ID: 926304948

View in Genome Browser
Species Human (GRCh38)
Location 2:11631151-11631173
Sequence CAGCTGCATGCACAGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926304938_926304948 20 Left 926304938 2:11631108-11631130 CCACTCACCTTCCAGCCTTCCTG 0: 1
1: 0
2: 4
3: 84
4: 880
Right 926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 208
926304943_926304948 9 Left 926304943 2:11631119-11631141 CCAGCCTTCCTGGCGGAGCTGGC 0: 1
1: 0
2: 5
3: 20
4: 274
Right 926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 208
926304945_926304948 1 Left 926304945 2:11631127-11631149 CCTGGCGGAGCTGGCCATGAGCA 0: 1
1: 0
2: 2
3: 15
4: 192
Right 926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 208
926304937_926304948 25 Left 926304937 2:11631103-11631125 CCACTCCACTCACCTTCCAGCCT 0: 1
1: 1
2: 6
3: 90
4: 879
Right 926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 208
926304936_926304948 28 Left 926304936 2:11631100-11631122 CCACCACTCCACTCACCTTCCAG 0: 1
1: 1
2: 5
3: 60
4: 550
Right 926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 208
926304941_926304948 13 Left 926304941 2:11631115-11631137 CCTTCCAGCCTTCCTGGCGGAGC 0: 1
1: 0
2: 1
3: 18
4: 272
Right 926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 208
926304944_926304948 5 Left 926304944 2:11631123-11631145 CCTTCCTGGCGGAGCTGGCCATG 0: 1
1: 0
2: 3
3: 18
4: 235
Right 926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926304948 Original CRISPR CAGCTGCATGCACAGTGTTG TGG Intronic
902464661 1:16608632-16608654 CAGCGGCATCCCCAGTGTGGAGG + Exonic
902780100 1:18699397-18699419 CAGCTGCAGGAAGAGTGTTCAGG + Intronic
904131000 1:28274935-28274957 CATCGCCATGCACAGTGGTGTGG + Exonic
904264645 1:29311303-29311325 CAGCTGCAAGCTGGGTGTTGTGG + Intronic
905705645 1:40054996-40055018 CAGATAAGTGCACAGTGTTGTGG + Intronic
906092743 1:43196425-43196447 CAGGTGCATTCACGGTGTTATGG - Intronic
906205309 1:43983438-43983460 CAGCTGCATGGGCACTGTGGGGG + Intronic
910130047 1:83893784-83893806 CAGCTTCCTGCACTGTGATGGGG + Intronic
910821030 1:91346860-91346882 CAGCTACATTCTCAGTGTTTTGG + Intronic
911102328 1:94104576-94104598 CAGCTGCATGGACAGGCCTGTGG - Intronic
912565220 1:110582695-110582717 CTGCTGCATGCACAGGGTGGGGG + Intergenic
916258544 1:162816630-162816652 CAACAGCAGGCACAGTGTGGAGG - Intergenic
916552248 1:165860108-165860130 CAACTGCGTGCACAGGGTTAAGG - Intronic
917327092 1:173844380-173844402 GAGCTGCATGCCCAGCGTGGTGG + Intronic
917479055 1:175394886-175394908 CACATGCATGCACAGTGATGAGG - Intronic
918073325 1:181150044-181150066 CAGCTGGGAGCCCAGTGTTGGGG - Intergenic
918293208 1:183129600-183129622 CAGCATCATGCTCGGTGTTGGGG - Intronic
920134278 1:203757013-203757035 AAGATGCATGCACAGTGTGATGG + Intergenic
921685099 1:218081001-218081023 GGTCTGCATGCACAGTGGTGAGG - Intergenic
1065852889 10:29805458-29805480 CACCAGCATGCCCAGTGGTGGGG + Intergenic
1066527560 10:36297728-36297750 CTGCAGCAGGCACAGTGCTGGGG + Intergenic
1067920222 10:50448115-50448137 CAGCTGAATATACAGTGGTGGGG - Intronic
1069764868 10:70847968-70847990 CAGCGGCATGAACTGTGCTGGGG + Intronic
1070238518 10:74655224-74655246 CAGGTGCATGGACAGGGATGAGG + Intronic
1070566548 10:77607647-77607669 CACCTGCATCCCCAGTCTTGTGG - Intronic
1070740118 10:78897638-78897660 CTGCTCCATGCAAGGTGTTGAGG + Intergenic
1070806074 10:79271504-79271526 CAGCAGCCTTCACAGTGTTCTGG + Intronic
1071354993 10:84784930-84784952 GAGCTGCAGCCACAGTGTTCAGG + Intergenic
1073454482 10:103628368-103628390 GAGCTGCAAGCAGAGGGTTGTGG - Intronic
1073756583 10:106587400-106587422 CATCTGCATCCATAATGTTGTGG + Intronic
1075018254 10:118927092-118927114 AAGCTGGAAGCACAGGGTTGGGG + Intergenic
1077321988 11:1946837-1946859 CAGCTGCAAGCGCAGCGGTGCGG + Intergenic
1078018022 11:7632066-7632088 CTGCTGAAGGCACAGTGTTGTGG + Intronic
1081849142 11:46262907-46262929 AAGCTACATGCACAGTGCTTGGG - Intergenic
1083040533 11:59681289-59681311 TATCTGCAAGCACAGGGTTGGGG - Intergenic
1083761819 11:64822849-64822871 CAGAAGCATGCACAGTGCTAAGG - Intergenic
1084191378 11:67500475-67500497 CAGCTACATGCCCAGCCTTGAGG + Intronic
1085297921 11:75441352-75441374 CAGCTCCAGGCCCAGTGTCGGGG + Intronic
1085474397 11:76780907-76780929 CAACTGGAGGCACAGTGATGAGG + Intergenic
1089128124 11:116191671-116191693 CAGCCTCATTCACAGGGTTGGGG + Intergenic
1089399870 11:118158161-118158183 CAGCTGTTTGCACAGAGCTGTGG + Intergenic
1091310806 11:134574006-134574028 CTGCAGCATGCACCATGTTGGGG - Intergenic
1202805004 11_KI270721v1_random:2150-2172 CAGCTGCAAGCGCAGCGGTGCGG + Intergenic
1091782877 12:3224990-3225012 CAGCTGCACACACAGTGGAGTGG - Intronic
1091798807 12:3311865-3311887 CTGGTGCATGCTCAGTGTAGAGG + Intergenic
1096385039 12:51189736-51189758 CACCTGCAGGCAAAGTGTGGGGG + Exonic
1097146250 12:56941320-56941342 CAACTGAATGCACAGGCTTGCGG - Intergenic
1097151967 12:56985797-56985819 CAACTGAATGCACAGGCTTGCGG - Intergenic
1103341199 12:120222026-120222048 CACCTCCATGTCCAGTGTTGTGG - Intronic
1105936703 13:25107209-25107231 CAGCTGGATCCACACTGTGGAGG + Intergenic
1106024950 13:25947661-25947683 CAGCTGCTTCCACAGGGATGGGG - Intronic
1107095537 13:36531183-36531205 CACCTACATGCACAGAGTGGAGG - Intergenic
1107098299 13:36560318-36560340 CAGCTGTCTGCACAGTGTGAAGG - Intergenic
1107339257 13:39388689-39388711 CATTAGGATGCACAGTGTTGTGG + Intronic
1108698196 13:52921230-52921252 CACCTTCATTCTCAGTGTTGGGG + Intergenic
1110363231 13:74652114-74652136 CATTTGAATGCACACTGTTGAGG - Intergenic
1110909735 13:80942430-80942452 CAGCTGTATATACACTGTTGAGG + Intergenic
1112199639 13:97262186-97262208 CTGCTGCAAGAACAGTGTGGCGG - Intronic
1113315987 13:109179364-109179386 CATGGGCATGCACAGTATTGTGG - Intronic
1115953764 14:38752593-38752615 CATCTGGGAGCACAGTGTTGAGG + Intergenic
1118116022 14:62777803-62777825 CAGCTGAGTGCACACTGGTGTGG - Intronic
1122318225 14:100838009-100838031 CACCTGCAAACACAGTGATGTGG + Intergenic
1122600158 14:102917364-102917386 CAGCTGCAGCCACAGTGAGGAGG - Intergenic
1202902197 14_GL000194v1_random:50399-50421 CAGCTGCCCGCTCCGTGTTGGGG - Intergenic
1128469216 15:67937905-67937927 AAGCTCCATTCTCAGTGTTGGGG + Intergenic
1129758253 15:78111658-78111680 CATCTGTCTGCACAGTGATGTGG - Intronic
1129974777 15:79813034-79813056 CAGCTTCATGTGGAGTGTTGGGG + Intergenic
1130065835 15:80604379-80604401 CTGCTCCATGAACAGTGCTGGGG + Intergenic
1131344451 15:91633072-91633094 CAGCTGAATGCACACTGGTGTGG + Intergenic
1131374169 15:91909908-91909930 CAGCTGTTTCCACAGTGCTGGGG - Intronic
1131775038 15:95785530-95785552 CCTCTGCAAGCACAGGGTTGGGG + Intergenic
1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG + Intronic
1133039742 16:3054187-3054209 CAGATGCATGCACAGAGTCAGGG + Intronic
1133039759 16:3054295-3054317 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039765 16:3054327-3054349 CAGATGCATGCACAGAGGTGGGG + Intronic
1133039801 16:3054563-3054585 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039817 16:3054667-3054689 CAGATGCATGCACAGAGGTGGGG + Intronic
1133039823 16:3054699-3054721 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039834 16:3054767-3054789 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039840 16:3054799-3054821 CAGATGCATGCACAGAGGCGGGG + Intronic
1133654539 16:7847710-7847732 GAGATCCATCCACAGTGTTGTGG - Intergenic
1136346574 16:29679652-29679674 GAGCTGTATGCAAACTGTTGGGG + Intronic
1137903638 16:52296378-52296400 CAGCTCCATGCAAAGCGTTCAGG + Intergenic
1141089452 16:81120275-81120297 CAGCTGCAGGCAGACTGTGGAGG + Intergenic
1142026401 16:87816417-87816439 AAGCTGCAGGCAAAGTGTTGGGG + Intergenic
1142264021 16:89055373-89055395 CAGCTGCCCACACAGGGTTGGGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142767001 17:2070454-2070476 CAGATGCAGGCACAGGGCTGGGG + Intronic
1143510531 17:7393166-7393188 CAGCTGCAGCCACAGTGCAGCGG + Exonic
1144272499 17:13631583-13631605 CAACTGCAAGCACAGTGGAGTGG - Intergenic
1144409559 17:14987357-14987379 CAGCTTCATGCACAATATTCTGG + Intergenic
1144522974 17:15966689-15966711 CAGCTCCGTACACAGTGGTGGGG + Intronic
1145942094 17:28747890-28747912 CCGCTGCATCCACAGTGAGGAGG + Exonic
1147186178 17:38714285-38714307 CAGCTGCAGAGACAGTGCTGTGG - Intronic
1147669822 17:42170547-42170569 CTGCTGTATACAAAGTGTTGGGG + Intronic
1147993523 17:44349436-44349458 CAGATGCCTGCTCAGTGTTGTGG - Exonic
1148119802 17:45201750-45201772 CAACTGCATGCCCAGTGCCGAGG - Intergenic
1149687774 17:58547364-58547386 CATCTTCATTCACTGTGTTGGGG - Intergenic
1150036782 17:61809888-61809910 CAGCTTCATCCCCAGTATTGTGG - Intronic
1150305045 17:64077610-64077632 AAGCGGCATGCACGGTGATGAGG - Intronic
1151534858 17:74733087-74733109 CAGGTGTTTGCACAGTGATGTGG + Intronic
1152936102 17:83137708-83137730 CAGCCACATGCACGGTGCTGGGG + Intergenic
1153646212 18:7198303-7198325 CAGCTGCTTGCTCAGTGGTATGG + Intergenic
1153800267 18:8662499-8662521 CAGCTGTATGCAAAGTGCAGAGG + Intergenic
1156705432 18:39875772-39875794 AAGCTGCATGCAAAATGTGGAGG - Intergenic
1158083907 18:53626872-53626894 CAGCAGCCTAAACAGTGTTGGGG + Intergenic
1161170672 19:2810936-2810958 CAGCTGCAGGCCCAGGGTCGGGG + Intronic
1161932266 19:7348941-7348963 CACCTGCATGCGCAGGGCTGAGG + Exonic
1165086147 19:33348890-33348912 CAGCACCAGGCACAGTGCTGCGG - Intergenic
1165422510 19:35729254-35729276 CAGCAGCATGCACATTCTTGAGG - Exonic
1166409391 19:42546730-42546752 CACCTCCATGTACAGGGTTGGGG + Intronic
1167745786 19:51351122-51351144 CAGCTGCATGAACAGGGTCTGGG + Intronic
924985196 2:264238-264260 CGGCTCCAAGCACGGTGTTGGGG + Intronic
926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG + Intronic
927429368 2:23014013-23014035 CTGCTGCACACACAGGGTTGGGG + Intergenic
931098415 2:58968321-58968343 TTGCAGCATGCACAGTATTGAGG + Intergenic
931796992 2:65720873-65720895 CAGCTGCTTGGACAGAGTTTAGG + Intergenic
936734138 2:115419750-115419772 AAGCAGCATACACAGTTTTGGGG - Intronic
937090704 2:119204587-119204609 CAGCTGCACGCACAGAGTGGTGG + Intergenic
937446489 2:121962889-121962911 CATCTGCAAGCTCAGTGCTGTGG - Intergenic
937650518 2:124313881-124313903 CATCTGCAAGTACAGTTTTGGGG - Intronic
937904295 2:127045411-127045433 CAGCAGCAGGGCCAGTGTTGGGG + Intergenic
938843015 2:135181215-135181237 CAGCAGCTTGCATAGTGATGGGG + Intronic
939393185 2:141594318-141594340 CATCTGCCTTCCCAGTGTTGTGG - Intronic
940419610 2:153464284-153464306 CACCTGGAGGCACAGTGATGGGG - Intergenic
940581288 2:155584147-155584169 GGGCTGCATCCACAGTGCTGAGG + Intergenic
942314969 2:174689790-174689812 GATCTGCATGGACAGCGTTGTGG - Intergenic
946332786 2:219019618-219019640 CAGCTCCATGGGCAGTGCTGAGG - Exonic
948176760 2:235949737-235949759 CAGCTGCATAAACAGCCTTGGGG + Intronic
1169026945 20:2379641-2379663 CAGCAGCCTGCAGGGTGTTGAGG + Intergenic
1173729345 20:45317695-45317717 CAGGTGCCTGGACAGTGATGAGG + Exonic
1174141510 20:48417420-48417442 CAGGTACATGCACAGTGTATGGG + Intergenic
1175259677 20:57666652-57666674 CAGCTTCATGGACTGCGTTGGGG - Intronic
1176621565 21:9065166-9065188 CAGCTGCCCGCTCCGTGTTGGGG - Intergenic
1177755140 21:25337230-25337252 CAGCTGGTTTCAGAGTGTTGGGG + Intergenic
1178437917 21:32575774-32575796 CAGCTGCATGGACAGAACTGGGG + Intergenic
1179383976 21:40924735-40924757 CAGCTTCAGGCACAGGGTTGGGG + Intergenic
1181003683 22:19999538-19999560 CACCTGCAGGCACAGGGGTGGGG + Intronic
1181747940 22:24968665-24968687 CAGCTCCATGCACACAGTGGGGG - Intronic
1182199774 22:28556437-28556459 TATCTGCATGCATAGTGTGGAGG - Intronic
1182872894 22:33664192-33664214 CATCTCCTTCCACAGTGTTGTGG - Intronic
1184715830 22:46281273-46281295 CAGCTGTATGCAGAATGCTGTGG + Intronic
1184799745 22:46752244-46752266 GAGATGCCTGCACAGTGTTCTGG - Intergenic
1184909038 22:47513778-47513800 CAGTTGCATGCACAGGTTTCAGG + Intergenic
1184952710 22:47855704-47855726 CAGGTTCATTCAAAGTGTTGGGG + Intergenic
1184979743 22:48087002-48087024 CAGACGCATGGACAGTGGTGTGG + Intergenic
950076950 3:10194048-10194070 TGGCTGTTTGCACAGTGTTGTGG + Intronic
953262569 3:41354023-41354045 CAGCTGCATGCAGAGGGCTCTGG - Intronic
954917786 3:54163738-54163760 CAGCTGCAAGGACAGTGAGGAGG + Intronic
957338601 3:78863512-78863534 CAACTGCATGCATGGGGTTGGGG + Intronic
960070091 3:113419907-113419929 CAACACCATGCACAGTATTGTGG - Intronic
962956827 3:140274389-140274411 TAGCTGAATGGACAGAGTTGGGG - Intronic
962971911 3:140408979-140409001 CAGGTACAAGCACAGTGGTGGGG - Intronic
963002259 3:140693058-140693080 CAGCTATATGCAAAGTGCTGTGG - Intronic
965231472 3:166059202-166059224 AATCTGGATGCAAAGTGTTGTGG - Intergenic
967778351 3:193407917-193407939 CAGCTGGATGCACAGTCCTGAGG - Intronic
967989874 3:195122828-195122850 CAGCCCCAGGCACAGTGATGTGG - Intronic
968578244 4:1377829-1377851 CAACTGCCTGCACACTGCTGTGG + Intronic
969038838 4:4277755-4277777 CAGTTGCATCCACAGTGATCAGG + Intronic
969297606 4:6279055-6279077 CAGCTGCAGGCCCAGTGGTGGGG - Intronic
971112818 4:23608016-23608038 CAGCTGTACACACAGTGTTAGGG + Intergenic
973757060 4:54085669-54085691 CAGCTACATGAACAGTTTTTGGG - Intronic
975394870 4:73863201-73863223 CAGCTGTGTGCAGAGTTTTGTGG - Intergenic
983666326 4:170188598-170188620 CAGATGCAAGCTCAGTGATGAGG + Intergenic
983814996 4:172113569-172113591 AAGCAGCATTCACAGTGTTGGGG - Intronic
985362336 4:189189033-189189055 CACATGCATGCGCACTGTTGGGG + Intergenic
988337992 5:29930931-29930953 CAGCTGCATCCAATGCGTTGTGG - Intergenic
989773104 5:45168312-45168334 AAGCAACATACACAGTGTTGAGG + Intergenic
994831058 5:104784689-104784711 CATCTGCATGGACAGTGCTGGGG - Intergenic
996751824 5:126896428-126896450 CAGCTGGATGAATAGAGTTGGGG + Intronic
996840138 5:127838802-127838824 ATGCTGCTTTCACAGTGTTGAGG - Intergenic
997564623 5:134877347-134877369 CAGATGCATTCACAGGGTAGGGG + Intronic
999770190 5:154769812-154769834 CAGCTTCAGTCAAAGTGTTGGGG + Intronic
1001209118 5:169793872-169793894 CAGCTGCATGCACTGATTTCAGG - Intronic
1002292815 5:178211277-178211299 CAGCTGCAGGCCCAGTTGTGGGG + Intronic
1002304421 5:178274801-178274823 CATCTCCAGGCACAGTGCTGTGG - Intronic
1003053229 6:2798287-2798309 CTGCTGCATGCCCGGTGATGTGG + Intergenic
1004159061 6:13197353-13197375 CAGCTCCATGCAAGGTGCTGAGG - Intronic
1004423894 6:15494813-15494835 CAGCAGCCTGCACAGCCTTGTGG + Intronic
1010633735 6:78231344-78231366 CAACTGAATGCAAAGTGTTCTGG - Intergenic
1013286003 6:108682424-108682446 CATCTACATGTAGAGTGTTGTGG + Exonic
1014182514 6:118400747-118400769 CAGATGAATGCACAGTTTTCAGG - Intergenic
1016052140 6:139540739-139540761 CAGCTTCTTGCTAAGTGTTGGGG + Intergenic
1016373142 6:143394720-143394742 CAGCACCAGGCATAGTGTTGGGG - Intergenic
1018900356 6:168048825-168048847 CAGCTGCACGCCCTGTGATGGGG - Intergenic
1018992335 6:168683768-168683790 CAGCTGCCAGCACAGTGATGTGG + Intergenic
1022355952 7:29614591-29614613 CAGCTGCAAACAGAGTGCTGGGG - Intergenic
1022533116 7:31079286-31079308 CAGCTGAAGGCACTGAGTTGGGG + Intronic
1024200446 7:47101256-47101278 CAGGTGCACTCAGAGTGTTGGGG + Intergenic
1024618207 7:51133678-51133700 AAGCTGCATTCACAGTACTGTGG + Intronic
1029608998 7:101616669-101616691 CAGCTGCATGACCAGTGGTCTGG + Intronic
1034064987 7:148127504-148127526 CCGCTGCCTGCACATTTTTGTGG - Intronic
1034724533 7:153323108-153323130 CAGAGCCCTGCACAGTGTTGGGG + Intergenic
1035012421 7:155731261-155731283 CAGCCGCATGGCCAGTGCTGTGG + Intronic
1035292227 7:157846563-157846585 CAGCAGCAGGCAGGGTGTTGGGG - Intronic
1035357555 7:158285633-158285655 CAGCAGCATGCTCTGTGGTGTGG - Intronic
1036404837 8:8445581-8445603 TATCTGCATGCACAGTATTCTGG + Intergenic
1037639409 8:20729272-20729294 CATCAGCATACACATTGTTGGGG - Intergenic
1039921051 8:41895129-41895151 CAGCTGACAGCAGAGTGTTGGGG - Intronic
1043553637 8:81404153-81404175 CAGTAGCATGCAAAATGTTGAGG - Intergenic
1045964290 8:108005853-108005875 CAGATGTATGCACAGGATTGGGG + Intronic
1046289210 8:112135155-112135177 AAGCTGCAAGCACAGAGTGGAGG + Intergenic
1046841890 8:118868243-118868265 CAGTTGCAGGCACAGTCCTGGGG + Intergenic
1048964752 8:139607539-139607561 CAGATGCCTGGACAGTGGTGTGG - Intronic
1052455472 9:28691404-28691426 CAAGTGCATTCACTGTGTTGTGG - Intergenic
1056029952 9:82543039-82543061 CAGCTCGAAGGACAGTGTTGAGG - Intergenic
1060975639 9:127763385-127763407 CTCCTGCAGGCACTGTGTTGGGG - Intronic
1062023499 9:134329976-134329998 CAGCTGCATGGAAGGTGGTGTGG + Intronic
1185532186 X:830834-830856 CAGCTGCTTGCAAAGGTTTGGGG - Intergenic
1186500330 X:10045605-10045627 CAGCTGCTGGCTCAGTTTTGGGG + Intronic
1186946834 X:14577970-14577992 TAGCTTTATGCACAGTGATGAGG + Intronic
1188566872 X:31536598-31536620 CAGCTAAATGCCCAGTGATGAGG - Intronic
1188938447 X:36207085-36207107 CAGCAGAATGCACAGAGTTTAGG - Intergenic
1190213518 X:48466230-48466252 CATCTGTCTGCACAATGTTGGGG - Exonic
1190584398 X:51923790-51923812 CAGCTGTTTGCCCAGAGTTGGGG + Intergenic
1190693362 X:52931087-52931109 AAACTGCATGCACAGTCTTATGG - Intronic
1192941720 X:75920050-75920072 AAGCTGCATCCACAGTGTTGAGG + Intergenic
1193883745 X:86960023-86960045 CAGCAGCAGTGACAGTGTTGTGG + Intergenic
1194046262 X:89007605-89007627 CATCTGCTAGCACAGTGTTTAGG + Intergenic
1195325750 X:103756997-103757019 CAGCTGCAGGCAGAGAGTAGGGG - Intergenic
1197898404 X:131342024-131342046 CAGCTGCAAGCAGAGCTTTGGGG + Intronic
1199690339 X:150304821-150304843 CAGGTGCATGCATGGTGCTGTGG - Intergenic
1199718199 X:150522546-150522568 AAGATGCATGCACAAAGTTGTGG + Intergenic
1199789977 X:151143977-151143999 CAGGTGAATGGACAGTGTTATGG + Intergenic
1200021783 X:153217968-153217990 CAGGTTCATTCAAAGTGTTGGGG - Intergenic
1202369920 Y:24189480-24189502 CAGCCACAAGCACACTGTTGAGG + Intergenic
1202500864 Y:25480637-25480659 CAGCCACAAGCACACTGTTGAGG - Intergenic