ID: 926304946

View in Genome Browser
Species Human (GRCh38)
Location 2:11631141-11631163
Sequence GTGCATGCAGCTGGTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926304946_926304949 -9 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304949 2:11631155-11631177 TGCATGCACAGTGTTGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 170
926304946_926304951 11 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304951 2:11631175-11631197 AGGTGCTCTGAGGAATTCAGAGG 0: 1
1: 0
2: 1
3: 41
4: 214
926304946_926304952 12 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304952 2:11631176-11631198 GGTGCTCTGAGGAATTCAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 194
926304946_926304950 1 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304950 2:11631165-11631187 GTGTTGTGGCAGGTGCTCTGAGG 0: 1
1: 0
2: 4
3: 54
4: 648
926304946_926304953 21 Left 926304946 2:11631141-11631163 CCATGAGCACCAGCTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 926304953 2:11631185-11631207 AGGAATTCAGAGGGAGCAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926304946 Original CRISPR GTGCATGCAGCTGGTGCTCA TGG (reversed) Intronic