ID: 926304946

View in Genome Browser
Species Human (GRCh38)
Location 2:11631141-11631163
Sequence GTGCATGCAGCTGGTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926304946_926304952 12 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304952 2:11631176-11631198 GGTGCTCTGAGGAATTCAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 194
926304946_926304949 -9 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304949 2:11631155-11631177 TGCATGCACAGTGTTGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 170
926304946_926304951 11 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304951 2:11631175-11631197 AGGTGCTCTGAGGAATTCAGAGG 0: 1
1: 0
2: 1
3: 41
4: 214
926304946_926304950 1 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304950 2:11631165-11631187 GTGTTGTGGCAGGTGCTCTGAGG 0: 1
1: 0
2: 4
3: 54
4: 648
926304946_926304953 21 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304953 2:11631185-11631207 AGGAATTCAGAGGGAGCAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926304946 Original CRISPR GTGCATGCAGCTGGTGCTCA TGG (reversed) Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
902784970 1:18727273-18727295 GTTCATGCAACTTGTGCACATGG - Intronic
903296282 1:22345169-22345191 GTGGATGGAGCTGGTGCACCAGG - Intergenic
903296289 1:22345193-22345215 GTGGATGGAGCTGATGCTCCAGG - Intergenic
903296334 1:22345409-22345431 GTGGATGGAGCTGGTGCACCAGG - Intergenic
903846949 1:26284389-26284411 GGGCAGGCAGCTGATGCACAAGG - Exonic
904594193 1:31632761-31632783 GTGCAGGCATCTGGGCCTCAGGG - Intronic
904619726 1:31767956-31767978 GAGAATGCAGGTGCTGCTCAAGG - Intergenic
907312510 1:53547020-53547042 GGACATACAGCAGGTGCTCAGGG + Intronic
908655280 1:66382174-66382196 GTACATACAGCTTGTGCCCATGG + Intergenic
909155120 1:72064512-72064534 GTGAAAGCCGTTGGTGCTCAGGG - Intronic
916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG + Intergenic
916743779 1:167668669-167668691 GGCCCTGCAGTTGGTGCTCAGGG - Intronic
918343325 1:183585125-183585147 ATGTATGCAGCTGTTGCTAAGGG - Intronic
920238513 1:204526390-204526412 TTGCATGCAGCAGGTGCGCAAGG + Exonic
920855217 1:209656288-209656310 GTGCATGCAGCTTGAGCCCGAGG + Intergenic
922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG + Intergenic
924616565 1:245616886-245616908 ATGCAAGCAACTGTTGCTCAAGG + Intronic
924880213 1:248152688-248152710 TTGCAGGCAGCTGGTGACCAGGG + Intergenic
1063095931 10:2908984-2909006 GTGCCTGCTGCGGGTGCTTATGG - Intergenic
1064483694 10:15764312-15764334 GTGCATGTGGCCGGTCCTCATGG - Intergenic
1065916315 10:30357264-30357286 GTGCATGCAACACGTGCTGAAGG + Intronic
1068706217 10:60078885-60078907 GTGTATGCAGCTTGTGTTCCTGG - Intronic
1068954007 10:62805439-62805461 GTCCATGCAGCTGATGCGCACGG - Exonic
1069564892 10:69457240-69457262 GTGCACACAGTAGGTGCTCAGGG + Intronic
1069719541 10:70540836-70540858 CAGCATGCACCTGGGGCTCAAGG - Intronic
1070588779 10:77786841-77786863 TGGCCTGCAGCAGGTGCTCACGG + Intergenic
1071518382 10:86314218-86314240 CTGCTTTCAGCTGGTGCTCAGGG + Intronic
1072306835 10:94115832-94115854 GTTCAGGCAGCTGGTGCTCCAGG - Intronic
1072760406 10:98051763-98051785 GTTCAGGCTGCTGGTCCTCATGG + Intergenic
1075522265 10:123149979-123150001 GAGCATGCCGCTGGTGTTCCGGG + Exonic
1076115128 10:127890158-127890180 ATACATGCAGCAGCTGCTCAGGG + Intronic
1076118318 10:127916670-127916692 CTGCATGGAGCTGGAGCCCAGGG + Intronic
1076998322 11:310262-310284 CTGGATCCAGCTGCTGCTCACGG - Intronic
1077000420 11:319496-319518 CTGGATCCAGCTGCTGCTCACGG + Intergenic
1077052158 11:571748-571770 GTGCATGCTCCTGGTGTGCACGG - Intergenic
1077278972 11:1733407-1733429 GTGGATGGAGGGGGTGCTCAGGG - Exonic
1077853342 11:6096781-6096803 GTGAATGCTGCTGGTCCTCTTGG - Intergenic
1084029382 11:66472288-66472310 GAGCAAGCACCTGGAGCTCAAGG - Intronic
1084289285 11:68151528-68151550 GTGCAGGCTTCTGGGGCTCAGGG - Intergenic
1084512834 11:69616798-69616820 GTGCACCCTGCAGGTGCTCACGG - Intergenic
1084522043 11:69669366-69669388 TTGCAAACAGCTGGTGCTCCTGG + Intronic
1088624861 11:111722730-111722752 GTTCCTGCAGCTGCTGCTCAAGG - Exonic
1089000104 11:115044705-115044727 GTGCTTGCAGCTGCAGCTAAAGG + Intergenic
1091909178 12:4214944-4214966 GTTCATGCAGCTGATGATCTTGG - Intergenic
1093435428 12:19130059-19130081 GTGCAGCCAGGTGGTGCTCTTGG - Exonic
1100232270 12:92620435-92620457 TTGCATTCAGCTGGTGCTGAGGG + Intergenic
1101946436 12:109140685-109140707 GTGCATGCAGTAGATGCACAAGG - Intronic
1103014857 12:117486056-117486078 GTGCATGCAGCTGGTGTGAATGG - Intronic
1103039002 12:117679231-117679253 GTGCATGGTGCTGATGCACATGG - Intronic
1103821534 12:123702567-123702589 GCTCATCTAGCTGGTGCTCAAGG + Intronic
1103951457 12:124553875-124553897 GCGCATGCAGCTCGGGCTCTTGG - Intronic
1104636712 12:130442136-130442158 GTGCACGCTGCTGGTGGGCAAGG - Exonic
1104837340 12:131800088-131800110 GAGCAAGCAGCCGGCGCTCAAGG - Intergenic
1107464353 13:40635865-40635887 ATGCATGCATCTGGTCCCCAGGG - Intronic
1110767525 13:79297958-79297980 GTGCAAGAATATGGTGCTCAAGG - Intergenic
1112709223 13:102107649-102107671 TTGCATGTAGCTGGTGCAGAGGG + Intronic
1113964205 13:114143309-114143331 GTGCACACAGCAGCTGCTCACGG - Intergenic
1114678869 14:24466154-24466176 GTGCATGCTGCTATTGCTCATGG + Intergenic
1115153196 14:30309111-30309133 GTGGATGCTACTGGTGCTGAGGG - Intergenic
1116052956 14:39827030-39827052 GTGCATGCAGCAGGTGAGCCTGG + Intergenic
1116063862 14:39958180-39958202 ATCCAGGCAGCTGGTGATCAGGG - Intergenic
1117228340 14:53687352-53687374 CTGGATGCAGCTGGTTCCCATGG - Intergenic
1118471222 14:66077038-66077060 GGGCTTGGAGCTGGGGCTCAGGG - Intergenic
1122031066 14:98912955-98912977 GGGCATGTAGCTGCTGTTCAGGG - Intergenic
1122954186 14:105062190-105062212 GGAGATGCAGCTGGAGCTCAGGG - Intronic
1125475759 15:40047242-40047264 GTGCATGGGCCTGGGGCTCAGGG - Intergenic
1129154522 15:73709549-73709571 GTGCAGGAAGCTGGTGAACAGGG - Intronic
1129476881 15:75791626-75791648 GTGCATGCACCATGTGCTGAGGG - Intergenic
1129741296 15:77990907-77990929 GGGCATCCAGGTGGTGCTCAGGG + Intronic
1129844369 15:78761492-78761514 GGGGATCCAGGTGGTGCTCAGGG - Intronic
1130257431 15:82332287-82332309 GGGGATCCAGGTGGTGCTCAGGG + Intergenic
1130597514 15:85257678-85257700 GGGGATCCAGGTGGTGCTCAGGG - Intergenic
1131254771 15:90854872-90854894 CTGCACACAGCAGGTGCTCAGGG - Intergenic
1131258328 15:90875795-90875817 CTGCTAGCAGCTGATGCTCAGGG + Exonic
1131931704 15:97449604-97449626 GTGCATACTGCTGGCCCTCATGG + Intergenic
1132887607 16:2189499-2189521 GCCCATGAAGCTGGTGCTGAAGG - Exonic
1132982621 16:2746279-2746301 CTGCATTCTCCTGGTGCTCAAGG - Intergenic
1132992958 16:2806545-2806567 GTGGATGTAGCTGGTTCTGAGGG + Intergenic
1133085120 16:3356273-3356295 GTGCATCCTGCTGGTGGTGATGG + Exonic
1133287678 16:4698159-4698181 GTCCTTGCAGCTGGCCCTCATGG + Intronic
1133426011 16:5690222-5690244 ATGCATTCAGGTGGAGCTCATGG - Intergenic
1133876417 16:9739109-9739131 CTGCATGGAGCTGGAGCTCAGGG + Intergenic
1134002630 16:10794646-10794668 ATGTATGCAGGTGGTGCACAGGG + Intronic
1135272993 16:21085024-21085046 TTGCTGTCAGCTGGTGCTCACGG - Intronic
1135746282 16:25019440-25019462 GTGCTTGCAGTTGCTGCTGAAGG - Intergenic
1136118489 16:28112077-28112099 GTGCAGCCAGCGGGTGCTGAAGG - Intronic
1140715692 16:77723476-77723498 TGGCACACAGCTGGTGCTCAGGG - Intronic
1145786043 17:27594523-27594545 GTGCACGCAGGAGGGGCTCATGG - Intronic
1147768895 17:42854509-42854531 GCCTCTGCAGCTGGTGCTCAGGG - Exonic
1147951593 17:44110861-44110883 TGGCATGCTGCTGGTGCCCAAGG - Intronic
1148647373 17:49226705-49226727 GTCCCTACAGGTGGTGCTCACGG - Exonic
1149577537 17:57724892-57724914 GTCCTTGCATCTGGTCCTCAAGG + Intergenic
1149612576 17:57968303-57968325 GTGCATGGAGAGGGTGGTCAGGG + Intergenic
1150031557 17:61742080-61742102 GTTAATGCAGCAGGTGCTGATGG - Intronic
1150827819 17:68492181-68492203 GTTCATTCGGCAGGTGCTCAAGG + Intergenic
1151262638 17:72928880-72928902 TGGCATGAAGCAGGTGCTCAGGG - Intronic
1151382110 17:73733010-73733032 GTGCAAGGAGTGGGTGCTCAGGG - Intergenic
1151437192 17:74105112-74105134 TGGCATGCAGCAGGTGCTCCAGG - Intergenic
1151804710 17:76398193-76398215 GGGACTGCAGCTGGTGCACAGGG + Intronic
1152074041 17:78147824-78147846 GAGCAGGCAGCTGGGGCTCCGGG + Intronic
1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG + Intergenic
1152388220 17:79987719-79987741 CTGCAGGGAGCTGGTTCTCAGGG + Intronic
1152532980 17:80931326-80931348 CTGCAGGGAACTGGTGCTCATGG - Intronic
1152662247 17:81547933-81547955 GAGGATGAAGCTGGTGCTCCGGG + Intronic
1156890898 18:42188143-42188165 GTCCCTGCAGCTGGGGCTGAAGG + Intergenic
1157359439 18:46964171-46964193 GTGGAAGAAGCTGGTGCTCGTGG - Exonic
1157361033 18:47023690-47023712 GTGGAAGAAGCTGGTGCTCGTGG - Exonic
1157362023 18:47029605-47029627 GTGGAAGAAGCTGGTGCTCGTGG - Exonic
1157362902 18:47035027-47035049 GTGGAAGAAGCTGGTGCTCGTGG - Exonic
1158375499 18:56858816-56858838 TTGCTTGCAGATGTTGCTCAAGG - Intronic
1159737009 18:72112714-72112736 GTGCAGGCAGCTGGAGCTCTCGG + Intergenic
1160246781 18:77165703-77165725 GGCAGTGCAGCTGGTGCTCATGG + Intergenic
1160470390 18:79127472-79127494 GTGAAAGCAGCTGGTGACCAAGG - Intronic
1160845099 19:1162797-1162819 GTGCATGTAGCTGGTCTACAGGG - Intronic
1161261211 19:3338829-3338851 GAGCAGGCAGCTGGTGCCCAAGG - Intergenic
1162943455 19:14028213-14028235 GTACATGCTGCTGCTGCTCCTGG + Exonic
1165008950 19:32829181-32829203 CAGCAGGCAGCTGGTGCGCACGG - Intronic
1166331187 19:42078959-42078981 GTGGATGGTGCTGGAGCTCAGGG - Exonic
1166876446 19:45900597-45900619 GAGCATGGGGCAGGTGCTCAGGG + Intronic
1167669845 19:50844431-50844453 TTGCAGGCAGCAGGTGCGCAGGG + Intergenic
926304946 2:11631141-11631163 GTGCATGCAGCTGGTGCTCATGG - Intronic
926419412 2:12682142-12682164 CTGCGTGCAGCAGGTGCTCAAGG - Intergenic
926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG + Intergenic
927251616 2:20999768-20999790 GTGTATGAATCTGGTACTCAAGG - Intergenic
928196595 2:29220753-29220775 GTTCATCCTGCTGGAGCTCATGG - Exonic
931667705 2:64622428-64622450 TTGCTGGCAGCTGGTGCTGAGGG - Intergenic
932415296 2:71569980-71570002 CTGGAGGCACCTGGTGCTCAGGG + Intronic
932883244 2:75523775-75523797 GTGCATAGAGCTAATGCTCAGGG + Intronic
935684268 2:105669785-105669807 CTCCAGGCAGCTGGTGCGCAGGG + Intergenic
937120183 2:119435597-119435619 GGGCATTCAGTGGGTGCTCAAGG - Intronic
937337629 2:121071585-121071607 GTGCACCCACCTGGTGCTGATGG - Intergenic
939838424 2:147157193-147157215 GTGCAAGCAGCTTCTGCTCTGGG - Intergenic
941345216 2:164360306-164360328 GTACATGCAGCAAGTGCTCAAGG - Intergenic
944863126 2:203834400-203834422 GTGGATTCAGCTGCTGCTAATGG + Intergenic
945257444 2:207814052-207814074 GATCATGCTGCTGGGGCTCAGGG + Intergenic
947811271 2:233005354-233005376 CTGCTTCCTGCTGGTGCTCAGGG - Intronic
947979733 2:234398745-234398767 GTGCAGGCAGCTGCAGCCCAGGG + Intergenic
948240553 2:236429605-236429627 ATGCATGCAGTAGGTGCTCTGGG + Intronic
948942952 2:241205043-241205065 GTGCAGACAGCTGGTGCTTGAGG + Intronic
1168948545 20:1781044-1781066 GTGAATGGAGCTGCTTCTCATGG - Intergenic
1168976317 20:1968735-1968757 GTGCCAGCAGCTGGTGCTCCTGG - Intergenic
1170359084 20:15524745-15524767 CTACATGTAGCTAGTGCTCAAGG - Intronic
1173556778 20:43972106-43972128 TTGCAGGCAGCTTGTGCTCAAGG - Intronic
1173617602 20:44413203-44413225 GTACATGCAGCTCCTGCTGATGG + Intronic
1173736726 20:45367055-45367077 GTGCATGCGGACGGAGCTCAAGG + Exonic
1174287602 20:49483727-49483749 CTACATGCAGGGGGTGCTCAGGG - Intergenic
1174674727 20:52342663-52342685 ATACATGTAGCTGGTGCTGATGG - Intergenic
1175259681 20:57666662-57666684 GTCCATGAAGCTGGTATTCATGG + Intronic
1175583782 20:60121374-60121396 GTGCACAGAGCTGGTGCTCAGGG - Intergenic
1176111730 20:63414004-63414026 CTGCCTGCTGCCGGTGCTCATGG - Intronic
1176293680 21:5059414-5059436 GGGAAGGCAGCTGCTGCTCATGG + Intergenic
1176514083 21:7770304-7770326 GTGCATGCTGCGGGTAGTCAAGG - Exonic
1178648196 21:34400828-34400850 GTGCATGCTGCGGGTAGTCAAGG - Exonic
1179863579 21:44204234-44204256 GGGGAGGCAGCTGCTGCTCATGG - Intergenic
1179879614 21:44287904-44287926 CTGCATGCAGCTGGGGGCCAGGG - Intronic
1180590729 22:16935076-16935098 GTGAGGGCAGCTGCTGCTCAGGG + Intergenic
1180983464 22:19890605-19890627 GTGGGTGCAGCTGGGGCTTAGGG - Intronic
1181019504 22:20091918-20091940 GTACATGCAGCGTGTCCTCAAGG + Exonic
1182530172 22:30949351-30949373 TGACATGCAGCAGGTGCTCAGGG + Intronic
1183344110 22:37297521-37297543 TTCCATGCAGCAGCTGCTCACGG + Intronic
1183695181 22:39417716-39417738 GAGGAGGCAGCTGGTGCTGAGGG - Exonic
1183818111 22:40321103-40321125 CTGCATGCAGATCGTTCTCAAGG - Exonic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1184859229 22:47163739-47163761 CTGCATGCAGCCGGGGCTCATGG + Intronic
1185298223 22:50064657-50064679 TTCCTAGCAGCTGGTGCTCAGGG - Intronic
949765530 3:7521913-7521935 GTGGAGGCAGGTGGGGCTCAAGG - Intronic
950187522 3:10954184-10954206 GTGTGGGTAGCTGGTGCTCAGGG + Intergenic
950521752 3:13501664-13501686 GTGCATGCAGGAGGTGGTCAGGG - Intronic
950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG + Intergenic
952303000 3:32120991-32121013 GTCCATCCAGCTGGGACTCAGGG + Intronic
954932270 3:54294546-54294568 GTGCATGAAGCTGGTGGTGTGGG + Intronic
955656857 3:61253360-61253382 GTGAATGTATCTGTTGCTCAAGG - Intergenic
956609580 3:71108889-71108911 GGGCATGGTGCTGGTGTTCATGG - Intronic
962690765 3:137896193-137896215 GTGAATCCATCTGGTGGTCATGG - Intergenic
962942898 3:140141760-140141782 GTGGATGGGGCTGGTGCCCATGG + Intronic
966352557 3:179046616-179046638 TTCCAGGCAGCTGGTGGTCAGGG - Intronic
968589725 4:1451284-1451306 CTGGACGCAGCAGGTGCTCAGGG + Intergenic
969463384 4:7340676-7340698 GGGCCTGCAGCTGGAGCTCAGGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
970006775 4:11418659-11418681 GTGCAGGCAGGTGGGGCTTAGGG + Intronic
970364463 4:15344152-15344174 GTGCATGCATATGGTGCAGAAGG + Intronic
970753938 4:19401036-19401058 ATGCAAACAGCTGGGGCTCAAGG + Intergenic
971643868 4:29170951-29170973 GTCCATGCACCTTGTGTTCAGGG - Intergenic
976288069 4:83389324-83389346 GTGTAGGCAGCCAGTGCTCAGGG + Intergenic
977846728 4:101775828-101775850 GTTCATTCAGCTGGGGGTCAAGG - Intronic
978013818 4:103719829-103719851 GGGGATGCAGCTGGGGCTAAGGG + Intergenic
981423258 4:144575503-144575525 GTGTATGCAGCTGTTGTTCATGG + Intergenic
989543350 5:42643430-42643452 ATACATGCTGCTGGTGATCATGG + Intronic
991963991 5:72072978-72073000 GTGCTTCCTGCTGCTGCTCAGGG - Intergenic
992778500 5:80108031-80108053 GTGGCTTCAGCTGATGCTCATGG - Intergenic
992789792 5:80202964-80202986 GTACATGAAGCGGGTGCTGAGGG + Exonic
994871030 5:105350831-105350853 GTCCAAGCAGCTGGTGAGCAGGG + Intergenic
995084064 5:108087090-108087112 GTGAATGGAGCTGGAGCTGATGG + Intronic
995658407 5:114453007-114453029 GAGCCTGCAGCTGGTGGACACGG + Intronic
999697316 5:154198587-154198609 GTGCATGCAGAGGCTGCTCTTGG + Intronic
1001221820 5:169906877-169906899 GTGCATGAGGCTGGTGCTGATGG + Intronic
1001755115 5:174162610-174162632 TTGAATGCAGCTGATGCTAAAGG + Intronic
1002422365 5:179155295-179155317 GTGGAAGCAGGTGCTGCTCAGGG - Intronic
1002792674 6:447349-447371 GTGCAAACAGCAGGTGCTCATGG + Intergenic
1008602352 6:53108585-53108607 CTTCATGCAGCTGGCCCTCAGGG - Intergenic
1012829594 6:104187865-104187887 GTGAATGCTGCTGTTGCTCTGGG - Intergenic
1012917044 6:105181448-105181470 GTGTATTCAGCTTGTGCGCAAGG + Intergenic
1013478702 6:110533334-110533356 GGGCCTGAAGCTGGTACTCAGGG - Intergenic
1014305530 6:119736661-119736683 ATGCAAGCAACTGGAGCTCATGG + Intergenic
1014420331 6:121235628-121235650 TTCCAGGCAGCTGGTGATCAGGG + Intronic
1015622006 6:135141278-135141300 GAGGATTCAGCTGGAGCTCAAGG + Intergenic
1017941050 6:159053368-159053390 GTTCTTGCAGGTGGTGGTCAAGG - Intergenic
1022317188 7:29256604-29256626 CTGCCAGAAGCTGGTGCTCATGG + Intronic
1023908571 7:44538716-44538738 GGGCATACAGCTGGTCCTGAAGG - Intronic
1025007631 7:55366397-55366419 GTTCATGCAGCTGAAGCCCACGG - Intronic
1025082418 7:55995346-55995368 GTGCAGGAAGCTGCTGCTCTGGG - Intronic
1025195086 7:56926358-56926380 TGGCATGCAGCTGGAGCTGAGGG - Intergenic
1025676866 7:63650585-63650607 TGGCATGCAGCTGGAGCTGAGGG + Intergenic
1026863312 7:73807901-73807923 GTGGGGGCAGCTGGTGCTCGTGG + Intronic
1033186579 7:139231865-139231887 GCGCCTGGAGCTGGTGCTTAAGG + Exonic
1034624149 7:152479545-152479567 GTGCCTGCAGCTGCTGCTTCTGG - Intergenic
1036380970 8:8236311-8236333 GTGCCTGCACAGGGTGCTCAGGG - Intergenic
1036396746 8:8377087-8377109 GAACATGCAGCTGCTGCCCAGGG - Exonic
1039394659 8:37215011-37215033 GGACAGGCAGGTGGTGCTCAGGG + Intergenic
1039602277 8:38850183-38850205 GTGAATGAAGCTGATGCACAGGG + Exonic
1041036939 8:53801845-53801867 GTGTTTGCAGCTGATGCTCCGGG - Exonic
1041160018 8:55031000-55031022 GTGTATTCTGCTGCTGCTCATGG - Intergenic
1043414686 8:80034452-80034474 GTCCTTGCAGCAGCTGCTCAAGG + Intronic
1047447976 8:124937133-124937155 CTGCCTGCAGCTGCTGCTAAGGG + Intergenic
1049047747 8:140166024-140166046 GTGCATGCAGGCGGGGCTCCTGG - Intronic
1049204452 8:141357188-141357210 GGCCATGCAGCTCCTGCTCACGG - Exonic
1049258004 8:141624188-141624210 GGGCAGTCAGCTGGTGCTGAAGG + Intergenic
1049731278 8:144179830-144179852 GTGCGTGCAGCTGGGGCCAAAGG + Intronic
1049825933 8:144667776-144667798 ATGCATGCAGTGGGTGCTCTTGG - Intergenic
1055059694 9:72055686-72055708 AGGCATGCAACTGGTGCACAGGG + Intronic
1055059746 9:72056396-72056418 AGGCATGCAACTGGTGCACAGGG + Intronic
1057222748 9:93266692-93266714 GTGTATGCAGGTGGTGCTCCTGG + Intronic
1057255868 9:93546566-93546588 ATGCATGCAGCTGGTCCTGGTGG + Intronic
1058471443 9:105283167-105283189 GGGCATGGAGCGGGTGCTGAAGG + Intronic
1058666692 9:107324882-107324904 GTTCAAGAAGCTGGTGGTCAAGG + Exonic
1060421374 9:123472095-123472117 GAGCACACAGCAGGTGCTCAGGG + Intronic
1060447710 9:123706971-123706993 GTGTAAGCAGCTGGAGTTCAAGG + Intronic
1060725689 9:126004255-126004277 GTGCATTCAGCCTGGGCTCAGGG - Intergenic
1060883732 9:127136238-127136260 CTGCAGCCAGCTGGAGCTCAGGG - Intronic
1061359811 9:130133926-130133948 GTGCATGCAGCTGGACCTCATGG - Intronic
1062252183 9:135603899-135603921 TTGCAGGCAGCTGGAGCTCCCGG + Intergenic
1062416811 9:136455323-136455345 GAGCAGGCAGCGGGCGCTCAGGG + Intronic
1187672651 X:21684035-21684057 CTTCTTGCATCTGGTGCTCATGG + Intergenic
1188389397 X:29600948-29600970 TTCCAGGCAGCTGGTGCCCAGGG + Intronic
1194201168 X:90954264-90954286 GTAGATGCATCTGATGCTCATGG - Intergenic
1199170246 X:144726743-144726765 GTGCATGCTGCTGCTCCTCTGGG - Intergenic
1199812047 X:151359725-151359747 GTGCATCCAACTGAGGCTCAGGG - Intergenic
1200547013 Y:4529723-4529745 GTAGATGCATCTGATGCTCATGG - Intergenic
1200758973 Y:7018689-7018711 ATGCATACAACTTGTGCTCATGG - Intronic
1201404714 Y:13638120-13638142 CTGCCTGCAGCTGGGGCTGAGGG - Intergenic