ID: 926305555

View in Genome Browser
Species Human (GRCh38)
Location 2:11635352-11635374
Sequence ATGAAGAAGCAGATCGTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926305550_926305555 8 Left 926305550 2:11635321-11635343 CCTGCTCTGCCGGTTCAACCGCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 145
926305552_926305555 -10 Left 926305552 2:11635339-11635361 CCGCTTCAGCGTGATGAAGAAGC 0: 1
1: 0
2: 0
3: 6
4: 129
Right 926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 145
926305549_926305555 11 Left 926305549 2:11635318-11635340 CCTCCTGCTCTGCCGGTTCAACC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 145
926305551_926305555 -1 Left 926305551 2:11635330-11635352 CCGGTTCAACCGCTTCAGCGTGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 145
926305548_926305555 15 Left 926305548 2:11635314-11635336 CCGGCCTCCTGCTCTGCCGGTTC 0: 1
1: 0
2: 1
3: 35
4: 352
Right 926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926305555 Original CRISPR ATGAAGAAGCAGATCGTGGT GGG Exonic
900957909 1:5898970-5898992 ATGTAGAGGCATCTCGTGGTTGG - Intronic
901328043 1:8380925-8380947 CTCAAGAAGCCGAACGTGGTAGG - Intronic
904349804 1:29897831-29897853 ATCAAGACGCAGATAGGGGTTGG - Intergenic
911538248 1:99126384-99126406 ATCAAAAATCAGATCGTTGTAGG + Intergenic
912937420 1:114015735-114015757 ATGAGGAAGCAGATTCTGGGAGG + Intergenic
915216069 1:154341538-154341560 GTCAAGAAGCAGATCCTGGCTGG + Intronic
916475567 1:165165413-165165435 AGCAAGAAGCAGATGGGGGTTGG + Intergenic
917790842 1:178497807-178497829 ATTAATAAGCAGATCGGGGAGGG + Intergenic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
922314248 1:224428070-224428092 ATGGAGAAGGAGATCTTGCTGGG - Intronic
922715853 1:227871338-227871360 TTGAAGAAGCAGAACAAGGTGGG + Intergenic
923447358 1:234084779-234084801 AGGAACAACCAGATCCTGGTTGG - Intronic
923624910 1:235606131-235606153 ATAAACAAGCAGACCGAGGTGGG + Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1067064606 10:43096719-43096741 ATGATGCAGCCAATCGTGGTGGG - Intronic
1069447063 10:68482822-68482844 ATGAAGAAGCTGGACATGGTGGG - Exonic
1070266387 10:74907224-74907246 ATGTCTAAGCAAATCGTGGTGGG - Intronic
1072230707 10:93411894-93411916 CTGAAAAAGCAGATCGGGGGAGG - Intronic
1073591165 10:104758882-104758904 CTGAAGAAGTAGATCCTGTTAGG + Intronic
1074066610 10:110020546-110020568 TGGATGAAGCAGAACGTGGTGGG + Intronic
1075347745 10:121696700-121696722 ATGGAAAAGCAGATCTTGGATGG - Intergenic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1079480316 11:20872941-20872963 AACAAGTAGCAGATAGTGGTTGG + Intronic
1084196727 11:67526947-67526969 AGGAAGGTGCAGAACGTGGTGGG + Intergenic
1085281712 11:75335286-75335308 CAGAAGAAGCAGATCTTGGCCGG + Intronic
1085971373 11:81595402-81595424 ATGAAAATGCAGATCTTGGCTGG + Intergenic
1086847980 11:91775235-91775257 CTGAAGAAGCAGCTCCTGTTTGG - Intergenic
1089524403 11:119087501-119087523 ATGAACAAACAGATCCTGGTGGG + Intronic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1089898328 11:121955063-121955085 ATGATGAAGGAGACTGTGGTTGG + Intergenic
1090849393 11:130558835-130558857 ATGAAGAAATAGGGCGTGGTAGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1093773291 12:23042315-23042337 ATGAAGAGGCAGATTATGGCAGG - Intergenic
1093856427 12:24109568-24109590 ATAAAGAAGCAGGTGATGGTGGG - Intergenic
1096547887 12:52353721-52353743 CTGAAGAAGCAGATGGCAGTGGG + Intergenic
1096764075 12:53868741-53868763 ATGAAGAAGCAGAGCATCGTGGG - Intergenic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1102822342 12:115918417-115918439 ATGATGTAGAAGATGGTGGTGGG - Intergenic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1106743569 13:32674728-32674750 ATGCAGAAGCATATAGAGGTAGG + Intronic
1108468272 13:50740997-50741019 ATGGGGAAGCAGGTGGTGGTAGG - Intronic
1117836923 14:59817375-59817397 TTGAAGAAGCTGATCCAGGTTGG - Intronic
1202933000 14_KI270725v1_random:56571-56593 ATTAAGAAGCAGAACTTGGCCGG + Intergenic
1128075952 15:64825609-64825631 ATGAACAAGCAGATCGTAGCCGG + Exonic
1131132104 15:89906782-89906804 AAGAAGAAGAAGATCATGGAGGG + Intronic
1132629835 16:911801-911823 ATGCAGAGGCAGGTCATGGTGGG + Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1139094174 16:63684668-63684690 ATGAACTAGCACATGGTGGTGGG - Intergenic
1140228066 16:73094605-73094627 ATGTAGAACCAGATCACGGTGGG + Intergenic
1141690633 16:85594292-85594314 ATGGAGAAGCTGACCGCGGTGGG - Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1144067375 17:11636767-11636789 AGGAGGAAGCAGAACTTGGTAGG + Exonic
1149387371 17:56155418-56155440 ATGAAGAGACAGAGCGTGGCTGG - Intronic
1149652115 17:58281944-58281966 ATCCAGGAGCAGATGGTGGTGGG - Intergenic
1150391006 17:64789904-64789926 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1150409788 17:64933958-64933980 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1152846715 17:82604944-82604966 ATGAAAAAGCAGCTCTTGGCCGG + Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153656260 18:7285243-7285265 ATGAAGAAATAGATTGTGGGAGG - Intergenic
1156874814 18:41996675-41996697 ATGAAGAACAAGATCTTGTTTGG + Exonic
1166475206 19:43118491-43118513 ATGAAGATGCAGAGAGTGTTGGG - Intronic
1167210532 19:48131355-48131377 ATGAAGAAGAAAATGATGGTAGG - Intronic
1167213062 19:48145653-48145675 ATGAGGCAGCAGAGTGTGGTGGG + Intronic
926094701 2:10073550-10073572 ATCAAGAAACAGAGCTTGGTGGG + Intronic
926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG + Exonic
926751973 2:16205072-16205094 AAGAAGAAGCAGCTCCTGGGAGG - Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
931181037 2:59900931-59900953 ACAAAGAAGCAGATTGTGTTTGG - Intergenic
933737210 2:85504717-85504739 AGGAAAAAGCAGATGGTGGGGGG - Intergenic
936044828 2:109179358-109179380 ATGAAAAAGCAGAACGTGAGAGG + Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939892055 2:147747945-147747967 ATGAATAATCTGATTGTGGTGGG - Intergenic
944000494 2:194830378-194830400 ATGAAAAATCAGACCATGGTTGG - Intergenic
947164849 2:227251426-227251448 ATGAAGAAGCAGACCAGGTTTGG - Intronic
948163805 2:235845605-235845627 ATTAAAAAGCAGATCGGGGGGGG - Intronic
1169551459 20:6705691-6705713 ATGAGGAAGCAGATACTGGTTGG - Intergenic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1174107303 20:48171864-48171886 ATGAAGAAACAGCTGGTGGCTGG - Intergenic
1177143874 21:17386605-17386627 AGGAAGAAGCATATCAAGGTTGG - Intergenic
1177197425 21:17918113-17918135 ATGAAGAGGCTGATACTGGTGGG + Intronic
1178053032 21:28768603-28768625 AGGAAGAGGCAGATCCTCGTCGG + Intergenic
1179671838 21:42954750-42954772 ATTAAGAACAATATCGTGGTGGG - Intergenic
1183072711 22:35407470-35407492 AGCCAGGAGCAGATCGTGGTGGG - Intronic
951796544 3:26545086-26545108 GTGAAGAAAAAGATCCTGGTTGG + Intergenic
956726510 3:72160947-72160969 GAGAATAAGCAGATCGTGGAAGG + Intergenic
959556669 3:107727414-107727436 ATCAAAAAGCAGAACGTGTTAGG - Intronic
961077690 3:123997148-123997170 ATAAAGAGGCATATTGTGGTAGG - Intergenic
964370062 3:155991011-155991033 TTGAAGAGGCAGATGGTGGTTGG + Intergenic
967549634 3:190775595-190775617 ATGAAGGAGCAGACGGAGGTGGG - Intergenic
975423094 4:74192185-74192207 AGGAAGAAGTAGATCATGGTAGG + Intronic
975974750 4:80081885-80081907 AGGAAGAAGCAGCTCGTGACTGG + Intronic
976892801 4:90070842-90070864 ATGAACTAGCATATAGTGGTTGG - Intergenic
978045222 4:104117208-104117230 ATGAAGTAGCAAATGGTGTTTGG - Intergenic
978723615 4:111944534-111944556 ATGCAGATGCTGATTGTGGTTGG - Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
988371883 5:30380501-30380523 ATGAAGAAGCCGATCTAGATTGG + Intergenic
989540411 5:42611432-42611454 ATGAACAAAGAGATAGTGGTGGG - Intronic
989993306 5:50795381-50795403 ATGAAGATGAAGATGGTGTTAGG - Exonic
990846305 5:60143873-60143895 ATCAAGAAGGAGAGCTTGGTGGG + Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992896897 5:81253438-81253460 ATGCAGAAGCACAGGGTGGTCGG + Intronic
994430914 5:99660152-99660174 ATGAAGGAGTAGATGGGGGTAGG - Intergenic
995955954 5:117776440-117776462 ATTAAGAAACAGATGGTGTTTGG - Intergenic
996264054 5:121513321-121513343 ATGAAGAAGCTTATCTTGGCTGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997590303 5:135068162-135068184 ATGAAGAAGCAGATCAGGCCAGG - Intronic
998147740 5:139739843-139739865 ATGAAGAAACAGGTCCTGGGAGG + Intergenic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1004179103 6:13365503-13365525 ATGAAGCAGCTGATCGAGGAGGG - Exonic
1004185711 6:13419632-13419654 AGGAGGAAGCAGATCGTGGAGGG - Intronic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1010030875 6:71269419-71269441 ATGAAGGAGAAGGTCCTGGTGGG + Intergenic
1012887387 6:104860919-104860941 ATGAAGGGGCAGATGGTGGTTGG + Intergenic
1013979090 6:116108841-116108863 ATGAAGAAAGAGAGGGTGGTGGG - Intronic
1014666412 6:124243192-124243214 ATGAAGAGGAAGATGTTGGTTGG + Intronic
1016779582 6:147943415-147943437 TTCAAGAAGCAGATTGGGGTGGG - Intergenic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1024237885 7:47411761-47411783 ATGACGATGCAGATCCTGCTGGG + Exonic
1024954162 7:54898736-54898758 CTGGAGAAGCAGGTCGTGCTCGG - Intergenic
1026237470 7:68539963-68539985 ATGAATGAACAGATTGTGGTAGG - Intergenic
1026447751 7:70500324-70500346 ATGAACCAGCAGCTTGTGGTGGG + Intronic
1027244831 7:76359570-76359592 ATCACGTAGCAGGTCGTGGTGGG + Intergenic
1027978093 7:85184931-85184953 ATGAGCAAGAAGATCGGGGTTGG - Intronic
1031850263 7:126854549-126854571 ATGTAGAAGCAGCTGGTGCTGGG + Intronic
1033611303 7:142965522-142965544 ATGGAGAAACAGATCATGGGGGG + Intergenic
1034512885 7:151550752-151550774 AGGAAGAAGCACTTGGTGGTTGG + Intergenic
1038735076 8:30161412-30161434 ATGAAGAAGTACTTGGTGGTGGG - Intronic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1041058858 8:54016540-54016562 ATGAATAAGCAAATCGTGGTTGG + Intronic
1042002796 8:64145221-64145243 GTGAAGAAGAAGATCGTTGGAGG - Intergenic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1043251823 8:78084297-78084319 ATGAAGAAGCTGTTTGTTGTGGG - Intergenic
1048145653 8:131840054-131840076 ATGAAGAAACAGAACATGATTGG - Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048941458 8:139404111-139404133 ATAAAGATGCAGAACATGGTGGG - Intergenic
1049148560 8:141019773-141019795 ATAAAGAAGGAGATCATGGGGGG - Intergenic
1051017774 9:12501627-12501649 ATGAAGAAACAGTATGTGGTGGG + Intergenic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1053133069 9:35629766-35629788 ATGTAGCAGCAGAGCATGGTGGG - Intronic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061242969 9:129384896-129384918 AGGATGAAGCAGAGCGCGGTGGG + Intergenic
1061437205 9:130571847-130571869 AAAAATTAGCAGATCGTGGTGGG - Intergenic
1061772029 9:132932657-132932679 ATGAAGAGGCAGAGGGGGGTTGG - Intronic
1186184796 X:7010281-7010303 ATGAAGATGCAGAGAGTGTTGGG - Intergenic
1186214432 X:7283747-7283769 CTGAAGTGGCAGATGGTGGTGGG + Intronic
1186387726 X:9126996-9127018 CTGAAGAACCAGGTCATGGTTGG - Intronic
1186729255 X:12391184-12391206 ATGAATAAGGAGATGGGGGTGGG - Intronic
1187684870 X:21805868-21805890 ATGAAGAAGGAGTGCATGGTGGG + Intergenic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1201994846 Y:20074578-20074600 ATGAAGCTGCAGACCTTGGTGGG - Intergenic
1201999870 Y:20141303-20141325 ATGAAGCTGCAGACCTTGGTGGG + Intergenic