAGG - Intergenic
1067750594 10:48968797-48968819 AGAGTGGAGCTGAGGGAGGATGG + Intronic
1067756936 10:49012300-49012322 GAGATGGACAGGAGAGAGGAGGG + Intergenic
1067821129 10:49531800-49531822 GGGCTGAACGGGATGGAGGATGG - Intronic
1068051614 10:51957182-51957204 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1068269186 10:54697694-54697716 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1068329093 10:55538461-55538483 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1068373124 10:56144862-56144884 GGGGTGGAGCAGGGGGAGGAGGG + Intergenic
1068627412 10:59264189-59264211 GGGGTGGAAGGGAGGGAAGGAGG + Intronic
1068775260 10:60862063-60862085 AGGATGGAACGAAGGGAGGAAGG - Intergenic
1068983046 10:63081447-63081469 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1069370771 10:67745510-67745532 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1069550352 10:69360052-69360074 GGGGTGACCCGGAGGGAGCAGGG - Intronic
1069610989 10:69772429-69772451 GGGATGGACCAGAGGTAGGCTGG - Intergenic
1069622536 10:69846680-69846702 TGGGAGCACTGGAGGGAGGAAGG - Intronic
1069901379 10:71708458-71708480 GCGGTGGACGGGAGTCAGGAAGG - Intronic
1069942385 10:71964515-71964537 GGGGCGGGCCGGAGGGATGGAGG - Exonic
1069942583 10:71965281-71965303 GGCGAGGCCCGGAGAGAGGAGGG + Intronic
1070667660 10:78356759-78356781 GGGGAGGACAGGAGGAAGGCTGG - Intergenic
1070831550 10:79421019-79421041 GGGGTGGAACGCAGGCAGGCTGG + Intronic
1070871571 10:79758481-79758503 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1071366231 10:84903203-84903225 GGGGTGGAGTGGAGGCAGCAGGG + Intergenic
1071589845 10:86862395-86862417 AGGCTGGAACGGAGGGAGGGTGG + Intronic
1071600375 10:86956007-86956029 CCGGTGGACGGGAGGGAGGAGGG - Intronic
1071638493 10:87280646-87280668 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1071656749 10:87457306-87457328 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1072448445 10:95519591-95519613 GGGGAGGAGTGGAGGAAGGAAGG + Intronic
1072713608 10:97734848-97734870 GGGGTGGACAGGGTGGGGGATGG + Intergenic
1072822988 10:98576718-98576740 GGGCAGGACAGGATGGAGGAGGG - Intronic
1072844631 10:98816028-98816050 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1072861572 10:99010999-99011021 GGGGTTGAAGGGTGGGAGGAGGG - Intronic
1073104949 10:101027245-101027267 AGGGTGGAGGGGAGGGCGGAGGG - Intronic
1073127912 10:101163497-101163519 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1073191859 10:101657071-101657093 CGGGAGGATTGGAGGGAGGAGGG - Intronic
1073500770 10:103934812-103934834 GGGGTCTACCGAAGGGTGGAGGG - Intergenic
1073894927 10:108144343-108144365 GGGGACTACCAGAGGGAGGAGGG - Intergenic
1074399135 10:113127290-113127312 GGGGAGGAGGGGAGCGAGGAGGG - Intronic
1074609196 10:115004611-115004633 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1074887664 10:117707019-117707041 AGGGTGGAAGGGAGGGAGGCAGG + Intergenic
1075198096 10:120378545-120378567 TGGGTGGAAAGGAGGGAGGTAGG + Intergenic
1075317737 10:121466026-121466048 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1075723246 10:124599215-124599237 GGGATGGACAGGAGGATGGATGG - Intronic
1075802220 10:125160603-125160625 GGAGGGGAGCGGAGGGAGGGTGG - Intronic
1076008014 10:126963666-126963688 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1076035291 10:127195265-127195287 GGCGAGGGCAGGAGGGAGGAGGG - Intronic
1076064991 10:127441727-127441749 GGGGAGGCCCGCAGGGGGGAAGG - Intronic
1076353705 10:129837364-129837386 GGGGTGGCAGGGAGGGAGGGAGG - Exonic
1076635157 10:131876773-131876795 GGGTCTGCCCGGAGGGAGGAGGG + Intergenic
1076841516 10:133048229-133048251 CGTGTGGACAGGAGAGAGGAAGG + Intergenic
1076931839 10:133536782-133536804 TGGGTGGATGGGAGGGTGGATGG + Intronic
1076931857 10:133536830-133536852 TGGGTGGATGGGAGGGTGGATGG + Intronic
1077101338 11:823877-823899 GGGGAGGAGGGGAGGCAGGAGGG + Intronic
1077177147 11:1196145-1196167 GGGGGGGACCTGGAGGAGGAGGG + Intronic
1077248549 11:1550753-1550775 GGGGTGGATGGGTGGGTGGATGG - Intergenic
1077248617 11:1550997-1551019 GGGGTGGATGGGTGGGTGGATGG - Intergenic
1077248655 11:1551127-1551149 GGGGTGGATGGGTGGGTGGATGG - Intergenic
1077248673 11:1551192-1551214 GGGGTGGATGGGTGGGTGGATGG - Intergenic
1077248708 11:1551314-1551336 GGGGTGGGCGGGTGGGTGGATGG - Intergenic
1077248745 11:1551440-1551462 GGGGTGGATGGGTGGGTGGATGG - Intergenic
1077248810 11:1551675-1551697 GGGGTGGATGGGTGGGTGGATGG - Intergenic
1077248845 11:1551797-1551819 GGGGTGGGCAGGTGGGTGGACGG - Intergenic
1077252893 11:1568372-1568394 GGGCTGGAGGGGCGGGAGGACGG + Intronic
1077304758 11:1864077-1864099 GGAGGGGAAGGGAGGGAGGAGGG + Intronic
1077317817 11:1927145-1927167 GAGGTGGAAGGGAGGGTGGAGGG + Intronic
1077333667 11:1994171-1994193 GGGGTGGAAGGCAGGGGGGAGGG + Intergenic
1077381805 11:2246828-2246850 GGGGAGGAGGGGTGGGAGGAAGG + Intergenic
1077403245 11:2369240-2369262 GGAGGGGACCCCAGGGAGGAGGG - Intergenic
1077554751 11:3220564-3220586 GGAGTGGCCCGGCGGCAGGAGGG + Intergenic
1077696811 11:4400960-4400982 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1077779256 11:5307633-5307655 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1077924421 11:6666680-6666702 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1078163407 11:8862030-8862052 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
1078451370 11:11443298-11443320 GGGGTGGAGAGGTAGGAGGAGGG - Intronic
1078599479 11:12717597-12717619 GAAGTGGAAGGGAGGGAGGAGGG + Intronic
1079095849 11:17509649-17509671 GGGGTGGGTTGGAGGGTGGAGGG + Exonic
1079383325 11:19958001-19958023 GGGGTGGGAGGGAGGCAGGAAGG - Intronic
1079393125 11:20039432-20039454 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1079576895 11:22015482-22015504 GGGGTTTACCTGAGGGTGGAAGG - Intergenic
1079629791 11:22659895-22659917 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1079898611 11:26152429-26152451 GGGGGGGAGGGGAGGGAGGAAGG + Intergenic
1080048905 11:27838439-27838461 GGGAGGGAAGGGAGGGAGGATGG - Intergenic
1080114569 11:28607226-28607248 GAGGGGGAGAGGAGGGAGGATGG - Intergenic
1080836275 11:35943978-35944000 GGGGAAGGCGGGAGGGAGGAGGG + Intronic
1081428010 11:42946178-42946200 GGGGTGGGGGGGAGGGAGGAGGG + Intergenic
1081675123 11:44964153-44964175 AGAGTGGAGGGGAGGGAGGAGGG - Intergenic
1081693655 11:45094776-45094798 GGGAAGGAAGGGAGGGAGGAGGG + Intergenic
1081809109 11:45905384-45905406 CGGGTGGCCTGGAGGGAGGGTGG + Intronic
1081831707 11:46120709-46120731 GGGGTGTGTGGGAGGGAGGAGGG - Intronic
1083034961 11:59628522-59628544 CGGGTGGGCAGGAGGGAGGGAGG - Intergenic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083282906 11:61638440-61638462 GGGGAGGACAGGAGGGAGGACGG + Intergenic
1083300477 11:61737440-61737462 GGAGTGGCCTGGAGGGTGGAGGG + Intronic
1083627512 11:64079117-64079139 GCGGTGGACGGGAGGGAGGGAGG + Intronic
1083642709 11:64153987-64154009 TGGGTGGACTGAAGGGAGCATGG - Intronic
1083780215 11:64913780-64913802 GGGGTGGACTGGTGTGAAGATGG - Intronic
1083898503 11:65632303-65632325 GGGGTGGGGCGGGGGGAGGCGGG + Intronic
1083934883 11:65865003-65865025 GGTGTGGCCCTGAGGGAAGAAGG - Exonic
1083977970 11:66139466-66139488 GGGGTGGATGGGAGGGAAGTGGG - Intronic
1084230694 11:67750639-67750661 GGGGTGGACGGGTGGGGGGGGGG - Intergenic
1084403015 11:68956002-68956024 GGGGTGGGGCGGGGGCAGGATGG + Intergenic
1084470465 11:69356363-69356385 GGGAAGGAAAGGAGGGAGGAAGG + Intronic
1084501625 11:69538781-69538803 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1084657222 11:70526793-70526815 GGGGTGTTCAGGAGGGAGGGAGG - Intronic
1084678287 11:70649628-70649650 TGGGTGTATGGGAGGGAGGAGGG + Intronic
1084849590 11:71928310-71928332 GGAGTGGCCGAGAGGGAGGAGGG - Intronic
1084906775 11:72354597-72354619 GTGGTGGGAGGGAGGGAGGAAGG - Intronic
1084941351 11:72615019-72615041 AGGGTGGGCAGGAGGGTGGAGGG - Intronic
1085181435 11:74540178-74540200 GTAGGAGACCGGAGGGAGGAAGG + Intronic
1085444785 11:76593114-76593136 GGGCTGTACCTGAGAGAGGAGGG - Intergenic
1085640434 11:78189472-78189494 CGGGTGCACTGGAGGGAGGGAGG + Intronic
1085847501 11:80083182-80083204 AGGGAGGACGGGAGGGAGGGAGG - Intergenic
1086048996 11:82566981-82567003 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1087527154 11:99330164-99330186 GGGAGGGAGGGGAGGGAGGAGGG + Intronic
1087969883 11:104467134-104467156 GGGGTGGATTGGAGGGATGTGGG + Intergenic
1088116028 11:106315895-106315917 GGGGAGGAAGGGAGAGAGGAAGG - Intergenic
1088339339 11:108745165-108745187 GGAGGGGAGGGGAGGGAGGAAGG - Intronic
1088480377 11:110291356-110291378 AGGGAGGGACGGAGGGAGGAAGG + Intronic
1088868046 11:113867804-113867826 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1088942463 11:114473966-114473988 GGGGTGGAGGGCAGGAAGGATGG + Intergenic
1089073128 11:115716670-115716692 GGGAAAGACCGGAGGGAGGAAGG - Intergenic
1089122355 11:116146274-116146296 GGGGTGGACCTGGAGGAGCAGGG - Intergenic
1089194283 11:116684048-116684070 GGGGTGGAGGGGAGCGGGGACGG - Intergenic
1089504356 11:118953631-118953653 GGGGGGGATTGGAGGGAGAAGGG + Intronic
1089526815 11:119102295-119102317 GGGGTGGGGAGGAGGGACGAGGG + Exonic
1089792460 11:120954672-120954694 GATGTGGAGGGGAGGGAGGAGGG - Intronic
1089915961 11:122156570-122156592 GGGAAGGACAGGAGGAAGGAAGG + Intergenic
1090011312 11:123048170-123048192 TGGGTGGACCGCAGGGAGAAAGG - Intergenic
1090246778 11:125221805-125221827 GGGGTGGTCGGGGAGGAGGAGGG - Intronic
1090276996 11:125427225-125427247 GGGAAGGAGCGGAGGCAGGATGG - Intronic
1090327789 11:125904239-125904261 GGCGCGGACCGGAGGGCAGAGGG - Intronic
1090470408 11:126975903-126975925 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1090846819 11:130536454-130536476 GGGCTGGAGCGGAGTCAGGAGGG + Intergenic
1091335149 11:134761034-134761056 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1202816648 11_KI270721v1_random:49353-49375 GGGGTGGAAGGCAGGGGGGAGGG + Intergenic
1091555104 12:1566980-1567002 GGTGGGGGCGGGAGGGAGGACGG + Intronic
1091591479 12:1845390-1845412 GGGGAGGAGGGGAGGGAGGAGGG + Intronic
1091650251 12:2304099-2304121 GGGGTGCACAGGACGGAGCAGGG + Intronic
1091695856 12:2627679-2627701 GGGGTGGCGCTGAGGGAGGGAGG - Intronic
1091718169 12:2794683-2794705 GGGATGGGAGGGAGGGAGGAAGG + Intergenic
1091740884 12:2959687-2959709 GGGGCGGACAGGAGGGAAGCGGG - Intronic
1091796335 12:3299414-3299436 GGGATGGAGAGGAGAGAGGAGGG - Intergenic
1091823052 12:3490863-3490885 GGGGTGGGCCGGGGTGGGGAGGG + Intronic
1092903016 12:13077411-13077433 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
1093024882 12:14236535-14236557 GGGGTGGTCTGGAGGGGTGATGG - Intergenic
1093252687 12:16827106-16827128 GGGGTGGGGAGGTGGGAGGAGGG - Intergenic
1093523333 12:20076066-20076088 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1093659441 12:21736977-21736999 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1093838035 12:23860145-23860167 GGGGGGAAACGGTGGGAGGAGGG + Intronic
1094292152 12:28863615-28863637 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1094292180 12:28863807-28863829 GGGAGGGAGGGGAGGGAGGAAGG - Intergenic
1094496154 12:30990611-30990633 GGGATGGAGAGGAGGAAGGAGGG + Intronic
1094615100 12:32029318-32029340 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1094802733 12:34055880-34055902 GGTGGGGACAGTAGGGAGGAAGG + Intergenic
1095137465 12:38622931-38622953 GGGGTGGGGGGGAGGGAGGAGGG + Intergenic
1095724112 12:45433451-45433473 GGGTTGGTCAGGAGGGAGGTTGG + Intronic
1095817554 12:46441220-46441242 GGGGGGGAAGGGAGGGAGGGAGG - Intergenic
1095866679 12:46979740-46979762 GAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1096101248 12:48971628-48971650 CGGGAGGAAGGGAGGGAGGAAGG + Exonic
1096294602 12:50372965-50372987 AGGGAGGGACGGAGGGAGGAAGG + Intronic
1096463084 12:51833570-51833592 GGTGTGGAAGGGAGGGAGGAGGG - Intergenic
1096633653 12:52945296-52945318 GGGGTGGGCTGGAGGGAGGAAGG - Intronic
1096667430 12:53175312-53175334 GGAGTGGGCCTGAGGGAAGAGGG + Intronic
1096855429 12:54478579-54478601 GGGGAGGAAGGAAGGGAGGAAGG - Intergenic
1096983671 12:55743242-55743264 GGGAGGGGGCGGAGGGAGGAGGG - Intergenic
1097190045 12:57215331-57215353 GGGGTGGAGAGGAGAGAGGCAGG - Intergenic
1097262636 12:57728151-57728173 GGGATGGACATCAGGGAGGACGG - Intronic
1097534861 12:60855920-60855942 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1097640219 12:62172214-62172236 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1097751182 12:63354581-63354603 GGGGTGGGGGGGAGGGGGGAAGG + Intergenic
1097991087 12:65834599-65834621 AGGGAGGAACGGAGGGAGGGAGG - Intronic
1099082589 12:78204205-78204227 GGGGTGGGGCGGAGGGGGGAGGG + Intronic
1099436500 12:82652571-82652593 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1100184793 12:92127646-92127668 GGGGAGAAGAGGAGGGAGGATGG + Intronic
1100875220 12:98954919-98954941 AGGGTGGGCAGGAGGGAGGGAGG - Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101881932 12:108631646-108631668 GGGGTGGAGGGTAGGGAGGGGGG - Intronic
1102249508 12:111376609-111376631 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1102623619 12:114216792-114216814 GGAATGGAAAGGAGGGAGGAAGG + Intergenic
1102646325 12:114406214-114406236 GGGGTGGGGGGAAGGGAGGACGG - Intronic
1102759683 12:115374613-115374635 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1102785312 12:115599717-115599739 AGGGCGGGGCGGAGGGAGGAAGG + Intergenic
1102934470 12:116884876-116884898 GGGGTGGAGCGGTGGCAGGGGGG - Intergenic
1103002492 12:117395992-117396014 TGGGTGGAAGGGAGGGAGGGAGG - Intronic
1103185813 12:118956183-118956205 GGGGAGGGCCAGAGGGAGGTAGG + Intergenic
1103239018 12:119398015-119398037 GGGGGCGGCGGGAGGGAGGAAGG + Intronic
1103251688 12:119505370-119505392 GAGGTGGACTTGAGGCAGGAGGG - Intronic
1103350896 12:120282890-120282912 GGGGAGGAAGGGAGGGAGGGAGG + Intergenic
1103425480 12:120830334-120830356 GAGGTGGAAAGGAGGGGGGAGGG + Intronic
1103566053 12:121816237-121816259 GGGGTGGAGGGGAGGGATTAAGG - Intronic
1103711818 12:122918277-122918299 GGGGGGCACCCAAGGGAGGAAGG - Intergenic
1103905750 12:124326504-124326526 GGGGCGGGCAGCAGGGAGGAGGG - Intronic
1104670273 12:130675521-130675543 GGGGTGGACGGAAGGGAGTGGGG - Intronic
1104690161 12:130819307-130819329 GGGGAGGGTGGGAGGGAGGAAGG - Intronic
1104813297 12:131631398-131631420 GGGGTGGATGGGTGGAAGGATGG + Intergenic
1104842518 12:131831830-131831852 GGGGGGGACGGGAAGGGGGAAGG + Intronic
1104842532 12:131831869-131831891 TGGGGGGACCGGAAGGGGGAAGG + Intronic
1104842561 12:131831944-131831966 GGGAGGGACCGGAAGGGGGAAGG + Intronic
1104842589 12:131832016-131832038 GGGAGGGACCGGAAGGGGGAAGG + Intronic
1104842619 12:131832089-131832111 GGGGGGGACGGGAAGGGGGAAGG + Intronic
1104842635 12:131832126-131832148 GGGGGGGACGGGAAGGGGGAAGG + Intronic
1104842665 12:131832198-131832220 GGGGGGGACGGGAAGGGGGAAGG + Intronic
1104842693 12:131832270-131832292 GGGGGGGACGGGAAGGGGGAAGG + Intronic
1104954494 12:132457673-132457695 TGGGTGGACAGGTGGGTGGATGG + Intergenic
1104954506 12:132457710-132457732 TGGGTGGACAGGTGGGTGGATGG + Intergenic
1104956767 12:132470559-132470581 GGAGGGGAAGGGAGGGAGGAGGG + Intergenic
1105429327 13:20322942-20322964 GGGCTGGGCGGGAGGGAGAATGG + Intergenic
1105481946 13:20785859-20785881 GGGGAGGAAAGGAGGGAGGGAGG + Intronic
1105619792 13:22055781-22055803 GTGGTGGACAAGAGGGTGGAAGG + Intergenic
1105947413 13:25201812-25201834 AGGGTGGATAGGAGGGTGGATGG - Intergenic
1105985422 13:25561514-25561536 GGGGTGGGCAGTAGGGAGGGTGG - Intronic
1106147588 13:27063846-27063868 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1106332609 13:28753324-28753346 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1107318532 13:39160730-39160752 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1107932794 13:45319988-45320010 GGGGAGGAAGGAAGGGAGGAAGG + Intergenic
1107999447 13:45892768-45892790 GGGGAGTAGGGGAGGGAGGAGGG + Intergenic
1108686002 13:52819046-52819068 AGGGAGGAAGGGAGGGAGGATGG - Intergenic
1108743349 13:53362261-53362283 AGGGAGGAACGGAGGGAGGGTGG - Intergenic
1108794828 13:54018019-54018041 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1108794833 13:54018031-54018053 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1109301871 13:60597948-60597970 GGGGCGGACCTGAGGGTGGAGGG - Intergenic
1109311749 13:60703100-60703122 GGGGACTACCCGAGGGAGGAGGG - Intergenic
1109671325 13:65612233-65612255 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1109781198 13:67112658-67112680 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1109833620 13:67826375-67826397 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1110166115 13:72445772-72445794 GGAGAGGAAGGGAGGGAGGAAGG + Intergenic
1110313393 13:74076798-74076820 GGGGTCGACTTGAGGGTGGAGGG - Intronic
1110779649 13:79449983-79450005 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1110789748 13:79574677-79574699 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1111317179 13:86578120-86578142 GGAGGGGAGGGGAGGGAGGAGGG - Intergenic
1111452632 13:88438780-88438802 AGGGTGGAAGGGAGGGAGGAAGG + Intergenic
1111812427 13:93107730-93107752 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1112060475 13:95734960-95734982 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
1112075075 13:95904435-95904457 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
1112108995 13:96273956-96273978 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1112507069 13:99981699-99981721 GGGGAGGGCGGGCGGGAGGAGGG - Intergenic
1112699452 13:101988707-101988729 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1113203479 13:107891713-107891735 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1113234857 13:108261333-108261355 AGGGAGGACGGGAGGAAGGAAGG - Intronic
1113366687 13:109683064-109683086 GGTGTGGACTGGAGGGAGGGAGG - Intergenic
1113489422 13:110679641-110679663 GGGCGTGACCGGAGGGAGGGAGG + Intronic
1113604337 13:111594824-111594846 GGGGTGGTCTGGAGGGTGGATGG - Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113655633 13:112066748-112066770 GGGGAGGAGGGGAGGAAGGAGGG - Intergenic
1113677242 13:112215277-112215299 GGGGGGGACTGGAGGAGGGAGGG + Intergenic
1113680661 13:112242106-112242128 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1113773749 13:112930103-112930125 GGGATGGAGCGGAGGGAGTGGGG + Intronic
1114920573 14:27322770-27322792 GGGGTTGAGAGGAGGGAGGGAGG - Intergenic
1114993702 14:28319480-28319502 GGGGTGGAAAAGAGGGAGGGAGG + Intergenic
1115399590 14:32941234-32941256 GGAGGGGAAAGGAGGGAGGAGGG - Intronic
1115875597 14:37858031-37858053 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1116863754 14:50014995-50015017 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1116953068 14:50896295-50896317 GGGGTGGTATGGAGGGAGAATGG - Intronic
1116985371 14:51213762-51213784 AGGGTGGAGGGGAGGGGGGAGGG - Intergenic
1117035265 14:51721721-51721743 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1117294979 14:54370913-54370935 GAGGAGGACGGGGGGGAGGAGGG - Intergenic
1117401108 14:55358966-55358988 GGGATGGGAAGGAGGGAGGAAGG + Intronic
1117766222 14:59086052-59086074 TGGGTAGACCTGAGTGAGGAAGG - Intergenic
1117771939 14:59142311-59142333 TGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1117992601 14:61449323-61449345 GGGGAGGAAAGGAGGGAGGGAGG - Intronic
1118320061 14:64747794-64747816 GGGGTGGGGGGGAGGGCGGAGGG - Exonic
1118824095 14:69364788-69364810 GGAGTGGGCAGGAGGGTGGAAGG + Intergenic
1118998791 14:70862109-70862131 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1119166617 14:72499944-72499966 CGTGTGGGCTGGAGGGAGGATGG + Intronic
1119231475 14:72983338-72983360 GGGGTGGGGGGGAGGGGGGAAGG - Intronic
1119317617 14:73708691-73708713 GGGGTGGAATGGAGAGAGAATGG - Intergenic
1119380419 14:74224677-74224699 GGGCTCGACGGGAGGGAGGGGGG + Intergenic
1119435058 14:74593129-74593151 GGGGTGGAGTGAAGGGAGAAGGG - Intronic
1119457789 14:74771058-74771080 GGGCTGGGCCGTAGGGTGGATGG + Intronic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119993628 14:79227801-79227823 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1119993639 14:79227829-79227851 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1120438681 14:84509381-84509403 GGGGAGGAAGGGAGGAAGGAAGG + Intergenic
1120745016 14:88144915-88144937 GGGGTGGACCCGGAGGAGCAGGG - Intergenic
1120777401 14:88452696-88452718 GGGGTATACTGGAGGGAAGATGG - Intronic
1120909734 14:89655386-89655408 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
1121385373 14:93517175-93517197 GGGGTGGAGAGAGGGGAGGAAGG - Intronic
1121430734 14:93885690-93885712 GGGGGTGACAGAAGGGAGGAAGG - Intergenic
1121764921 14:96478186-96478208 GCGGGGGAAGGGAGGGAGGAAGG + Intronic
1121843858 14:97156254-97156276 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1121917053 14:97844753-97844775 GGAGAGGAAGGGAGGGAGGAAGG + Intergenic
1122114811 14:99522356-99522378 GGTGTGGAGGGGAGGGTGGAGGG - Intronic
1122297697 14:100714514-100714536 GGGGTGGAGTGGAGTGAGGAGGG - Intergenic
1122363413 14:101180776-101180798 GGGGTGACCCAGAGGGAGCAGGG - Intergenic
1122517994 14:102321977-102321999 GGGGTGGGGAAGAGGGAGGATGG - Intronic
1122582009 14:102777194-102777216 GGCGGGGACGGGAGGGAGGCGGG + Intergenic
1122624655 14:103078203-103078225 GGGGAGGAAGGGAGGAAGGAAGG + Intergenic
1122658534 14:103279144-103279166 GGAGGGGAGGGGAGGGAGGAAGG - Intergenic
1122662706 14:103308737-103308759 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1122835088 14:104426943-104426965 GGGGTGGGCGGGGAGGAGGAGGG - Intergenic
1123075292 14:105664858-105664880 TGGGTGGACTGAAGGGCGGATGG - Intergenic
1123191706 14:106578356-106578378 AGAGTGGACAGGAGGGAGGAAGG + Intergenic
1123833959 15:24169298-24169320 GGGGTGGAGCGGGGGCAGGGTGG - Intergenic
1123917707 15:25049023-25049045 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1124102155 15:26705707-26705729 AGGGTGGACACGAGAGAGGAAGG + Intronic
1124450422 15:29783789-29783811 GGGGACTACCGGAGGGTGGAGGG + Intronic
1124887616 15:33701653-33701675 GGGGTGGAGAGGAGGGACGTGGG + Intronic
1125527027 15:40383071-40383093 GGGCTGGATGGGAGGAAGGACGG + Intronic
1125582359 15:40795282-40795304 GGGATGGAAGGGAGGGGGGAGGG + Intronic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126628778 15:50712656-50712678 GGGGGGGGAGGGAGGGAGGAAGG - Intronic
1126889587 15:53190054-53190076 GGGCTGGAAGGGAGGGAGGGAGG + Intergenic
1126897507 15:53274948-53274970 AGGGTGGGAAGGAGGGAGGAAGG - Intergenic
1127116994 15:55738786-55738808 GGGGAGGAAGGTAGGGAGGAAGG + Intronic
1127260766 15:57324507-57324529 GGGAGGGACCTGAGGGGGGAGGG - Intergenic
1127260786 15:57324558-57324580 GGGAGGGACCTGAGGGAGGGAGG - Intergenic
1127260798 15:57324592-57324614 GGGAGGGACAGGAGGGAGGGAGG - Intergenic
1127423003 15:58826849-58826871 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1127983438 15:64050616-64050638 GGGGAGGAGAGAAGGGAGGAAGG + Intronic
1128501432 15:68229765-68229787 GGAGCGGAGCGGAGGGAGGCGGG + Intronic
1129538949 15:76335969-76335991 GTGGTGGAGGAGAGGGAGGAGGG + Intergenic
1129652740 15:77503122-77503144 GGGATGAACTGGAGGGAGGCTGG - Intergenic
1129687771 15:77696321-77696343 GGGGTGGAGGGAAGGGAGGCGGG - Intronic
1129717906 15:77862638-77862660 GGGGTGGCCAGGAGAGAGGCAGG + Intergenic
1129969404 15:79764201-79764223 GGGAAGGACCAGAAGGAGGAAGG + Intergenic
1130202971 15:81850598-81850620 GGGGTGGTCAGGAGGCAGAAGGG + Intergenic
1130214854 15:81958688-81958710 GGGGTGGTTTGGAGGAAGGAGGG - Intergenic
1130673168 15:85930719-85930741 GGGGTAGAGAGAAGGGAGGAGGG - Intergenic
1130673176 15:85930741-85930763 GGGGTAGAGAGAAGGGAGGAGGG - Intergenic
1130673183 15:85930762-85930784 GGGGTAGAGAGAAGGGAGGATGG - Intergenic
1130680532 15:85992497-85992519 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1130680537 15:85992509-85992531 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1130788161 15:87123252-87123274 GGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1130905385 15:88236640-88236662 GGGAAGGACGGAAGGGAGGAAGG + Intronic
1130959877 15:88652508-88652530 GGGGAGGAGGGGAAGGAGGAGGG - Intronic
1131009397 15:89004619-89004641 GGGAGGGAACGGAAGGAGGAAGG - Intergenic
1131284738 15:91047920-91047942 GGGGAGAAGCGGAGGGGGGAAGG - Intergenic
1131588539 15:93722447-93722469 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1131683155 15:94744923-94744945 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1132055430 15:98648128-98648150 GGGGTGGGCAGGAGAGGGGAGGG - Intergenic
1132154580 15:99486566-99486588 GGGGTGGAGTCGGGGGAGGAAGG + Intergenic
1132208449 15:100002828-100002850 GGGCTGGACAGCAGGAAGGAGGG - Intronic
1132260775 15:100422936-100422958 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1132318557 15:100908643-100908665 AGGGTGGGCTGGAGAGAGGAAGG - Intronic
1132700142 16:1218781-1218803 GGGGCAGGCAGGAGGGAGGATGG + Intronic
1132700164 16:1218860-1218882 GGGCTGGCCAGGAAGGAGGATGG + Intronic
1132705966 16:1243615-1243637 GGGATGGGCCAGAGGGAGGAAGG - Intergenic
1132850807 16:2024099-2024121 GAGGTGGGCGGGAGGGAGTAGGG - Intergenic
1133567456 16:7008873-7008895 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1133567500 16:7008977-7008999 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1133567519 16:7009021-7009043 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1133567524 16:7009033-7009055 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1133567558 16:7009109-7009131 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1133587711 16:7211950-7211972 GGGGTGGGTAGGAGGGAGTAGGG - Intronic
1133614160 16:7460554-7460576 GGGGTCTACCAGAGGGTGGAAGG + Intronic
1133643537 16:7741032-7741054 GGGATGGGGCAGAGGGAGGAGGG - Intergenic
1133663052 16:7937510-7937532 GGGGAGGAAGGGAGGGAAGAAGG - Intergenic
1133739483 16:8640635-8640657 TGGGTGGATGGGAGGGAGGGAGG + Intronic
1133773838 16:8883229-8883251 GAGGAGGACCATAGGGAGGAGGG - Intergenic
1133794317 16:9033772-9033794 GGGAGGGACCGAAGGAAGGAAGG - Intergenic
1133794334 16:9033828-9033850 GGGAGGGACCGAAGGAAGGAAGG - Intergenic
1133795285 16:9041462-9041484 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1133853051 16:9524231-9524253 GGGGAGGAACGGAGAGAGGGAGG - Intergenic
1133978148 16:10614967-10614989 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1134165703 16:11927624-11927646 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134287958 16:12879064-12879086 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1134350464 16:13432903-13432925 GGGGTCTATCGGAGGGTGGAGGG + Intergenic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134495031 16:14726185-14726207 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134500415 16:14765305-14765327 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134526955 16:14951917-14951939 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134545448 16:15104433-15104455 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134545461 16:15104504-15104526 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134580165 16:15363745-15363767 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134714543 16:16350451-16350473 AGGGTGGAGCTGAGGGTGGAAGG - Intergenic
1134722418 16:16393815-16393837 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134743167 16:16566482-16566504 GGGGGGGAAGGGAGGGAGGGGGG - Intergenic
1134881357 16:17747459-17747481 AGGGAGGAAGGGAGGGAGGATGG + Intergenic
1134924393 16:18145978-18146000 GGGGGGGAAGGGAGGGAGGGGGG + Intergenic
1134945009 16:18318054-18318076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134952273 16:18358207-18358229 AGGGTGGAGCTGAGGGTGGAAGG + Intergenic
1135050022 16:19185165-19185187 GGGGAGGAGGGGAGGGAGGAAGG - Intronic
1135310704 16:21402736-21402758 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310725 16:21402862-21402884 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310747 16:21402988-21403010 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310769 16:21403114-21403136 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310791 16:21403240-21403262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310837 16:21403505-21403527 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310858 16:21403631-21403653 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310880 16:21403757-21403779 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310901 16:21403883-21403905 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310918 16:21404009-21404031 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310935 16:21404113-21404135 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310958 16:21404240-21404262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310998 16:21404479-21404501 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311021 16:21404603-21404625 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311043 16:21404729-21404751 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363652 16:21835170-21835192 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363674 16:21835296-21835318 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363696 16:21835422-21835444 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363718 16:21835548-21835570 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135363740 16:21835674-21835696 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363762 16:21835800-21835822 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363807 16:21836065-21836087 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363829 16:21836191-21836213 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363851 16:21836317-21836339 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363868 16:21836443-21836465 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363885 16:21836550-21836572 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363907 16:21836676-21836698 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363929 16:21836802-21836824 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363951 16:21836928-21836950 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363972 16:21837054-21837076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363994 16:21837180-21837202 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135447847 16:22534168-22534190 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447869 16:22534294-22534316 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447890 16:22534420-22534442 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447930 16:22534660-22534682 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447947 16:22534764-22534786 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447964 16:22534890-22534912 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447986 16:22535016-22535038 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448007 16:22535142-22535164 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448029 16:22535268-22535290 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448050 16:22535394-22535416 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448096 16:22535659-22535681 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448118 16:22535785-22535807 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448140 16:22535911-22535933 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135708704 16:24696781-24696803 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1135725988 16:24854192-24854214 GGAGTGGGGCAGAGGGAGGAGGG - Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136285527 16:29238323-29238345 GGGGAGGAAAGGAGGGAGGGAGG + Intergenic
1136307450 16:29381937-29381959 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307472 16:29382063-29382085 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307494 16:29382189-29382211 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307517 16:29382328-29382350 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307539 16:29382454-29382476 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307561 16:29382580-29382602 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307583 16:29382706-29382728 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307605 16:29382832-29382854 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307627 16:29382958-29382980 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307645 16:29383084-29383106 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307663 16:29383209-29383231 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307684 16:29383335-29383357 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307705 16:29383461-29383483 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307726 16:29383587-29383609 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307747 16:29383713-29383735 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307767 16:29383839-29383861 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307791 16:29383977-29383999 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136317588 16:29463474-29463496 GGGCTTGACTGGAGGAAGGAGGG + Intronic
1136320974 16:29484141-29484163 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136320995 16:29484267-29484289 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321017 16:29484393-29484415 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321042 16:29484532-29484554 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321064 16:29484658-29484680 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321086 16:29484784-29484806 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321108 16:29484910-29484932 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321140 16:29485143-29485165 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321162 16:29485269-29485291 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321186 16:29485407-29485429 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136365106 16:29806232-29806254 GGGTGGGACGGGAGGGAGGGCGG - Intronic
1136432163 16:30202819-30202841 GGGCTTGACTGGAGGAAGGAGGG + Intronic
1136435547 16:30223481-30223503 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435568 16:30223607-30223629 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435590 16:30223733-30223755 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435612 16:30223859-30223881 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435634 16:30223985-30224007 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435654 16:30224111-30224133 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435679 16:30224250-30224272 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435701 16:30224376-30224398 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435723 16:30224502-30224524 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435755 16:30224735-30224757 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435777 16:30224861-30224883 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435799 16:30224987-30225009 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435821 16:30225113-30225135 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435843 16:30225239-30225261 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435867 16:30225377-30225399 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136556646 16:31010901-31010923 GGGGTGGCCCGGCGGAAAGAGGG + Intergenic
1136634830 16:31514025-31514047 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1136849684 16:33603106-33603128 GGAGGGGAGGGGAGGGAGGACGG - Intergenic
1137442285 16:48507700-48507722 GGGTTGGAGGGGAGGGATGAAGG + Intergenic
1137557056 16:49477296-49477318 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557066 16:49477317-49477339 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557081 16:49477347-49477369 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557091 16:49477368-49477390 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137632552 16:49957138-49957160 GGGGAGGACCAGTGGAAGGAAGG + Intergenic
1137737496 16:50735768-50735790 GGGTTGGATGGGAGGGATGAGGG + Intergenic
1137774069 16:51041038-51041060 GGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1137947719 16:52750912-52750934 GGGGAGGAGAGGAGAGAGGAGGG + Intergenic
1137997414 16:53233601-53233623 GGGGAGGAGGGGAGGAAGGAAGG - Intronic
1138567875 16:57846597-57846619 GGGGGAGAAAGGAGGGAGGATGG - Intronic
1138644227 16:58411592-58411614 GGGGAGGAAGGAAGGGAGGAAGG + Intergenic
1138988487 16:62361457-62361479 GGGGAGGAGAGGAGAGAGGAGGG + Intergenic
1139246796 16:65452412-65452434 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1139253531 16:65519566-65519588 GAGGTAGAAAGGAGGGAGGAAGG - Intergenic
1139282645 16:65783907-65783929 GTGGAGGCCCGGAGAGAGGAAGG - Intergenic
1139341382 16:66270137-66270159 AGGGAGGACGGGAGGGAGGGAGG + Intergenic
1139754552 16:69132295-69132317 GGGGTGGCCGGGAAGGGGGAGGG - Intronic
1140087882 16:71812549-71812571 GGGGAGGAAGGGAGGAAGGAAGG - Intergenic
1140207498 16:72945784-72945806 AGGCAGGACGGGAGGGAGGAAGG + Intronic
1140252353 16:73305172-73305194 GGGGTGGCCAGGTGGGAGGAAGG + Intergenic
1140270168 16:73458368-73458390 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1140865590 16:79058491-79058513 GGGATGGAAAGGAGGAAGGAAGG + Intronic
1140924720 16:79571231-79571253 GGGATGAGCGGGAGGGAGGAAGG + Intergenic
1141110784 16:81269198-81269220 GGGGTGGATGGGAGGCAGGAGGG - Intronic
1141141661 16:81500409-81500431 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1141430209 16:83967498-83967520 TGGATGGATGGGAGGGAGGATGG + Intergenic
1141488202 16:84355002-84355024 GGAGTGGAGGGGAGGGTGGATGG + Intergenic
1141557576 16:84846194-84846216 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1141682941 16:85554776-85554798 GGGGGGGGAGGGAGGGAGGACGG + Intergenic
1141693009 16:85607066-85607088 GGGGGGGGCGGGAGGGAGGAGGG + Intergenic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141798968 16:86294560-86294582 GGGAAAGACAGGAGGGAGGAGGG - Intergenic
1141860358 16:86712270-86712292 AGGGTGCTCGGGAGGGAGGAGGG - Intergenic
1141980720 16:87548261-87548283 CGTGTGGATCAGAGGGAGGAAGG + Intergenic
1142090854 16:88208463-88208485 GGGGAGGAGAGGAGGGAGGGAGG + Intergenic
1142251420 16:88993706-88993728 GAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1142252589 16:88999586-88999608 GGGGGGGGGCGGAGGGAGGAGGG + Intergenic
1142252609 16:88999633-88999655 GGGGCGGGACAGAGGGAGGAGGG + Intergenic
1142252643 16:88999706-88999728 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252656 16:88999730-88999752 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252674 16:88999769-88999791 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142252700 16:88999824-88999846 GGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1142274654 16:89111471-89111493 AGGGTGTGGCGGAGGGAGGAGGG - Intronic
1142329802 16:89444462-89444484 GGGGTGGAGTGGAGGGAGGGGGG + Intronic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1142597279 17:1035766-1035788 GGGGAGGGGCTGAGGGAGGATGG - Intronic
1142757215 17:2023677-2023699 GGGGTGGAGGGGGGGGAGGTTGG - Intronic
1143021203 17:3917995-3918017 GGGAGGGAACGGAGGGAGGAAGG + Intergenic
1143325333 17:6094789-6094811 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1143498179 17:7324233-7324255 GGCGTGGTACGGCGGGAGGACGG - Exonic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143584368 17:7844042-7844064 GGGGGGGTCCTGAGGGAGGGAGG - Intronic
1143631723 17:8143726-8143748 GGGGTGGGCCAGGGGGTGGAGGG + Exonic
1144046109 17:11456177-11456199 ACGGAGGACCGGAGGGAGGGAGG + Intronic
1144654289 17:17025407-17025429 GAGGTAGACCTGAGGGAGGGAGG + Intergenic
1144836009 17:18157078-18157100 GGGGTGGGCTGGGGGCAGGAGGG + Intronic
1145392823 17:22469287-22469309 TGAGTGCACCGCAGGGAGGAAGG + Intergenic
1145692377 17:26755875-26755897 GGAATGGAAGGGAGGGAGGAAGG + Intergenic
1146422210 17:32698277-32698299 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1146488437 17:33262424-33262446 GAGGAGGAAGGGAGGGAGGAAGG + Intronic
1146820886 17:35982957-35982979 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1146824409 17:36010423-36010445 GGGGTGGACCTGGCGGAGCAGGG - Intergenic
1146944546 17:36864754-36864776 AGGGAGGAGGGGAGGGAGGAAGG - Intergenic
1146969397 17:37060302-37060324 GGGGCAGATAGGAGGGAGGAGGG + Intergenic
1147140199 17:38456307-38456329 TGTGTGGACAGGAGGGTGGATGG + Intronic
1147193031 17:38748226-38748248 GGGGGGGATGGGAGGGAGGGAGG + Exonic
1147692420 17:42324675-42324697 CGGGTGGGCGGGAGGGAGAAGGG + Intronic
1147966860 17:44198822-44198844 GGGCTGGTCCTGAGGGAGGGCGG - Intronic
1148205149 17:45775320-45775342 CGTGAGGACAGGAGGGAGGATGG - Intergenic
1148232766 17:45947221-45947243 GTGGTGGGCAGGAGAGAGGAGGG + Intronic
1148335115 17:46835775-46835797 GGGTTGGAGGGAAGGGAGGAGGG + Intronic
1148776077 17:50096315-50096337 GGGGTGGCCCTGGGGCAGGAGGG + Intronic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1150216947 17:63476531-63476553 GGGGGGGAGAGGAGGGAGGCGGG - Intergenic
1150345093 17:64398439-64398461 GAGGTGGAGTGGGGGGAGGAAGG + Intronic
1150455473 17:65303697-65303719 GGGGTGGGAGGGAGGGAGGGAGG + Intergenic
1150501929 17:65659478-65659500 GGGGTGCACCGGTGGGACAACGG - Intronic
1150697735 17:67420371-67420393 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1151051012 17:70978584-70978606 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1151310501 17:73289736-73289758 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1151345862 17:73500780-73500802 GGAGGAGAACGGAGGGAGGATGG - Intronic
1151367342 17:73626158-73626180 GGAGAGGCCAGGAGGGAGGAAGG + Intronic
1151390747 17:73785239-73785261 GGGGTGGGACGGGGGGATGATGG + Intergenic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151540498 17:74762305-74762327 TGGGTGGATGGGAGGGAGGGAGG + Intronic
1151569181 17:74917582-74917604 GGGGTGGACGGGAGGAGGGGAGG + Exonic
1151686957 17:75653060-75653082 GTGGTGGGGCGGAGGGAGGTGGG + Intronic
1152053065 17:77997580-77997602 AGGGTGGAGCGGAGGCATGAGGG + Intergenic
1152162040 17:78674924-78674946 GGGGTGCACTGGAGTGAGGGGGG - Exonic
1152362393 17:79838881-79838903 GAGGTGGGGTGGAGGGAGGAGGG - Intronic
1152473630 17:80503758-80503780 GGGGTGGAGGGGTGGGTGGATGG + Intergenic
1152540060 17:80970324-80970346 GGTGGGCACCGGAGGGAGGATGG - Intergenic
1152588413 17:81199326-81199348 GGGGTGGACTGCAGCCAGGAAGG - Intronic
1152596345 17:81239499-81239521 GAGGTGGCTGGGAGGGAGGACGG + Intronic
1152728227 17:81958043-81958065 TGGGTGGACTGGAGGAAGGCGGG + Intronic
1152793813 17:82296909-82296931 GGGGTGGAGAGGAGGGAGGGAGG - Intergenic
1152915329 17:83031713-83031735 GGGGTGGGTCCCAGGGAGGATGG + Intronic
1203183865 17_KI270729v1_random:93198-93220 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1153318916 18:3752518-3752540 AGGGAGGAACGGAGGGAGGGAGG - Intronic
1153320812 18:3772426-3772448 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1153320815 18:3772434-3772456 GGGGTGGGGGGGAGGGAGGGAGG - Intronic
1153408461 18:4766767-4766789 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1153574120 18:6503974-6503996 GAGGAGGAAGGGAGGGAGGAGGG + Intergenic
1153831794 18:8930269-8930291 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1153997405 18:10454433-10454455 GGAGGGGAGCGGGGGGAGGAGGG + Intergenic
1154333403 18:13447981-13448003 GGGGTGGCCGGGAGGGTGTAGGG + Intronic
1155055703 18:22180946-22180968 GGGGTGGGCGGCAGGGAGGTGGG + Intronic
1155079159 18:22390381-22390403 GGGGTGGGGTGGAGGGAGGGAGG + Intergenic
1155334248 18:24748733-24748755 AGGGAGGAAGGGAGGGAGGAGGG - Intergenic
1155507699 18:26548712-26548734 GGGATGGAGGGGAGGGGGGAGGG + Intronic
1155524487 18:26702698-26702720 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1155844730 18:30691648-30691670 GGGGTGTACTTGAGGGTGGAAGG - Intergenic
1156466099 18:37348608-37348630 GGGGTGGGACGGTGGGGGGATGG + Intronic
1156473339 18:37390967-37390989 GACGGGGACAGGAGGGAGGACGG - Intronic
1156781747 18:40858254-40858276 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1156829862 18:41478686-41478708 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1157223177 18:45841394-45841416 AGGGTGGACGGGAGGAAGGCAGG + Intronic
1157294910 18:46435425-46435447 AGGGAGGAAGGGAGGGAGGAGGG + Intronic
1157296817 18:46450976-46450998 GGTGTGGCCAGGAGGGAAGATGG + Intronic
1157358296 18:46955078-46955100 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1157650883 18:49329285-49329307 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1158142410 18:54269559-54269581 GGGGTGGAGCCGGAGGAGGAAGG + Exonic
1158153096 18:54394405-54394427 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1158321652 18:56270520-56270542 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
1158528177 18:58234263-58234285 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1158602251 18:58864580-58864602 GGGGTGGAGGGGAGGGGGGATGG + Intronic
1158839582 18:61369901-61369923 GGGGTCTAACGGAGGGTGGAAGG + Intronic
1158857293 18:61555274-61555296 GGGGTGGATGGGTGGGAGGGTGG + Exonic
1159104552 18:63990657-63990679 GGGGTGGGGGGGAGGGATGAGGG - Intronic
1159356060 18:67338265-67338287 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1159356079 18:67338333-67338355 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1159356104 18:67338409-67338431 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1159369937 18:67516778-67516800 GGGGCGGGGCGGAGGCAGGACGG + Exonic
1159550901 18:69894635-69894657 GGAGGGGAGGGGAGGGAGGAAGG + Intronic
1159850787 18:73525049-73525071 GGGATGGATGGTAGGGAGGAGGG - Intergenic
1160089037 18:75808670-75808692 GGGATGGACAGAAGGCAGGATGG - Intergenic
1160356088 18:78229531-78229553 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
1160356147 18:78229695-78229717 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1160543112 18:79636135-79636157 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160570433 18:79813543-79813565 GGGGTAGCGTGGAGGGAGGATGG + Intergenic
1160700426 19:504234-504256 AGGGCAGACCGGAGAGAGGACGG - Intronic
1160709637 19:545058-545080 TGGATGGATGGGAGGGAGGAGGG - Intronic
1160810866 19:1012395-1012417 GGAGGAGACCCGAGGGAGGAGGG + Intronic
1160812158 19:1017540-1017562 GGGCTGACCCGGAGGAAGGAAGG - Intronic
1160926523 19:1549386-1549408 TGGGTGGACAGGAAGGGGGATGG - Intergenic
1160939692 19:1614462-1614484 GGGATGGAGGGGAGGGCGGAAGG + Intronic
1161063715 19:2227554-2227576 GCGGGGGGCCGGAGGGCGGAGGG + Intronic
1161207064 19:3046902-3046924 GGGGAGGAGGAGAGGGAGGAGGG - Intronic
1161222859 19:3126037-3126059 TGGTTGGAGCGGAGGGAGGGGGG + Intergenic
1161241521 19:3225896-3225918 GGGGTGGACAGGGAGGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161278691 19:3433633-3433655 GGAGGGGGCCGCAGGGAGGAAGG + Intronic
1161374656 19:3933322-3933344 GGGGTGGAGAGGAGGGAGGAGGG + Intronic
1161399255 19:4060178-4060200 GGAGTGGCCCGGGGGGAGGAGGG - Intronic
1161477677 19:4495542-4495564 GGGCTGGAGTGGAGGGAGGAGGG + Intronic
1161554496 19:4932982-4933004 GGGGAGGAAAGGAGAGAGGAAGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161714604 19:5868183-5868205 GGGGAGGATAGGAGGGAGAATGG + Intronic
1161741681 19:6024745-6024767 GGTGAGGACGGGAGTGAGGACGG + Intronic
1161741688 19:6024774-6024796 GGTGAGGACGGGAGTGAGGACGG + Intronic
1161741695 19:6024803-6024825 GGTGAGGACGGGAGTGAGGACGG + Intronic
1161741702 19:6024832-6024854 GGTGAGGACGGGAGTGAGGACGG + Intronic
1161741709 19:6024861-6024883 GGTGAGGACGGGAGTGAGGACGG + Intronic
1161756605 19:6138536-6138558 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1161857106 19:6772396-6772418 GGGCTGGACCAGACAGAGGAGGG + Intergenic
1161868079 19:6849243-6849265 GGGGAGCACTAGAGGGAGGAGGG - Intronic
1161913892 19:7214798-7214820 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1161974533 19:7600746-7600768 TGGGTGGAAGGGTGGGAGGATGG - Intronic
1161979658 19:7623957-7623979 GGGCTGGAGCGGAGTGAGGGTGG - Intronic
1161989491 19:7676641-7676663 GGGGTGGAGCTGAGGCTGGAGGG + Exonic
1162110367 19:8396712-8396734 GGGGGGGGCGGGAGGGAGGAGGG + Intronic
1162185574 19:8902063-8902085 GGGGTGGGGCGGAGTGAGGAGGG + Intronic
1162188074 19:8922690-8922712 GGGGTGGACCAGGGTGAGGTGGG + Intronic
1162301395 19:9847072-9847094 GGGGTGGCCTGGAGTCAGGAAGG + Intronic
1162526538 19:11209819-11209841 GGGGTGGACAGGTGAGAGGGTGG - Intronic
1162561740 19:11421382-11421404 GGGGCGGACCTGAGTGATGAGGG - Intronic
1162584720 19:11551839-11551861 GGGGTGGGCGGGCGGCAGGAAGG + Intronic
1162783581 19:13020395-13020417 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
1162823336 19:13236468-13236490 GGGGAGGACGGGAGGGAGCTGGG + Intronic
1162999329 19:14356227-14356249 GGGGTGGCCAGGAGGGAAGCTGG + Intergenic
1163064802 19:14785125-14785147 GGGGTGGCCAGGAGGGAAGCTGG - Intergenic
1163204898 19:15795197-15795219 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1163207267 19:15812727-15812749 AGGGAGGAATGGAGGGAGGAAGG + Intergenic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163238416 19:16043346-16043368 GGGGTGGATGGGTGGGTGGATGG + Intergenic
1163327751 19:16616053-16616075 GGCATGGACTGGAGAGAGGAAGG + Intronic
1163350604 19:16774344-16774366 TGGGTGGATGGGTGGGAGGATGG - Intronic
1163448816 19:17363540-17363562 AGGGTGGAAGGGAGGGGGGAAGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163609330 19:18292867-18292889 GGGGGAGACGGGAGGGAGAAGGG - Intergenic
1163663820 19:18594026-18594048 TGGGTGGGCGGGAGGGAGCAAGG - Intronic
1163675595 19:18653931-18653953 TGGGTGGACAGGTGGGTGGATGG - Intronic
1163682042 19:18688340-18688362 TGGGTGGAAAGCAGGGAGGAGGG + Intronic
1163730193 19:18944548-18944570 AGGGTGGGGGGGAGGGAGGAAGG + Intergenic
1163779591 19:19239503-19239525 GGGGAGGAGAGGAGGGAGAAGGG - Intronic
1163779607 19:19239564-19239586 AGGGAGGAGGGGAGGGAGGATGG - Intronic
1164441829 19:28284896-28284918 GGGGTGGAGGGGAAGGAGGGTGG + Intergenic
1164654501 19:29910553-29910575 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1164862749 19:31575495-31575517 TGGGTGGTCTGGAAGGAGGAGGG + Intergenic
1164970237 19:32525970-32525992 GGGGAGGATAGGAGGGAGGTGGG - Intergenic
1165101991 19:33444526-33444548 GGGGTGGAAGGGGAGGAGGAGGG - Intronic
1165432782 19:35781932-35781954 GGGGTGGCCAAGAGGGAGGCAGG + Intronic
1165489820 19:36116499-36116521 GAGGTGGAAAGGAGGGAGCAGGG + Intronic
1165590352 19:36963989-36964011 GGGGAGGGACGGAGGGAGGGAGG + Intronic
1165670291 19:37672444-37672466 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1165872989 19:38986369-38986391 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1165911358 19:39230134-39230156 GGAGGGGAGGGGAGGGAGGAAGG + Intergenic
1166040360 19:40198586-40198608 GGGGAGTAAGGGAGGGAGGAAGG + Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1166503050 19:43355040-43355062 GGGGTGGGCAGGGTGGAGGAGGG - Intronic
1166507402 19:43379692-43379714 GGGGTGGGCAGGGTGGAGGAGGG + Intergenic
1166546217 19:43636050-43636072 GGGCTGGATCTGATGGAGGAGGG - Intronic
1166648087 19:44547591-44547613 GGGGAGGAAGGGAGGGAGGGAGG + Intergenic
1166691067 19:44821345-44821367 GGGGTGGGGCGGAGGTAGGGCGG - Exonic
1166692757 19:44833559-44833581 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1166979659 19:46625104-46625126 AGGGAGGGACGGAGGGAGGAGGG - Exonic
1166981269 19:46633648-46633670 GGGGAGGAGAGGAGAGAGGATGG + Intergenic
1167055036 19:47105037-47105059 GGAGTGGAACGCAGGGAGAATGG + Intronic
1167129252 19:47573402-47573424 GGGGAGGAGCGGCGGGGGGAGGG + Intergenic
1167195226 19:48023567-48023589 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1167240860 19:48342273-48342295 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1167396849 19:49235077-49235099 GGGGAGGAAAGGAGAGAGGAAGG + Intergenic
1167418547 19:49389789-49389811 TGGGTGGAATGGAGGCAGGATGG + Intronic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167483669 19:49747669-49747691 TGGGTGGACCGAAGAGAGGTGGG - Intronic
1167502635 19:49856376-49856398 GGGGTGGCCCGGTGTGGGGAGGG + Intronic
1167552685 19:50171989-50172011 GAGGTGGACTGGAGGCAGGTTGG - Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167611110 19:50508098-50508120 GGAATGGACTGGAGGGAGGCTGG - Intronic
1167638522 19:50668226-50668248 GGGGCGGCCCGGAGGGAGGGGGG - Exonic
1168097606 19:54124474-54124496 GCGGTGGGAGGGAGGGAGGAAGG - Intronic
1168107414 19:54173206-54173228 CAGGTGGCCCGGAGGGAGTAAGG + Exonic
1168143944 19:54408655-54408677 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1168143956 19:54408678-54408700 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168325499 19:55536769-55536791 GGGCTGGGTCGGAGGGAGGTGGG - Intronic
1168344590 19:55644028-55644050 TGGGTGGACGGGTGGGAGCACGG + Intronic
1168346693 19:55653258-55653280 TGGGTGGTCAGGCGGGAGGACGG + Intergenic
1168348011 19:55660241-55660263 GGAGTGGACATCAGGGAGGAAGG - Intronic
1168389141 19:55992024-55992046 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1168389380 19:55993516-55993538 GGGGGGGAGGGGAGGGGGGAGGG - Intergenic
1168418216 19:56183001-56183023 AGGGTGGAGCAGGGGGAGGAGGG - Intronic
1168521730 19:57056511-57056533 GGGGCAGACCTGAGGGTGGAGGG + Intergenic
924979355 2:207018-207040 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979360 2:207030-207052 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979365 2:207042-207064 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979370 2:207054-207076 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979385 2:207090-207112 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979390 2:207102-207124 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979455 2:207246-207268 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979460 2:207258-207280 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979501 2:207358-207380 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979506 2:207370-207392 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979519 2:207402-207424 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979543 2:207458-207480 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979603 2:207602-207624 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979627 2:207658-207680 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
924979641 2:207694-207716 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
925051402 2:818481-818503 GAGGTGGACCCGGGGGAGGCTGG - Intergenic
925775875 2:7335180-7335202 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926157318 2:10463840-10463862 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
926291971 2:11538812-11538834 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
926291986 2:11538852-11538874 AGGGAGGGACGGAGGGAGGAAGG - Intronic
926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG + Intronic
926408169 2:12574916-12574938 GGGGTGGTGCGGAGAGAGAATGG - Intergenic
926495040 2:13575842-13575864 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
926707084 2:15844601-15844623 GGGGTGGGGCGGAGGGGGGGTGG - Intergenic
926711091 2:15881429-15881451 GGGGTGGCGGGGAGGGTGGAGGG + Intergenic
926728929 2:16020058-16020080 GGGGTTGAGGGGAGGGAGGGAGG + Intergenic
926733736 2:16057131-16057153 GGGGTGAGAGGGAGGGAGGACGG - Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926815134 2:16792450-16792472 GGGGTGGTGCGGAGAGAGAATGG + Intergenic
927350387 2:22105624-22105646 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
927350392 2:22105636-22105658 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
927362816 2:22256178-22256200 GGGGTGGGCAGGAGGGAGCAAGG - Intergenic
927920854 2:26970932-26970954 GGGGTTGACCGGCGCGGGGAAGG - Intronic
927939136 2:27092825-27092847 GGCCTGGACCTGGGGGAGGATGG - Intronic
928041535 2:27882915-27882937 GGGGTCTACCTGAGGGTGGAGGG + Intronic
928105834 2:28470076-28470098 GGGGAGGAGGAGAGGGAGGAGGG + Intronic
928406949 2:31022181-31022203 GGGGAGGAAGGGAGGGAAGAAGG + Intronic
928512447 2:32014040-32014062 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
928602381 2:32916072-32916094 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
928602405 2:32916139-32916161 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
929261675 2:39873057-39873079 GGAGGGGAGGGGAGGGAGGAGGG - Intergenic
929317164 2:40493346-40493368 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
929423455 2:41818969-41818991 GGGGAGGAAGGGAGGAAGGAAGG + Intergenic
929635904 2:43520962-43520984 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
930036100 2:47086120-47086142 GGGGTGGCCCGCACGGAGGAGGG - Intronic
930318774 2:49828551-49828573 GGAGTGGCCCTGAGGGATGATGG - Intergenic
930632866 2:53772868-53772890 GGGGTCTACGGGAGGGTGGAGGG - Intronic
930639496 2:53840549-53840571 GGAGGGGAGGGGAGGGAGGAGGG + Intergenic
930700794 2:54456585-54456607 GCGGCGGACGGGCGGGAGGAGGG + Intronic
930736934 2:54788950-54788972 GGGGTGGGGCGGATGGAGAAGGG - Intronic
931115447 2:59162049-59162071 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
931121643 2:59226436-59226458 GGGGTGGAAGGGAGGGAGGGAGG + Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931494936 2:62795246-62795268 GGGGTAGGATGGAGGGAGGAAGG - Intronic
931635918 2:64340758-64340780 GGGGTGGGACGTAAGGAGGATGG - Intergenic
931846790 2:66212217-66212239 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
932071607 2:68626349-68626371 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932880853 2:75500725-75500747 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
932955343 2:76345293-76345315 GGGGTGGGGGGGAGGGAGGAGGG - Intergenic
933271310 2:80235963-80235985 GGGGTCTACTGGAGGGTGGAGGG - Intronic
933635883 2:84708482-84708504 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
933665309 2:84960086-84960108 GGAGGGGAGTGGAGGGAGGAGGG - Intergenic
933672040 2:85017553-85017575 GGGGTGGGGTGGAGGGAGGGAGG - Intronic
933936576 2:87208942-87208964 GGAGGGGAGGGGAGGGAGGAGGG - Intergenic
933946241 2:87288536-87288558 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
934056111 2:88252971-88252993 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
934154329 2:89181695-89181717 GGGGTCTACCTGAGGGTGGAGGG + Intergenic
934212902 2:90000245-90000267 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
934735710 2:96688903-96688925 GGGGTGAAGGGGAGGGAGCAGGG - Intergenic
935493276 2:103746828-103746850 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
935765830 2:106366896-106366918 TGGGTTGACCTGAGGGTGGATGG + Intergenic
935989855 2:108709319-108709341 GGAGGGGAGGGGAGGGAGGAAGG + Intergenic
936240018 2:110779394-110779416 GGGGGAGAGAGGAGGGAGGAAGG + Intronic
936333974 2:111573047-111573069 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
936356568 2:111756884-111756906 GGAGGGGAGGGGAGGGAGGAGGG + Intergenic
936501118 2:113067141-113067163 AGGGTGGACAGAAGGGTGGATGG + Intergenic
937183022 2:120013053-120013075 GGGGTGGACGGGCGGGAGGTCGG + Exonic
937267857 2:120628373-120628395 GGGGAGAATTGGAGGGAGGAAGG + Intergenic
937424701 2:121789412-121789434 GGGGTGGCGAGAAGGGAGGAAGG - Intergenic
937920023 2:127122357-127122379 GGGGTGGGCGTGTGGGAGGAAGG - Intergenic
938077199 2:128346189-128346211 GGGGTGGCCTAGGGGGAGGAAGG + Intergenic
938120337 2:128628577-128628599 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
938120342 2:128628589-128628611 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
938943603 2:136190843-136190865 GGAGTGGGGAGGAGGGAGGAGGG + Intergenic
939134021 2:138273141-138273163 GGGGTGGGGCGGTGGGGGGAAGG + Intergenic
939261807 2:139820425-139820447 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
939275070 2:139990284-139990306 GGGGGGGACGGGCGGGGGGAGGG - Intergenic
939887795 2:147700099-147700121 GGGGTGGAATGGAGAAAGGAAGG - Intergenic
940179707 2:150918509-150918531 GGGGAGGAAGGGAGGAAGGAAGG + Intergenic
940182281 2:150948241-150948263 AGGGTGGGAGGGAGGGAGGAAGG - Intergenic
941513697 2:166445375-166445397 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
941705072 2:168649760-168649782 GGGATAGCCCAGAGGGAGGAGGG - Intronic
942041526 2:172068865-172068887 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
942213078 2:173691267-173691289 GGGGTAGAGGGGAGGGAGGGAGG + Intergenic
942496061 2:176541110-176541132 GGGGAGGAGGGGAGGGAGGGAGG + Intergenic
942602411 2:177654823-177654845 TGGGAGGAAAGGAGGGAGGAAGG - Intronic
942640433 2:178055348-178055370 GGGGTGGGGGGGAGGGAGGAGGG + Intronic
942729202 2:179045152-179045174 GGGGTCGAGGGGAGGGGGGAGGG - Intronic
943300427 2:186191214-186191236 GGGAGGGAACGGAGGGAGGGAGG + Intergenic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945028955 2:205645805-205645827 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
945111655 2:206366129-206366151 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
945142384 2:206700420-206700442 GGGAAGGAGAGGAGGGAGGAGGG + Intronic
945323756 2:208458601-208458623 GGGGTGTACTTGAGGGGGGAAGG - Intronic
945938739 2:215927577-215927599 GGGGTGGTATGGAGGGAGAATGG - Intergenic
946180670 2:217947154-217947176 GGGGTGGGAGGGAGGGAGGTAGG - Intronic
946248839 2:218401136-218401158 GGGGTGGAGAGGATGGAGGGAGG + Intronic
946519093 2:220446634-220446656 GGGGAGGAAGGGAGGGGGGAAGG - Intergenic
946553110 2:220823920-220823942 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
946686980 2:222280321-222280343 GGAGGGGAGGGGAGGGAGGAAGG + Intronic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947006053 2:225512640-225512662 TGGGAGGAAGGGAGGGAGGAAGG - Intronic
947077710 2:226363900-226363922 AGGGAGGAACGGAGGGAGGAAGG + Intergenic
947077729 2:226363950-226363972 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077734 2:226363962-226363984 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077740 2:226363974-226363996 AGGGAGGAAGGGAGGGAGGAGGG + Intergenic
947077746 2:226363986-226364008 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077751 2:226363998-226364020 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077756 2:226364010-226364032 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077781 2:226364081-226364103 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077787 2:226364093-226364115 AGGGAGGAAGGGAGGGAGGAGGG + Intergenic
947077793 2:226364105-226364127 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077799 2:226364117-226364139 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077804 2:226364129-226364151 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077809 2:226364141-226364163 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077824 2:226364177-226364199 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077829 2:226364189-226364211 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077835 2:226364201-226364223 AGGGAGGAAGGGAGGGAGGAGGG + Intergenic
947077841 2:226364213-226364235 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077847 2:226364225-226364247 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077853 2:226364237-226364259 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077859 2:226364249-226364271 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077865 2:226364261-226364283 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077870 2:226364273-226364295 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077884 2:226364309-226364331 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077889 2:226364321-226364343 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077894 2:226364333-226364355 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947077908 2:226364369-226364391 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
947179759 2:227401565-227401587 GCAGTGGAGCTGAGGGAGGAGGG + Intergenic
948282738 2:236760350-236760372 GGGAGGGAGAGGAGGGAGGAAGG + Intergenic
948297519 2:236873536-236873558 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
948542645 2:238701494-238701516 GGGGCGGGCCGCAGGCAGGAAGG - Intergenic
948577658 2:238965023-238965045 GGGGGAGGCAGGAGGGAGGAGGG - Intergenic
948635054 2:239329494-239329516 GGGGTGTCCCGGTGGGAGGAGGG - Intronic
948635157 2:239329967-239329989 GGGGTGTCCTGGTGGGAGGAGGG + Intronic
948677636 2:239608161-239608183 GGGAAGGAAGGGAGGGAGGAGGG - Intergenic
948695653 2:239732012-239732034 GAGGTGGAGGGGAGGAAGGAGGG - Intergenic
948695688 2:239732093-239732115 GAGGTGGAGGGGAGGAAGGAGGG - Intergenic
948760479 2:240187242-240187264 GGGGTGGGAGGGAGGAAGGAGGG + Intergenic
948802797 2:240440545-240440567 GGGCAGGACCGGAGGCAGGGAGG - Intronic
948802809 2:240440580-240440602 GGGCAGGACCGGAGGCAGGGAGG - Intronic
948802821 2:240440615-240440637 GGGCAGGACCGGAGGCAGGGAGG - Intronic
948802833 2:240440650-240440672 GGGCAGGACCGGAGGCAGGGAGG - Intronic
948802845 2:240440685-240440707 GGGCAGGACCGGAGGCAGGGAGG - Intronic
948802857 2:240440720-240440742 GGGCAGGACCGGAGGCAGGGAGG - Intronic
948802869 2:240440755-240440777 GGGCAGGACCGGAGGCAGGGAGG - Intronic
948864652 2:240769164-240769186 GGTGTGGCCATGAGGGAGGATGG - Exonic
948965244 2:241374568-241374590 GGGGTGGGAAGGAGGGAAGAGGG + Intronic
1168918558 20:1511923-1511945 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1168952944 20:1814952-1814974 TGGGTGGATGGGAGGGTGGATGG + Intergenic
1169611598 20:7386847-7386869 GGGGTGGGGCGGCGGGAGGCAGG - Intergenic
1169709723 20:8548069-8548091 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1170166163 20:13362142-13362164 GGGGTGGTGCGGAGAGAGAATGG - Intergenic
1170408597 20:16065211-16065233 GGAGAGGAGAGGAGGGAGGAAGG + Intergenic
1170501817 20:16982450-16982472 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1171036288 20:21714968-21714990 GGGGTGGAAGGTAGGGAGGAAGG - Exonic
1171456553 20:25275833-25275855 AGGGTTGACAGGAGAGAGGAAGG + Intronic
1171749013 20:29029100-29029122 GGTGTGAACAGGAGGCAGGAGGG + Intergenic
1172113943 20:32562937-32562959 AGGGTGGAGGGGAGGGAGGGTGG + Intronic
1172126370 20:32627338-32627360 GGGGCGGGCTGGAGGCAGGATGG - Intergenic
1172146474 20:32761872-32761894 TGGGTGGAAGGAAGGGAGGAAGG + Intergenic
1172184621 20:33023607-33023629 GGGGTGGGGCAGAGGAAGGAGGG - Exonic
1173161870 20:40658781-40658803 GGGGTGGATCGCAGGATGGAGGG + Intergenic
1173434149 20:43017406-43017428 GAGGTGGGCCGGAGGAGGGAGGG - Intronic
1173440108 20:43068122-43068144 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1173477015 20:43367021-43367043 GGGGACTACCAGAGGGAGGAAGG + Intergenic
1173618652 20:44419692-44419714 GGGTTGGGAGGGAGGGAGGATGG - Intronic
1173662671 20:44745396-44745418 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1173662679 20:44745416-44745438 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1173662687 20:44745436-44745458 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1173750052 20:45469674-45469696 GGGGTGGAGCCGAGCGGGGAAGG - Intergenic
1174164578 20:48575708-48575730 GGGGAGGAGGGGAGGGAGGGAGG + Intergenic
1174354926 20:49991135-49991157 GGGAAGGAAAGGAGGGAGGATGG + Intergenic
1174512602 20:51065630-51065652 GGGGTTTACTGGAGGGTGGAGGG - Intergenic
1174790036 20:53469619-53469641 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1174790059 20:53469715-53469737 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1174793662 20:53503708-53503730 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1174793671 20:53503732-53503754 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1175135211 20:56818353-56818375 GGAGGTGACAGGAGGGAGGAGGG + Intergenic
1175372379 20:58500730-58500752 GGTGTGGCCTGGAGGAAGGATGG - Intronic
1175573621 20:60042831-60042853 GGGGTGGGAGGGAGGCAGGAAGG + Intergenic
1175668734 20:60882749-60882771 GGGGTGGACAGGAGGCAAGGAGG - Intergenic
1175757728 20:61540053-61540075 GGTGTAGACCTGAGGGTGGAGGG + Intronic
1175889391 20:62309627-62309649 GGGGTGGAGGGGTGGGGGGAGGG + Intronic
1175917074 20:62430977-62430999 AGGGTGGAGGGAAGGGAGGATGG - Intergenic
1175921078 20:62450916-62450938 GGAGGGGACCTGGGGGAGGAAGG - Intergenic
1175985183 20:62760974-62760996 GGTGAGGATGGGAGGGAGGAGGG - Exonic
1176034086 20:63028033-63028055 GGAGTGGACCGGTGGGGAGAGGG + Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1176162187 20:63653532-63653554 GGGAAGGAGCGGGGGGAGGAGGG + Intergenic
1176365068 21:6027794-6027816 GGGTTGGGGCTGAGGGAGGAAGG + Intergenic
1176513702 21:7767452-7767474 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1176956825 21:15115282-15115304 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1177513764 21:22121993-22122015 GGGGAGGACCTGAAGGAGCAGGG - Intergenic
1177708237 21:24736983-24737005 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1177718090 21:24866521-24866543 GGGGTCTATCGGAGGGTGGAGGG - Intergenic
1177722290 21:24923863-24923885 GGGGTGGAGGTGTGGGAGGAGGG - Intergenic
1178357856 21:31923520-31923542 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178598323 21:33974679-33974701 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1178647815 21:34397976-34397998 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1178857226 21:36260237-36260259 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887695 21:36496712-36496734 GGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887700 21:36496724-36496746 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887717 21:36496764-36496786 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887744 21:36496832-36496854 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887749 21:36496844-36496866 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887757 21:36496864-36496886 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887797 21:36496956-36496978 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887824 21:36497016-36497038 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887862 21:36497104-36497126 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887870 21:36497124-36497146 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887887 21:36497164-36497186 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887902 21:36497200-36497222 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887924 21:36497252-36497274 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1179019285 21:37623617-37623639 AGGGAGGAAGGGAGGGAGGAAGG - Exonic
1179218845 21:39389075-39389097 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1179244747 21:39623130-39623152 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1179374779 21:40840843-40840865 GAGGTGGACGGGAGGGAGGAAGG + Intronic
1179395240 21:41033621-41033643 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1179758450 21:43510751-43510773 GGGTTGGGGCTGAGGGAGGAAGG - Intergenic
1179801926 21:43815223-43815245 GGGGTGGGCGGGGGGGAGGGGGG + Intergenic
1179979577 21:44889088-44889110 GGTGCGCACAGGAGGGAGGAGGG + Intronic
1180112148 21:45664757-45664779 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
1180156200 21:45978300-45978322 GGAGGGGACAGGAGAGAGGAGGG + Intergenic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1180981304 22:19879400-19879422 GGGGTGGCCTGGAGGGATGCGGG - Intronic
1181283434 22:21735880-21735902 GGGGCGGAACGGAGGCAGGATGG - Intergenic
1181592660 22:23894674-23894696 GGGGCGGGGCGGGGGGAGGACGG + Exonic
1181630260 22:24147372-24147394 AGGGAGGAACGGAGGGAGGGAGG - Intronic
1181695289 22:24589875-24589897 GGGGTCGACCGGGTTGAGGAAGG + Exonic
1182045882 22:27273907-27273929 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182351916 22:29704278-29704300 GGGGTGGTCAGGAGGTGGGAGGG - Intergenic
1182408337 22:30158545-30158567 GGAGGGGAGGGGAGGGAGGAAGG - Intronic
1182445540 22:30387364-30387386 GGGGGGGATCGGAGGGAGCGAGG + Exonic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183334161 22:37237202-37237224 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1183509611 22:38227179-38227201 GTGGAGGAAGGGAGGGAGGAAGG + Intronic
1183593254 22:38794008-38794030 GGGCCGGCCCGGAGGGAGGGCGG - Intronic
1183629538 22:39024992-39025014 GGGGTGGGGCAGGGGGAGGAGGG - Intronic
1183638753 22:39080855-39080877 GGGGTGGGGCAGGGGGAGGAGGG - Intronic
1183959351 22:41402022-41402044 GGGGTGGAGGGGAAGGAGAAGGG - Intergenic
1184101038 22:42341903-42341925 TGGGAGGACCACAGGGAGGAGGG + Intronic
1184463815 22:44657447-44657469 GGAGGGGAGGGGAGGGAGGAAGG + Intergenic
1184765193 22:46568585-46568607 GGGGTGGTGAGGAGGGAGCATGG - Intergenic
1184769166 22:46587873-46587895 GGGGTGGGGCCGCGGGAGGATGG + Intronic
1184780740 22:46648107-46648129 TGGGTGGACGGGTGGGTGGATGG + Intronic
1184843484 22:47066404-47066426 GGGGAGGTCGGGAGGGAGGGAGG + Intronic
1184852312 22:47127986-47128008 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852326 22:47128014-47128036 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852365 22:47128108-47128130 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852378 22:47128135-47128157 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852391 22:47128162-47128184 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852404 22:47128189-47128211 TGGGTGGGGCGGAGGGAGGATGG - Intronic
1185036942 22:48484458-48484480 GGAGGGGAGGGGAGGGAGGAAGG - Intergenic
1185114788 22:48926585-48926607 GGAGGGGAGGGGAGGGAGGAAGG - Intergenic
1185277792 22:49957199-49957221 GGGATGGGCCGGCGGGAGGCAGG + Intergenic
1185329370 22:50245333-50245355 GGGGTGGAGCGGGGGAAGCACGG + Exonic
1185379894 22:50503521-50503543 GGGGAGGACCGGAGAGAACAGGG + Exonic
1185380215 22:50504502-50504524 GGGGTGGAGCGGGGTGGGGAGGG - Intronic
1185398337 22:50603756-50603778 GGGGAGGAGGGCAGGGAGGATGG + Intronic
949262711 3:2121071-2121093 GGGAAGGAAGGGAGGGAGGAAGG - Intronic
949512048 3:4774922-4774944 GGGGTGGGCAGGAGAGAGGAAGG + Intronic
950327175 3:12121707-12121729 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
950454384 3:13083994-13084016 GGGGTGGACTGAGGGGAGGGCGG + Intergenic
950635533 3:14311746-14311768 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
950655127 3:14431793-14431815 GAGGTGGGGCGGAGGTAGGAAGG + Intronic
950901865 3:16505223-16505245 GGACTGGAAAGGAGGGAGGATGG - Intronic
952230532 3:31424917-31424939 AGGGAGGAAGGGAGGGAGGAGGG + Intergenic
952261740 3:31746824-31746846 GGGGTGGGGGGGAGGGAGGAGGG + Intronic
952358514 3:32606415-32606437 GGAGGGGAGGGGAGGGAGGAAGG + Intergenic
953122743 3:40061236-40061258 GGGGTCTACTGGAGGGTGGAGGG - Intronic
953439238 3:42904075-42904097 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
953900672 3:46840290-46840312 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
953905411 3:46866072-46866094 GGGGTGAACAGGAGGCAGGAAGG + Intronic
953909214 3:46883319-46883341 GGGAGGGACAGGAGGGAGGGAGG - Intronic
953913922 3:46906136-46906158 GGGGTGGTCAGCAGGGTGGAGGG + Intergenic
953935369 3:47037271-47037293 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
954146660 3:48637769-48637791 GGGGTGGAATAGGGGGAGGAAGG + Exonic
954332083 3:49896509-49896531 GTGCTGGCCAGGAGGGAGGAAGG - Intronic
954584615 3:51722418-51722440 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
954584620 3:51722430-51722452 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
954664700 3:52245709-52245731 GGGGTGCGCCGGCGGGAGGCGGG - Intergenic
954840791 3:53509595-53509617 GGGGCTGACCCGAGGGAGGGCGG + Intronic
955036240 3:55270621-55270643 GGGGTTGAGGGGAGGGAAGAGGG + Intergenic
955072449 3:55583467-55583489 GGGATGGAGGGGAGGGAGGAAGG - Intronic
955349297 3:58182181-58182203 GGGGAGGGGAGGAGGGAGGAGGG + Intergenic
955365587 3:58307151-58307173 GGGATTGAGCGGAGGGAGAATGG + Intronic
955479863 3:59378620-59378642 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
956159672 3:66335899-66335921 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
956745260 3:72306041-72306063 GGGCTGGAGGGGAGGGAGAATGG + Intergenic
956767544 3:72496622-72496644 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
956960380 3:74392383-74392405 AGGGTGGAAGGGAGGGAGGGAGG - Intronic
956976787 3:74589958-74589980 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
956979010 3:74614725-74614747 CGGGCGGACTGGAGGGAGGGAGG + Intergenic
957047353 3:75386238-75386260 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
957150312 3:76478168-76478190 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
957182231 3:76893815-76893837 AGGGTGGGTCGGTGGGAGGAGGG - Intronic
957293826 3:78310911-78310933 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
957367297 3:79242973-79242995 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
957858552 3:85912441-85912463 CGAGTGGACCGGAGTGATGATGG + Exonic
957880538 3:86206307-86206329 GGGGTGGGGGGAAGGGAGGAGGG + Intergenic
958070161 3:88599656-88599678 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
958186384 3:90125268-90125290 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
958635584 3:96739954-96739976 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
959119659 3:102217576-102217598 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
959185253 3:103038647-103038669 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
959416237 3:106078986-106079008 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
959621571 3:108403730-108403752 GGGGTGGACTGGAGGCAGGGGGG - Intronic
959863361 3:111240412-111240434 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
960071277 3:113433985-113434007 GGGATGGACCAAAGGTAGGATGG - Intronic
960312401 3:116132420-116132442 GGGGTGGAGCAGTGGGAGGAAGG - Intronic
960452388 3:117826470-117826492 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
960574732 3:119218493-119218515 GGGGTGGAGGGAAGGTAGGATGG - Intronic
960959543 3:123060301-123060323 GGGGAGGAAGGGAGGAAGGAAGG - Intergenic
961034934 3:123635539-123635561 AGGGTTGTCAGGAGGGAGGAGGG - Intronic
961171552 3:124801128-124801150 GGAGTGGACGGGAGCGGGGAGGG + Intronic
961182486 3:124887387-124887409 CTGGCGGGCCGGAGGGAGGAAGG - Intronic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961340124 3:126212285-126212307 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
961340144 3:126212348-126212370 AGGGTGGAAGGGAAGGAGGAAGG + Intergenic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961735713 3:129001243-129001265 CGGGCGGGGCGGAGGGAGGAGGG + Intronic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
961868483 3:129971751-129971773 AGGGAGGAAGGGAGGGAGGAGGG + Intergenic
961879424 3:130050352-130050374 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
962416862 3:135191096-135191118 GGAGTGGAAGGGAGGAAGGAAGG + Intronic
962437794 3:135382672-135382694 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
962711679 3:138091634-138091656 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
963108456 3:141665771-141665793 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
963108543 3:141666037-141666059 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
963247273 3:143074854-143074876 GGCTTGGAGCAGAGGGAGGATGG + Intergenic
963316564 3:143765165-143765187 AGGGTGGGCCTGAGGGAGGGAGG - Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963894720 3:150673145-150673167 CGGATGGAAGGGAGGGAGGAAGG - Intronic
963913015 3:150830986-150831008 CGGATGGGACGGAGGGAGGAAGG - Intergenic
964144849 3:153447302-153447324 GGGGTGGGGGGGAGGAAGGAGGG + Intergenic
964369622 3:155986286-155986308 AGGGAGGAAGGGAGGGAGGATGG - Intergenic
964645816 3:158957433-158957455 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
964730671 3:159861204-159861226 GGGCTGGGCCAGAGGCAGGAAGG + Intronic
965120160 3:164543914-164543936 GGAGTGGAGGGGAGGGGGGAGGG - Intergenic
965171129 3:165265703-165265725 GGGGAGGACGGGAGGGGTGAAGG - Intergenic
965182383 3:165420785-165420807 GGGGCCTACCGGAGGGTGGAGGG + Intergenic
965563231 3:170081727-170081749 GGGGTCTACTTGAGGGAGGAGGG - Intronic
965632705 3:170749652-170749674 GGGGTGGAAAGAAGGGAAGATGG - Intronic
965668315 3:171119798-171119820 GGGGTTGGGGGGAGGGAGGAGGG + Intronic
966228619 3:177625969-177625991 GGGGCCTACCGGAGGGTGGAGGG - Intergenic
966398842 3:179527149-179527171 GGGGTGGAGGGGAAGGGGGAGGG + Intergenic
966932992 3:184687669-184687691 GGGGAGGAGGGGAGGGAGGAAGG + Intergenic
966985716 3:185178567-185178589 GGGGAGGACTGGAAGGGGGATGG + Intergenic
967258547 3:187619006-187619028 GGGGAGGAAGGGAGGGAGGCAGG - Intergenic
967294049 3:187948415-187948437 GGGGTGGACCTGAGGGATAGAGG - Intergenic
967531723 3:190555290-190555312 GGAGTAGAGAGGAGGGAGGAAGG - Intronic
967978556 3:195049783-195049805 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
968287426 3:197517229-197517251 GGGGTCGGCCTGAGGGGGGATGG - Intronic
968287485 3:197517441-197517463 GGGGTCGGCCTGAGGGGGGATGG - Intronic
968287528 3:197517597-197517619 GGGGTCGGCCTGAGGGGGGATGG - Intronic
968287559 3:197517702-197517724 GGGGTTGGCCTGAGGGGGGATGG - Intronic
968287734 3:197518349-197518371 GGGGTCGGCCTGAGGGGGGATGG - Intronic
968287811 3:197518618-197518640 GGGGTCGGCCTGAGGGGGGATGG - Intronic
968287844 3:197518724-197518746 GGGGTCGGCCTGAGGGGGGATGG - Intronic
968287917 3:197518979-197519001 GGGGTCGGCCTGAGGGGGGATGG - Intronic
968373379 4:15952-15974 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
968517891 4:1022525-1022547 GGGGTGTGCAGGAGGGCGGACGG + Intronic
968653018 4:1767447-1767469 GGGGCAGAGCGGAGGGGGGAAGG - Intergenic
968768070 4:2485041-2485063 GGGGTGGGCGGAAGGGAGCAGGG - Intronic
968887404 4:3341802-3341824 GGTGTGGACAGAAGGGAGGGTGG + Intronic
968889226 4:3359043-3359065 GGGGAGGGGAGGAGGGAGGAGGG - Intronic
968889263 4:3359130-3359152 GGAGGGGAGGGGAGGGAGGAGGG - Intronic
968909043 4:3467283-3467305 GGGGAGGGCGGGAGGGAAGAAGG - Intronic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
968985286 4:3871565-3871587 GGTGTGGCCAGGAGGGAGGTGGG - Intergenic
968991662 4:3917385-3917407 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
969143859 4:5102898-5102920 GGAGGGGAGGGGAGGGAGGAAGG - Intronic
969235906 4:5864950-5864972 GGGGTGGGCTGGGGGGAGGCAGG + Intronic
969286000 4:6202140-6202162 GACGTGGACAGGAGGGAGGGAGG + Intergenic
969436560 4:7192505-7192527 GGGAGGGAGCGGCGGGAGGAGGG - Intergenic
969456722 4:7304473-7304495 TGGATGGACGGGAGGCAGGAGGG - Intronic
969481493 4:7449088-7449110 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
969481498 4:7449100-7449122 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
969481565 4:7449270-7449292 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
969481570 4:7449282-7449304 GGGGAGGAAGGGAGGGAGGAAGG - Intronic
969623136 4:8288925-8288947 GGGGAGGAAGGGAGGAAGGAAGG - Intronic
969625628 4:8303936-8303958 TGGGTAGACAGGTGGGAGGAGGG - Intronic
970365033 4:15350020-15350042 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
970602292 4:17650092-17650114 TGGATGGACAGGAGGAAGGATGG - Intronic
971034153 4:22675090-22675112 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
972106790 4:35497566-35497588 AGGGTGGAAGGGTGGGAGGAGGG + Intergenic
972124979 4:35753302-35753324 GGGGTGGAGAGAAGTGAGGATGG - Intergenic
972142073 4:35973273-35973295 GGAGGGGAAGGGAGGGAGGAAGG + Intronic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972790256 4:42364964-42364986 GGAGGGGAGGGGAGGGAGGAAGG - Intergenic
972796946 4:42430631-42430653 GGGGCCCACCGGAGGGTGGAAGG - Intronic
973157690 4:46977287-46977309 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
973157695 4:46977299-46977321 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
973157700 4:46977311-46977333 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
973277657 4:48327015-48327037 GGGGTGGAGAGGAGAGAGGGTGG - Intergenic
973743603 4:53942052-53942074 GGGGTCTACTGGAGGGTGGAGGG + Intronic
973765398 4:54157236-54157258 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
973953773 4:56042582-56042604 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
974200489 4:58632308-58632330 GGGGGAGACAGGAGGTAGGATGG + Intergenic
974333583 4:60510496-60510518 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
974333598 4:60510539-60510561 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
974762848 4:66300718-66300740 GGAGGGGAGGGGAGGGAGGAGGG - Intergenic
974859552 4:67502997-67503019 GGGGTTGAAGGGATGGAGGAAGG - Intronic
974986790 4:69037325-69037347 GGGGTGTATTGGAGGGTGGAGGG - Intronic
975065460 4:70057374-70057396 GGGATGGAGGGGAGGGAGTAAGG + Intronic
975094495 4:70442431-70442453 GGGGTGGTGGGGAGGGAGGGAGG - Intronic
975430203 4:74280998-74281020 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
975515309 4:75240838-75240860 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
975767791 4:77687192-77687214 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
975933360 4:79553844-79553866 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
976033409 4:80786268-80786290 GGGGTGGAGAGGAGGTAGAAGGG + Intronic
976366031 4:84233252-84233274 GGGGTGGGGTGGAGGGAGTAGGG - Intergenic
976433823 4:84994033-84994055 GGGGAGGAAGGGAGGGAGGGTGG + Intergenic
976486153 4:85607369-85607391 AGGGAGGAACGGAGGGAGGAAGG + Intronic
976675250 4:87695439-87695461 GGGATGGAAGGGAGGGAGGGAGG + Intergenic
976925395 4:90489661-90489683 GGGGTTGGGTGGAGGGAGGATGG - Intronic
977151737 4:93520992-93521014 GGGGTGGACCAGAGTGATTATGG + Intronic
977278669 4:95011241-95011263 GGGGTCTACCTGAGGGTGGAGGG - Intronic
977290558 4:95160590-95160612 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
977593324 4:98850858-98850880 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
977593365 4:98851009-98851031 GGAGAGGAGGGGAGGGAGGAAGG + Intergenic
977654619 4:99506388-99506410 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
977654624 4:99506400-99506422 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
977738475 4:100446743-100446765 GGGGTCTACCTGAGGGTGGAGGG - Intronic
977807885 4:101324139-101324161 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
977908955 4:102509962-102509984 GGGGAACACCGGAGGGAGTAAGG - Intronic
978620481 4:110631560-110631582 GGGGTGTAAGGGATGGAGGAGGG - Intronic
979842432 4:125460437-125460459 GGGGTCTACTGGAGGGTGGAGGG - Intronic
979938059 4:126722381-126722403 GGGGGGGGCGGGAGGGTGGAGGG + Intergenic
980038684 4:127914275-127914297 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
980129971 4:128809596-128809618 GGTGGGGACGGGAGGGCGGAGGG - Intergenic
980133682 4:128840560-128840582 GCTGTGGACCGGCTGGAGGATGG + Intronic
980616192 4:135228994-135229016 GGGGAAGAAGGGAGGGAGGAAGG - Intergenic
980908031 4:138968078-138968100 GGGGACTACTGGAGGGAGGAGGG + Intergenic
980981146 4:139655516-139655538 AGGGTGGACTGGAAGGAGAAAGG - Intergenic
981025324 4:140071967-140071989 GTGGTGGACGTGGGGGAGGAAGG + Intronic
981027145 4:140088213-140088235 AGGGAGGAAGGGAGGGAGGACGG + Intronic
981081798 4:140644301-140644323 GGGGTGGACAGCAGGGAGTGGGG + Intronic
981413343 4:144458767-144458789 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
981912275 4:149995460-149995482 AGGGAGGAAGGGAGGGAGGATGG + Intergenic
982997955 4:162375037-162375059 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
983500945 4:168499253-168499275 AGGGAGGAAGGGAGGGAGGATGG + Intronic
983500950 4:168499265-168499287 AGGGAGGATGGGAGGGAGGATGG + Intronic
983500955 4:168499277-168499299 AGGGAGGATGGGAGGGAGGATGG + Intronic
983500960 4:168499289-168499311 AGGGAGGATGGGAGGGAGGAAGG + Intronic
983877328 4:172892840-172892862 GGGCTGCCCCTGAGGGAGGAGGG - Intronic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984822052 4:183890547-183890569 AGGGAGGAATGGAGGGAGGAAGG + Intronic
984831251 4:183976556-183976578 GGGGAGGGAGGGAGGGAGGAGGG + Intronic
984831951 4:183984041-183984063 GGTGTGGATGGGAGGGAGGTGGG - Intronic
984911040 4:184674416-184674438 GGTCCGGACCGGAAGGAGGATGG - Intronic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985677029 5:1237503-1237525 AGAGTGGACAGGAGGGAGGCCGG + Intronic
985779081 5:1860471-1860493 GGAGTGGATCTGAGGAAGGATGG - Intergenic
985851584 5:2392462-2392484 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
985894913 5:2743213-2743235 GGCGGGGAGCGGAGAGAGGAAGG - Intergenic
985905443 5:2831511-2831533 GCGGTGGGTGGGAGGGAGGAGGG + Intergenic
985958018 5:3278914-3278936 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
986078467 5:4363280-4363302 GGGGAGGGAGGGAGGGAGGAGGG - Intergenic
986187338 5:5457082-5457104 GAGATGGACCGGTGGGTGGATGG - Intronic
986322261 5:6641538-6641560 GTGGTGGACAGGGGAGAGGAGGG - Intronic
986323219 5:6650783-6650805 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
986889377 5:12282927-12282949 GGAGTAGAGAGGAGGGAGGAAGG - Intergenic
987013336 5:13790907-13790929 GGGGTCTACCTGAGGGTGGAAGG + Intronic
987696994 5:21344759-21344781 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
987750286 5:22030114-22030136 GGGGTGGGGGGGAGGGGGGAAGG + Intronic
988081989 5:26426467-26426489 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
988086569 5:26481901-26481923 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
988706436 5:33730388-33730410 GGGGAAGACTGGAGGCAGGAGGG + Intronic
988755240 5:34241922-34241944 AGGATGGACGGAAGGGAGGAAGG + Intergenic
988801198 5:34698154-34698176 AGGGAGGAGGGGAGGGAGGAAGG - Intronic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
989254197 5:39349022-39349044 GGGGTGGGGGGGAGGGGGGAAGG + Intronic
989697719 5:44223161-44223183 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
989710334 5:44389475-44389497 GGGGTGGAGAAGAGGGGGGAGGG + Intronic
990485638 5:56257284-56257306 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
990927081 5:61038063-61038085 GGGGTGGGAGGGAGGGAGGCGGG + Intronic
991092876 5:62710017-62710039 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
991424463 5:66476464-66476486 GGGGCGGACCAGAGGGAGACAGG - Intergenic
991635182 5:68697501-68697523 GGGGTGGGGGGCAGGGAGGAGGG + Intergenic
991646740 5:68808166-68808188 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
991646758 5:68808212-68808234 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
991646763 5:68808224-68808246 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
991646768 5:68808236-68808258 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
991754243 5:69847597-69847619 AGGATGGAAGGGAGGGAGGAAGG - Intergenic
991822840 5:70582917-70582939 AGGATGGAAGGGAGGGAGGAAGG + Intergenic
991887403 5:71286881-71286903 AGGATGGAAGGGAGGGAGGAAGG + Intergenic
992896909 5:81253531-81253553 AGGGTGGACCTGAAGGAGGAGGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993653997 5:90556097-90556119 GGGATGGAAGGAAGGGAGGAAGG - Intronic
993808689 5:92445362-92445384 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
993894852 5:93522193-93522215 GGGGTCTACCTGAGGGTGGAGGG + Intergenic
994467417 5:100155618-100155640 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
994526225 5:100908419-100908441 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
994730991 5:103490498-103490520 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
994793684 5:104265666-104265688 GGGGTGGGTGGGAGGGAAGATGG - Intergenic
996415624 5:123207204-123207226 GGGGTGGGGAGGAAGGAGGAAGG - Intergenic
996506293 5:124271103-124271125 GGAGAGGAAGGGAGGGAGGAAGG + Intergenic
996924803 5:128811883-128811905 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
997257151 5:132437836-132437858 GGGGTGGGGCAGAGGGAGGGAGG + Intronic
997433735 5:133858866-133858888 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
998019467 5:138757211-138757233 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
998102556 5:139446378-139446400 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
998247511 5:140520780-140520802 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
998381429 5:141728857-141728879 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
998461552 5:142313827-142313849 GGGGGGGGGCGGAGGGAGGGAGG + Exonic
999113468 5:149141713-149141735 GGTGTGGACCACAGGGAGGCAGG - Exonic
999268808 5:150284491-150284513 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
999548113 5:152654100-152654122 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
999758529 5:154682887-154682909 CGGGTGGAATGGAGGGAGGAGGG - Intergenic
999769115 5:154761660-154761682 GGAGTGGCCAGGAGAGAGGATGG + Intronic
1000001439 5:157142610-157142632 GGGGTGGACAGCCTGGAGGAGGG - Intronic
1000132080 5:158309948-158309970 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1000132123 5:158310062-158310084 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1000132145 5:158310109-158310131 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1000997523 5:167974101-167974123 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997575 5:167974255-167974277 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997591 5:167974308-167974330 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1001003777 5:168031698-168031720 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1001312122 5:170618529-170618551 AGGGAGGAAAGGAGGGAGGAGGG + Intronic
1001314716 5:170633748-170633770 GGGGCGGGGCGGAGGGGGGATGG + Intronic
1001602844 5:172940109-172940131 TGGGTGGGCTGGAGGGAGGGAGG + Intronic
1001825686 5:174743309-174743331 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1001825700 5:174743341-174743363 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1001949420 5:175805910-175805932 GGTGTGGAGCTGAGGGAGAATGG - Intronic
1002061944 5:176630355-176630377 GGGGTGGACCAGGGGCCGGAGGG + Exonic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002617370 5:180464215-180464237 GGGGTGGGCCGGAGACAGGAGGG - Intergenic
1002678659 5:180941079-180941101 GAGGTGGAAGGGAGGGAGGGAGG + Intronic
1002963401 6:1938938-1938960 GGGGAGGAAAGAAGGGAGGAAGG - Intronic
1003319001 6:5035743-5035765 GGGGGGGAGGGGAGGGAGGGAGG - Intergenic
1003457189 6:6293736-6293758 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1003878826 6:10462131-10462153 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1003921610 6:10838315-10838337 GGGAAGGACTGGAGGGAGGAGGG - Intronic
1004031302 6:11871898-11871920 GGGAGGGACGGGAGGGAGGGAGG - Intergenic
1004131172 6:12921519-12921541 GGGGAGGGAGGGAGGGAGGAGGG + Intronic
1004748464 6:18536507-18536529 GGGGTGCAGCGGGGGGAGAATGG + Intergenic
1004748661 6:18538556-18538578 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1004752838 6:18581579-18581601 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1004999785 6:21229416-21229438 GGGGTGGACTGAAGGGAGGCAGG - Intronic
1005112069 6:22293597-22293619 GGGGAGGAAGGAAGGGAGGAGGG + Intronic
1005177644 6:23064817-23064839 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1005264751 6:24100376-24100398 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1005402647 6:25450751-25450773 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1005402652 6:25450763-25450785 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1005402662 6:25450784-25450806 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1005402667 6:25450796-25450818 GGAGGGGAGGGGAGGGAGGAAGG - Intronic
1005940758 6:30557533-30557555 GGGCTGTAACGGAAGGAGGAAGG + Intronic
1005996293 6:30933448-30933470 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006151763 6:31993681-31993703 ACGGTGGACGGGAGTGAGGAGGG - Intronic
1006158064 6:32026419-32026441 ACGGTGGACGGGAGTGAGGAGGG - Intronic
1006273709 6:32984116-32984138 GGGGTGGATGGGTGGGAGCAGGG + Intergenic
1006744149 6:36329927-36329949 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1007263658 6:40581535-40581557 GGGGAAGAAGGGAGGGAGGATGG - Intronic
1007375930 6:41456751-41456773 GGGGAGGAAAGAAGGGAGGAAGG - Intergenic
1007483781 6:42166879-42166901 GGGGCCGAGGGGAGGGAGGATGG - Intronic
1007623925 6:43231842-43231864 AGGAAGGACGGGAGGGAGGAAGG - Intergenic
1008067133 6:47061783-47061805 GGGGTGGAGCTGAGGCAGGAAGG - Intergenic
1008160472 6:48069156-48069178 GGGGGGGAGAGGAGGGAGAAGGG + Intergenic
1008191123 6:48459404-48459426 GGGGTCTACTGGAGGGTGGAGGG - Intergenic
1008503231 6:52204414-52204436 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1008611675 6:53190116-53190138 GGGGTGTACTTGAGGGTGGAAGG - Intergenic
1008713179 6:54254768-54254790 GGGGGGGAAGGGAGGGAGGAAGG - Intronic
1009465483 6:63963123-63963145 GGGGGAGGCGGGAGGGAGGAAGG + Intronic
1009522799 6:64705828-64705850 GGGGTGGGAGGGAGGGGGGAGGG + Intronic
1009593757 6:65708826-65708848 GGAGTGGAGGGGAGGGAGGAGGG - Intergenic
1009704983 6:67238705-67238727 GGGGAAGAAGGGAGGGAGGAAGG + Intergenic
1009804024 6:68578838-68578860 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1009869768 6:69439681-69439703 GGGGTGGGTGGGAGGGGGGAGGG - Intergenic
1010298657 6:74232087-74232109 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011325975 6:86150429-86150451 GGGGTGGACCTGGAGGAGAAGGG + Intergenic
1011447965 6:87463023-87463045 GAGGTGGACTGGGGGTAGGATGG + Intronic
1012508832 6:99979033-99979055 GAGGTGGGGCGGAGGGAGGTGGG + Intronic
1012689822 6:102296799-102296821 GGGGTGGTATGGAGGGAGAATGG - Intergenic
1012807896 6:103918030-103918052 GGGGTGGGGGGGAGGGGGGATGG + Intergenic
1012872796 6:104692008-104692030 GGAGTGGAAGGAAGGGAGGAAGG + Intergenic
1012872842 6:104692139-104692161 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1013196415 6:107848483-107848505 CGCCTGGACCGGAAGGAGGAAGG + Intergenic
1013734109 6:113205839-113205861 GGAGAGGAGAGGAGGGAGGAAGG - Intergenic
1014029622 6:116685438-116685460 GGGGCCTACCGGAGGGTGGAGGG - Intronic
1014243056 6:119039610-119039632 GGGGTTGAGGAGAGGGAGGAAGG + Intronic
1014248626 6:119093981-119094003 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1014454458 6:121620944-121620966 GGGGTGGTACGGAGAGAGAATGG + Intergenic
1014510857 6:122320408-122320430 GGGGTGTATCAGAGGGTGGAGGG - Intergenic
1014556264 6:122845021-122845043 GGGGTGGTACGGAGAGAGAATGG - Intergenic
1014777614 6:125528843-125528865 GGGAAGGAGGGGAGGGAGGAGGG - Intergenic
1014884838 6:126767116-126767138 GGGGAGGAAGGGAAGGAGGAAGG - Intergenic
1014973443 6:127848059-127848081 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
1015771167 6:136769808-136769830 GGAGGGGACGGGAGGGAGGGAGG + Intronic
1016320684 6:142842156-142842178 TGGGTGGAAGGGAAGGAGGAGGG - Intronic
1016480090 6:144471213-144471235 AGGGTGGGAAGGAGGGAGGAGGG + Intronic
1016681720 6:146837853-146837875 AGGGAGGGCGGGAGGGAGGAAGG + Intergenic
1017163989 6:151391022-151391044 GCGGCGGATCGGAGGGAGGGTGG - Intronic
1017399081 6:154039235-154039257 AGGCTGGAAGGGAGGGAGGAGGG - Exonic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1017637336 6:156456149-156456171 GGGGAGGAGGGGAGGGAGGGGGG - Intergenic
1017673411 6:156789589-156789611 GGGGTGGAGTTGAGGCAGGAAGG + Intronic
1017720622 6:157240913-157240935 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
1017786601 6:157762023-157762045 GGGGCGCACCGCAGGGAGCACGG + Intronic
1017816694 6:158021538-158021560 TGGGAGGGCTGGAGGGAGGAGGG + Intronic
1017931904 6:158963387-158963409 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1017956038 6:159178561-159178583 GGGGTGGATGGGAGGAAGGAAGG - Intronic
1017960369 6:159216320-159216342 GGGCTGGACAAAAGGGAGGATGG - Intronic
1018302979 6:162423375-162423397 AAGGTGGAAGGGAGGGAGGAAGG - Intronic
1018804019 6:167244776-167244798 AGGGTGGAAGGGAGGGAGGAAGG + Intergenic
1018855021 6:167669027-167669049 GGGGTGGGCCGGGGGCAGGGAGG - Intergenic
1019112108 6:169724539-169724561 GGGGCGGGCCGGAGGGCGGGCGG - Intronic
1019313494 7:374121-374143 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1019320757 7:414326-414348 AGGATGGAGAGGAGGGAGGAGGG - Intergenic
1019335707 7:481593-481615 GGGCGGGAAGGGAGGGAGGAGGG - Intergenic
1019473326 7:1232656-1232678 GGGGGGAGCCGGAGGGAGGGAGG - Intergenic
1019495809 7:1340148-1340170 GGGCTGGACAGGAGAGAGGATGG - Intergenic
1019504274 7:1383010-1383032 GGGGTGCACGGGAAGAAGGAAGG - Intergenic
1019508352 7:1404798-1404820 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508367 7:1404832-1404854 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508382 7:1404866-1404888 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508397 7:1404900-1404922 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019549484 7:1594919-1594941 TGGATGGACGGGAGGGTGGATGG - Intergenic
1019549521 7:1595051-1595073 GGGATGGACAGGAGGATGGATGG - Intergenic
1019697284 7:2452662-2452684 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1019700353 7:2471784-2471806 GGTGGGGCCCGGAGAGAGGAGGG - Intergenic
1019751899 7:2735884-2735906 GGGCTGGAGGGGAGGGAAGAAGG + Intronic
1019781413 7:2942377-2942399 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1020092956 7:5351505-5351527 GGGGAGGAGGGCAGGGAGGAGGG + Intronic
1020116379 7:5478631-5478653 GGGGTTGGAGGGAGGGAGGAGGG - Intronic
1021759753 7:23892171-23892193 GGAGGGGAGAGGAGGGAGGAAGG + Intergenic
1022092076 7:27114130-27114152 GGGAGGGACCGGAGGGAGAAGGG + Intronic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022629498 7:32071478-32071500 GGGGTGAAAGGGAGGGAGGGAGG - Intronic
1022675431 7:32495324-32495346 GGGGAGGAGCGGGGGGAGGGCGG - Intergenic
1022720103 7:32935003-32935025 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1023011196 7:35926046-35926068 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
1023088939 7:36600204-36600226 AGGGAGGAGAGGAGGGAGGAAGG - Intronic
1023142354 7:37114015-37114037 TGGGTGGAGTTGAGGGAGGAAGG + Intronic
1023533419 7:41183086-41183108 GGAGGGGAGGGGAGGGAGGAAGG - Intergenic
1023545844 7:41317177-41317199 GGGGTTGACCTGGGGTAGGATGG - Intergenic
1023863845 7:44229575-44229597 GGGGAGGCCAGGAGGGAGGGAGG + Intronic
1023873425 7:44274718-44274740 CGGGTGGCCTGGAGGGAGCAAGG + Intronic
1023993480 7:45144760-45144782 GGGGTGGGGTGGAGGGAGTAGGG + Intergenic
1024079932 7:45847804-45847826 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1025117028 7:56267112-56267134 GGGGAGGAAGGGAGGAAGGAAGG - Intergenic
1025117164 7:56268298-56268320 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1025117203 7:56268455-56268477 GGGGAGGAGGGGAGGAAGGAAGG - Intergenic
1025124839 7:56336142-56336164 GGGGTGGGAGGGAGGGAGGAAGG + Intergenic
1025886271 7:65597039-65597061 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1025970247 7:66316909-66316931 GGGGTGTACTGGAGGGTGGAGGG + Intronic
1026062255 7:67036918-67036940 GGCAGGGACTGGAGGGAGGAGGG + Intronic
1026133175 7:67636922-67636944 AGGGAGGAACGGAGGGAGGGAGG - Intergenic
1026471265 7:70695204-70695226 GGGGAGGAAAGAAGGGAGGAGGG - Intronic
1026484770 7:70808412-70808434 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1026492116 7:70872123-70872145 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1026492133 7:70872163-70872185 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1026506684 7:70990601-70990623 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1026638825 7:72106727-72106749 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1026670573 7:72387239-72387261 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1026677188 7:72437823-72437845 AGGATGGAAGGGAGGGAGGAAGG - Intronic
1026678667 7:72449015-72449037 GGGGTGTCCAGGAGGGAGGTGGG + Intergenic
1026917765 7:74132492-74132514 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1026917770 7:74132504-74132526 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1027138204 7:75639224-75639246 AGGCTGGACCGGAGAAAGGAAGG + Intronic
1027141692 7:75662073-75662095 AAGGTGGAGGGGAGGGAGGAGGG + Intronic
1027967945 7:85038047-85038069 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1028721380 7:94036123-94036145 GGTGGGGCCCGGAGGGGGGAGGG + Intergenic
1029045986 7:97629232-97629254 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1029121421 7:98270676-98270698 GGGCTGGGCCAGAGAGAGGATGG + Intronic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1029144962 7:98439294-98439316 GGGGAGGAGAGGAGGAAGGAAGG - Intergenic
1029147803 7:98458959-98458981 GGGGGGTTCCGGAGGCAGGAGGG + Intergenic
1029269709 7:99369820-99369842 GGGGTGGACCAGTGGGACAAAGG + Intronic
1029421137 7:100472410-100472432 GGGGTGGGATGGAGGGAGGCAGG + Intronic
1029496478 7:100897555-100897577 GGAGGGGACAGGAGGGTGGATGG + Intergenic
1029607803 7:101609599-101609621 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1029607808 7:101609611-101609633 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1029628873 7:101737821-101737843 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
1029909366 7:104128665-104128687 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
1030098339 7:105921437-105921459 TGGGTTGAGGGGAGGGAGGAGGG + Intronic
1030374537 7:108739773-108739795 GGGGTCCACCAGAGGGTGGAGGG - Intergenic
1030590159 7:111470725-111470747 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1030884619 7:114922471-114922493 GGGCTGAGCCGGAGGGAGGCGGG + Exonic
1030952799 7:115813031-115813053 GGGGAGGGGTGGAGGGAGGAGGG - Intergenic
1031049929 7:116934777-116934799 AGGGAGGACAGGAGGAAGGAAGG - Intergenic
1031187367 7:118500087-118500109 GGTGTGGACAGGAGGGAGGTGGG - Intergenic
1031540621 7:122990866-122990888 GGAGGGGAGAGGAGGGAGGAAGG - Intergenic
1031769105 7:125820506-125820528 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1031819614 7:126483760-126483782 GGGGAGGAAGGGAGGGAGGGAGG - Intronic
1031929867 7:127674125-127674147 GGGCAGGAAGGGAGGGAGGAAGG - Intronic
1032091850 7:128915235-128915257 GGGGCGGAGGGGAGGGGGGAGGG - Intergenic
1032121965 7:129162937-129162959 GGTGTGACCCAGAGGGAGGAAGG + Intronic
1032281477 7:130506308-130506330 GGGGTGGGGGGGAGGGGGGAGGG - Exonic
1032402908 7:131636323-131636345 GAGGTGGTCCGGAGATAGGAGGG + Intergenic
1032685661 7:134231535-134231557 AGGGAGGGACGGAGGGAGGAAGG - Intronic
1032869586 7:135969084-135969106 GGGGTGGGGGGGGGGGAGGAGGG + Intronic
1032996124 7:137448580-137448602 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1032996138 7:137448616-137448638 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1032996152 7:137448652-137448674 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1032996166 7:137448688-137448710 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1033096249 7:138433880-138433902 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1033150854 7:138913926-138913948 GAGGGAGACAGGAGGGAGGAGGG + Intronic
1033165606 7:139036132-139036154 GGGGTGGGCCTGCGGGAGGCCGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033786478 7:144737270-144737292 GGGGGAGAAGGGAGGGAGGAAGG + Intronic
1033870800 7:145751587-145751609 GGGGTGGACCTGGAGGAGCAGGG + Intergenic
1034030903 7:147762726-147762748 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1034065882 7:148136095-148136117 TGGAGGGAACGGAGGGAGGAAGG + Intronic
1034376100 7:150645881-150645903 GGAGGGGAGGGGAGGGAGGAGGG - Intergenic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1034469989 7:151249831-151249853 AGGAGGGACCGGAAGGAGGAGGG + Intronic
1034492515 7:151401400-151401422 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1034875194 7:154719386-154719408 GGGGTGGAAGGAAGGGAGGATGG + Intronic
1034889753 7:154829451-154829473 GGTGGGGAGGGGAGGGAGGAGGG + Intronic
1035264695 7:157684604-157684626 TGTGTGGGCCGGAGGGAGGGGGG - Intronic
1035271519 7:157722677-157722699 GGGGGGGACAGGGGTGAGGAGGG + Intronic
1035700140 8:1632099-1632121 AGGATGGAAGGGAGGGAGGATGG + Intronic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036190693 8:6667640-6667662 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1036192224 8:6680725-6680747 GGGAGGGACGGGAGGGAGGGAGG - Intergenic
1036744827 8:11399196-11399218 GGGGTGGACAGAAGGATGGAGGG + Intronic
1036791642 8:11725152-11725174 GGGGTAGAGATGAGGGAGGAGGG + Intronic
1036822463 8:11951803-11951825 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1036982927 8:13491299-13491321 GGGGTGGAGTGGAGAGAAGATGG - Intronic
1037062546 8:14532714-14532736 GGGGAGGGCGGGGGGGAGGAGGG + Intronic
1037097972 8:15008575-15008597 GAGGGGGAGGGGAGGGAGGAAGG + Intronic
1037098061 8:15008806-15008828 AGGGAGGGACGGAGGGAGGAAGG + Intronic
1037216347 8:16456730-16456752 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1037216352 8:16456742-16456764 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1037676969 8:21059348-21059370 AGGGTGGACAGAAAGGAGGAAGG + Intergenic
1037760328 8:21737703-21737725 GGCGGGGACCAGAGGGAGGGAGG - Intronic
1037821768 8:22138606-22138628 GAGGACGACAGGAGGGAGGAGGG - Intronic
1037867413 8:22457032-22457054 GGGAAGGAAGGGAGGGAGGAAGG - Intronic
1037908597 8:22729779-22729801 GGGGAGGACCTGGTGGAGGAGGG + Intronic
1038016940 8:23523415-23523437 GGGGTTGCAGGGAGGGAGGAAGG + Intergenic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038141400 8:24849305-24849327 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1038156975 8:25000406-25000428 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1038339530 8:26673896-26673918 GAGGAGGAGGGGAGGGAGGAAGG - Intergenic
1038663417 8:29516843-29516865 GGGATGGATAGGAGGAAGGAAGG + Intergenic
1038691096 8:29764337-29764359 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1039269230 8:35862659-35862681 GGGGTGGAGCGGAGGTGAGAGGG + Intergenic
1039476471 8:37841678-37841700 GGGGAGGACTTGAGGGAGGGGGG - Exonic
1039487896 8:37926340-37926362 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1039560691 8:38510340-38510362 AGGGTGGAAAGGAGGGAGGGGGG + Intergenic
1039607192 8:38891139-38891161 GGGGTGGCCTGGTGGGGGGATGG - Intergenic
1039724209 8:40197864-40197886 GGAGTGGAGGGGAGGGAGGCTGG - Intergenic
1039821082 8:41136121-41136143 GGGGTGGGCAGGGAGGAGGAAGG + Intergenic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1040369904 8:46759292-46759314 GGGATTGAAAGGAGGGAGGAAGG - Intergenic
1040961515 8:53038569-53038591 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1041126884 8:54650676-54650698 GGGGAGGGGAGGAGGGAGGAGGG - Intergenic
1041230738 8:55748556-55748578 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1041381641 8:57259029-57259051 AGAGTGGACCCTAGGGAGGAGGG + Intergenic
1041444236 8:57932079-57932101 GGGGGGGCAGGGAGGGAGGAAGG + Intergenic
1041507845 8:58621087-58621109 GTGGAGGATGGGAGGGAGGAGGG - Intronic
1042049507 8:64688371-64688393 AGGGTGGGAGGGAGGGAGGAAGG - Intronic
1042528489 8:69791029-69791051 AGGGAGGAATGGAGGGAGGAGGG + Intronic
1042591281 8:70402130-70402152 CGTGCGGACCGGAGGAAGGAAGG - Intronic
1043094251 8:75946451-75946473 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1043433539 8:80216734-80216756 GGGGTCTACCTGAGGGTGGAGGG + Intronic
1043547811 8:81335081-81335103 AGGGAGGACAGGAGAGAGGAAGG + Intergenic
1044352870 8:91186813-91186835 GAGGTGGATGGGATGGAGGATGG + Intronic
1044429744 8:92095280-92095302 GGGGTGGCCAGGAGGAAGGGGGG - Intronic
1044698767 8:94948761-94948783 GGAGTGGAGGGGAGTGAGGAGGG + Intronic
1044994703 8:97828205-97828227 GGGGTGGTATGGAGGGATGATGG + Intronic
1045265186 8:100612936-100612958 GGGGTGGACAGGTGTGAGCAGGG - Intronic
1045330922 8:101155081-101155103 GGGGGAGAAGGGAGGGAGGATGG - Intergenic
1045367882 8:101493440-101493462 GGGGCGGACCCGGGGGAGGGAGG - Intronic
1045412034 8:101929408-101929430 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1045523207 8:102921408-102921430 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1046302848 8:112320630-112320652 GGGGTGGAGGGGAGGGGGGAGGG - Intronic
1046941810 8:119938836-119938858 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1047204097 8:122789553-122789575 GTGGTGGTCCGGAGGGAGTAGGG + Intronic
1047240787 8:123086190-123086212 GGTGTGGTAAGGAGGGAGGAGGG - Intronic
1047363975 8:124195472-124195494 GCTGTGGGCAGGAGGGAGGAGGG - Intergenic
1047511854 8:125521664-125521686 GGGAAGGACGGGAGGAAGGAGGG - Intergenic
1047712105 8:127562832-127562854 GGGGTGGGGTGGAGGGGGGAGGG - Intergenic
1047717591 8:127609992-127610014 AGGGTGGTCAGGAGGGAGAAGGG - Intergenic
1047942147 8:129836543-129836565 GGGATGGCAAGGAGGGAGGAGGG + Intergenic
1047953665 8:129956812-129956834 GGGGAGGGAGGGAGGGAGGAGGG - Intronic
1048318624 8:133380947-133380969 GGGCTAGAGCGGAGGGAGGGAGG + Intergenic
1048336085 8:133503512-133503534 GGGGCTGGACGGAGGGAGGAAGG - Intronic
1048690289 8:136955657-136955679 AGGGTGGGAGGGAGGGAGGAAGG - Intergenic
1048703706 8:137125349-137125371 GGGGTGGTGTGGAGGGAGGGAGG - Intergenic
1048837791 8:138537632-138537654 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1048857675 8:138698130-138698152 AGGGTGGACCTGAGGGAGGGAGG + Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1049141859 8:140962270-140962292 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049378536 8:142300946-142300968 AGGGTGGGCAGGAGGCAGGAAGG + Intronic
1049425694 8:142537011-142537033 GTGGTTGACCGGCAGGAGGAGGG + Exonic
1049453949 8:142677611-142677633 GGCGGGGGGCGGAGGGAGGATGG + Intronic
1049463090 8:142739153-142739175 GCGGTGGAGGGGAGGGAGAAGGG - Intergenic
1049937596 9:514247-514269 AGGGAGGGACGGAGGGAGGAAGG - Intronic
1050089796 9:2006172-2006194 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1050429187 9:5544459-5544481 AGGGTGGACTGGAGGGAGAAGGG - Intronic
1051054359 9:12966433-12966455 GGGGTCTACCTGAGGGTGGAGGG - Intergenic
1051595801 9:18823527-18823549 AGGGTGGAACAGAGGGAGAAGGG - Intronic
1052174637 9:25443609-25443631 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1052416934 9:28189362-28189384 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1052417027 9:28189618-28189640 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1052526126 9:29622042-29622064 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1052526131 9:29622054-29622076 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1052526158 9:29622119-29622141 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1052970407 9:34373800-34373822 GAGGGGGAGAGGAGGGAGGAAGG + Intronic
1053095973 9:35328659-35328681 GGGAAGGAAGGGAGGGAGGAAGG - Intronic
1053161974 9:35819457-35819479 GGGGTGGTGGGGATGGAGGATGG - Intronic
1053280492 9:36817328-36817350 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1053514739 9:38721248-38721270 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1053719980 9:40935649-40935671 GGTGTGAACGGGAGGCAGGAGGG + Intergenic
1054454100 9:65420619-65420641 GGGAGGGACGGGAGGGAAGAAGG + Intergenic
1054970963 9:71086197-71086219 GGTGTGGGAGGGAGGGAGGAGGG + Intronic
1055028932 9:71752481-71752503 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
1055624128 9:78155749-78155771 GGGGTGTACTTGAGGGTGGAGGG + Intergenic
1056590220 9:87961001-87961023 AGTGGGGACTGGAGGGAGGATGG - Intergenic
1056609313 9:88114467-88114489 GGGGTGGAGTGGGGGGAGGCGGG + Intergenic
1056756227 9:89383577-89383599 GTGGTGGGCGGGAGGTAGGAGGG + Intronic
1056992554 9:91424412-91424434 GGGGTGGGCAGGAGGGAAGGCGG + Intergenic
1056999789 9:91497206-91497228 GCGGCTGACAGGAGGGAGGATGG - Intergenic
1057167398 9:92939965-92939987 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1057450589 9:95155324-95155346 GGGGAGGAAGGAAGGGAGGAAGG + Intronic
1057605333 9:96494768-96494790 GGAGGGGACGGGAGGGGGGAGGG - Intronic
1057706439 9:97398375-97398397 GGGGAGCCCTGGAGGGAGGATGG - Intergenic
1058663632 9:107289063-107289085 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1058663637 9:107289075-107289097 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1058740479 9:107937608-107937630 GGGGTGATCTGGAGGGAGGGAGG + Intergenic
1058857377 9:109076381-109076403 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1058883453 9:109305208-109305230 GGGGTGGTGGGGTGGGAGGATGG + Intronic
1058944179 9:109841561-109841583 GGGATGGAGAGGAGGGTGGAGGG + Intronic
1058944223 9:109841669-109841691 GGGATGGAAGGGAGGGTGGAGGG + Intronic
1058944267 9:109841785-109841807 GGGGTGGAAGGGAGGGTGGAGGG + Intronic
1059334337 9:113559314-113559336 TGGTTGGACCGGAGCCAGGAAGG + Intronic
1059491818 9:114674216-114674238 TGGGTGGACAGGAGGGAAGAAGG - Intergenic
1059862945 9:118485422-118485444 GGGGTGGGATGCAGGGAGGAGGG + Intergenic
1060109374 9:120895345-120895367 GGGATGGAGAGGTGGGAGGATGG + Intergenic
1060319888 9:122548734-122548756 GGGGTAGAGGGGAGGGGGGAGGG - Intergenic
1060760098 9:126239759-126239781 TGGGTGGACAGGATGGAGGTGGG + Intergenic
1061060270 9:128246743-128246765 AGGGAGGAAAGGAGGGAGGATGG - Intronic
1061086892 9:128404778-128404800 GGGGGGGACCAAGGGGAGGAGGG + Intergenic
1061246145 9:129402117-129402139 GAGGTGGGGAGGAGGGAGGAGGG - Intergenic
1061371790 9:130201538-130201560 GGGCTGGGCCTGGGGGAGGAGGG + Intronic
1061377796 9:130236375-130236397 CGGGTGGTCCGGAGGGAGGCTGG + Exonic
1061399037 9:130358396-130358418 AAGGTGGACCTGAGGGACGAGGG + Intronic
1061483216 9:130907295-130907317 GGCGTGGACTGGAGGAAGGACGG - Intronic
1061942625 9:133891615-133891637 GGGATGGAGGGGAGGGAGGGCGG + Intronic
1062235891 9:135507411-135507433 GGGGTGAGCCAAAGGGAGGACGG - Intergenic
1062359662 9:136181795-136181817 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1062449147 9:136608281-136608303 GGAGAGGAAGGGAGGGAGGAAGG + Intergenic
1062469611 9:136696830-136696852 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469621 9:136696848-136696870 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469631 9:136696866-136696888 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469653 9:136696910-136696932 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469663 9:136696928-136696950 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469686 9:136696973-136696995 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469696 9:136696991-136697013 GGGAAGGAGGGGAGGGAGGAGGG - Intergenic
1062677077 9:137752926-137752948 GGTGAGGACTGGAGGGAAGAGGG + Intronic
1062712048 9:137980666-137980688 GGGGAGTACTAGAGGGAGGAGGG - Intronic
1202780781 9_KI270717v1_random:34881-34903 GGAGAGGAAGGGAGGGAGGAAGG - Intergenic
1185449673 X:275624-275646 GGGGTGGACCGGAAGCAGCCAGG + Intergenic
1185462848 X:340480-340502 GGGACGGACGGGAGGGGGGACGG - Intronic
1185462864 X:340514-340536 GGGACGGACGGGAGGGGGGACGG - Intronic
1185462880 X:340548-340570 GGGACGGACGGGAGGGGGGACGG - Intronic
1185462896 X:340582-340604 GGGACGGACGGGAGGGAGGACGG - Intronic
1185462910 X:340616-340638 GGGACGGACGGGAGGGAGGACGG - Intronic
1185511534 X:668025-668047 GGGGAGGAGGGGAGGGGGGAAGG - Intergenic
1185581340 X:1213184-1213206 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1185603592 X:1354959-1354981 GAGGAGGACTGGGGGGAGGAAGG + Intronic
1185624538 X:1472983-1473005 GGGGTGGGTGGGAGGGTGGATGG + Intronic
1185624782 X:1474012-1474034 TGGGTGGATGGGAGGGTGGATGG + Intronic
1185820229 X:3195942-3195964 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1186020661 X:5251351-5251373 GGAGGGGAGGGGAGGGAGGAAGG + Intergenic
1186242752 X:7587732-7587754 GGGGTGGGGCGGGGGGGGGAGGG - Intergenic
1186523628 X:10228210-10228232 GGGGAGGAGGGGATGGAGGATGG - Intronic
1186685132 X:11917737-11917759 AGGGAGGAAGGGAGGGAGGAGGG + Intergenic
1186778936 X:12893583-12893605 GGGGTGGAGGGGAAGGAGGAAGG + Intergenic
1187034345 X:15522210-15522232 AGGGAGGAAGGGAGGGAGGAAGG - Intronic
1187297907 X:18020181-18020203 GGGGTCTATCGGAGGGTGGAGGG + Intergenic
1187327853 X:18308296-18308318 AGGGAGGAAGGGAGGGAGGAAGG + Intronic
1187357984 X:18596325-18596347 GGGGTGGAGGTGGGGGAGGAGGG + Intronic
1187419588 X:19122652-19122674 GGCGGGGCGCGGAGGGAGGAGGG + Intergenic
1187480675 X:19652241-19652263 GGGGTGGACAAGAGGAAGCAAGG - Intronic
1187783537 X:22857336-22857358 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1187915311 X:24149018-24149040 GGGGTGGAGTGGGGGGAGAAGGG - Intergenic
1188142905 X:26574138-26574160 GGGGAGGAAGGGAGGGAGGGAGG + Intergenic
1188760163 X:34017803-34017825 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1188958430 X:36462168-36462190 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1189236046 X:39488291-39488313 GGGGTGGGCAGGAGGCAGGCAGG - Intergenic
1189310051 X:40012518-40012540 GGAGAGGACGGGAGGGAAGAGGG + Intergenic
1189323135 X:40098032-40098054 AGGGCGGGCGGGAGGGAGGACGG - Intronic
1189775918 X:44470143-44470165 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1189874652 X:45423249-45423271 GGGGTCTACTAGAGGGAGGAGGG + Intergenic
1190473471 X:50805926-50805948 GGGGTGGTGGGTAGGGAGGAGGG - Intronic
1190495566 X:51025512-51025534 GGGGTGGACCGGAAGGGAGAGGG + Intergenic
1190510361 X:51168069-51168091 GGGGTGGACTGGAAGGGAGAGGG - Intergenic
1190827043 X:54027246-54027268 GGGGCGGACAGAAGGGAGGGAGG - Intronic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1191985031 X:66970481-66970503 GGGGTGGGGAGGAGGGGGGAGGG - Intergenic
1192207824 X:69107734-69107756 GGGAAGGACAGAAGGGAGGAAGG - Intergenic
1192380377 X:70610226-70610248 GGGAGGGACGGGAGGGAGGGAGG + Intronic
1192531966 X:71895677-71895699 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1192533963 X:71911980-71912002 GGAGTGGCCGGGAGGGGGGAGGG + Intergenic
1192657309 X:73004442-73004464 GGGGTGGGCGGGGGAGAGGAAGG - Exonic
1192664811 X:73078565-73078587 GGGGTGGGCGGGGGAGAGGAAGG + Exonic
1193495962 X:82213287-82213309 GGGGCCTACCAGAGGGAGGAGGG - Intergenic
1194296961 X:92137999-92138021 GGGGTGGAGAGGAGGGGGGACGG - Intronic
1194780857 X:98024039-98024061 GGGGTCTACTTGAGGGAGGAGGG - Intergenic
1195409206 X:104550621-104550643 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1195534149 X:105992045-105992067 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1195672555 X:107482179-107482201 TGGGAAGACCGGGGGGAGGAGGG - Intergenic
1195908046 X:109864829-109864851 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1196264773 X:113629747-113629769 GGGGTGGAGAAGAGTGAGGATGG + Intergenic
1196337837 X:114559285-114559307 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1196358998 X:114830837-114830859 GGGGTGGGGGGGAGGGGGGAGGG - Intronic
1196621289 X:117827588-117827610 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1196749305 X:119100476-119100498 GGGTTGGAGGGGAGTGAGGATGG - Intronic
1196797717 X:119515575-119515597 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1196913190 X:120505413-120505435 AGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1197483063 X:127011049-127011071 GGGGCCTACCGGAGGGTGGAGGG + Intergenic
1197920250 X:131584574-131584596 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1198080138 X:133231881-133231903 AGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1198112043 X:133510293-133510315 AGGATGGAAGGGAGGGAGGAAGG - Intergenic
1198158581 X:133985651-133985673 GGGGTGGGGCGGGGCGAGGAGGG + Intronic
1198421360 X:136473050-136473072 GGGGAGGAATGAAGGGAGGAAGG + Intergenic
1198421374 X:136473095-136473117 GGGGAGGAATGAAGGGAGGAAGG + Intergenic
1198517818 X:137427047-137427069 GAGGTGGCTTGGAGGGAGGAAGG + Intergenic
1198652102 X:138874004-138874026 GGGGTGGGGGGGAGGGGGGAGGG + Intronic
1198957155 X:142145920-142145942 AGGGAGGGACGGAGGGAGGAAGG + Intergenic
1198980081 X:142385732-142385754 GGGGTGGGGGGGAGGGGGGAGGG - Intergenic
1199103577 X:143836538-143836560 GGGGTCTATCGGAGGGGGGAAGG + Intergenic
1199264765 X:145817760-145817782 GGGGAAGAAGGGAGGGAGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200332574 X:155313102-155313124 GGGATGCCACGGAGGGAGGATGG + Intronic
1200397449 X:155999501-155999523 GGGATGGGCAGGAGGCAGGAGGG - Intronic
1200614472 Y:5362574-5362596 GGGGTGGAGAGGAGGGGGGACGG - Intronic
1200807028 Y:7443561-7443583 GAGGTGGGAGGGAGGGAGGAAGG - Intergenic
1201249804 Y:12045361-12045383 GGGGTGGGGGGGAGGGGGGAGGG + Intergenic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201300247 Y:12498763-12498785 GGGGGGGAAGGGGGGGAGGAGGG - Intergenic
1201698498 Y:16854170-16854192 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic