ID: 926306054

View in Genome Browser
Species Human (GRCh38)
Location 2:11637895-11637917
Sequence TTACCTGAACCTGGGATCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 236}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926306049_926306054 1 Left 926306049 2:11637871-11637893 CCACCCAGTGCTGTCTGTCGACT 0: 1
1: 0
2: 0
3: 5
4: 115
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
926306046_926306054 17 Left 926306046 2:11637855-11637877 CCCTGAAGAACCATGACCACCCA 0: 1
1: 0
2: 0
3: 13
4: 134
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
926306044_926306054 25 Left 926306044 2:11637847-11637869 CCCGCTGTCCCTGAAGAACCATG 0: 1
1: 1
2: 1
3: 15
4: 221
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
926306048_926306054 7 Left 926306048 2:11637865-11637887 CCATGACCACCCAGTGCTGTCTG 0: 1
1: 0
2: 4
3: 15
4: 292
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
926306047_926306054 16 Left 926306047 2:11637856-11637878 CCTGAAGAACCATGACCACCCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
926306051_926306054 -3 Left 926306051 2:11637875-11637897 CCAGTGCTGTCTGTCGACTGTTA 0: 1
1: 0
2: 1
3: 9
4: 73
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
926306045_926306054 24 Left 926306045 2:11637848-11637870 CCGCTGTCCCTGAAGAACCATGA 0: 1
1: 0
2: 1
3: 12
4: 331
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
926306050_926306054 -2 Left 926306050 2:11637874-11637896 CCCAGTGCTGTCTGTCGACTGTT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926306054 Original CRISPR TTACCTGAACCTGGGATCTC AGG Exonic
900298823 1:1966402-1966424 TTAGCTGAGCCCGAGATCTCTGG - Exonic
900353318 1:2247699-2247721 TTTCCTGAACCTAGGAGCCCAGG + Intronic
903270218 1:22183505-22183527 TTCCATGTAGCTGGGATCTCAGG + Intergenic
903937350 1:26905633-26905655 TTACCAGAGACTGGGAACTCGGG - Intronic
906697509 1:47833256-47833278 TTACCTGACCCTGGGCTCTTAGG + Intronic
909604820 1:77497670-77497692 TCACCTGAACTTGGGAAGTCGGG - Intronic
910457661 1:87414490-87414512 TTACCTGAAGCTAGGAGTTCAGG + Intergenic
912515287 1:110212996-110213018 TAACCTGAACCAGGGCTTTCTGG - Intronic
914434534 1:147648278-147648300 TTACCAGCACCTGGAATCTAAGG - Exonic
915428047 1:155843496-155843518 TTACCTGGACCTAGGATGTTGGG + Intronic
916124059 1:161553597-161553619 TTATCTTAACCTAGGATCTCTGG - Intergenic
916133942 1:161634959-161634981 TTATCTTAACCTAGGATCTCTGG - Intronic
917204800 1:172561238-172561260 TTACCTGGACCTGGGAAGTTGGG - Intronic
917239894 1:172936760-172936782 TTACCTGGACCTGAGACATCTGG - Intergenic
919581919 1:199387126-199387148 TTGCCTGAACCTGGGGTCCAAGG - Intergenic
919914675 1:202132217-202132239 TTTCCTGGGCCTGGGATCCCGGG - Exonic
919951262 1:202365903-202365925 TTACCTGAGCCTGGGAGTTTCGG + Intronic
921145537 1:212352532-212352554 TCACCTGAGCCTGGGAGGTCAGG - Intronic
922490922 1:226015811-226015833 TCACCTGAGCCTGGGAGATCAGG + Intergenic
1063442523 10:6084443-6084465 TTGCTTGAGCCTGGGATTTCGGG + Intergenic
1064095777 10:12423607-12423629 TTCCCTGTACCTGGGAGTTCTGG - Intronic
1065643257 10:27806346-27806368 TTACTTGAGCCTGGGAGGTCAGG + Intergenic
1066692056 10:38039305-38039327 TTGCCTGAGCCTGGGAAGTCAGG - Intronic
1067000652 10:42609332-42609354 TTGCCTGAGCCTGGGAAGTCAGG + Intronic
1069098923 10:64293844-64293866 TCACCTGAACCTGGGAGGTGAGG - Intergenic
1069810526 10:71156014-71156036 TTACCTGAATCTGCCATTTCTGG - Intergenic
1070004268 10:72407750-72407772 TTCACTGAACTTGGCATCTCAGG + Intronic
1070125575 10:73618825-73618847 TTGCTTGAACCTGGGAGCACAGG + Intronic
1070517441 10:77221318-77221340 TTAGCTTAACCTGGGATCCAAGG + Intronic
1072203561 10:93182261-93182283 TTACCTTAACCATGGATATCAGG - Intergenic
1073113989 10:101080688-101080710 TCACCTGAGCCTGGGAAGTCGGG - Intergenic
1074736369 10:116438350-116438372 TTACCTGAATCTGTAACCTCAGG + Intronic
1076244440 10:128935401-128935423 TTGCCTGAACCTGGCATTTAAGG - Intergenic
1079927112 11:26507864-26507886 ATATCTGAACATGGGTTCTCTGG - Intronic
1080978247 11:37367970-37367992 TTTTATGAACCTGGGATTTCTGG - Intergenic
1082716739 11:56623243-56623265 TTACATGAACTTGTGATCTATGG + Intergenic
1083806276 11:65076198-65076220 TCACCTGAGCCTGGGAGGTCGGG - Intronic
1083848120 11:65348358-65348380 TTGCTTGAGCCTGGGATTTCAGG + Intronic
1084185365 11:67468413-67468435 TGCCTTGAACCTGGGAACTCTGG - Intronic
1084571220 11:69961107-69961129 TTACATAATCCTGGGATCTGAGG - Intergenic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1085099806 11:73790968-73790990 TCACCTGAGCCCGGGATATCGGG - Intronic
1085696248 11:78707232-78707254 TTACCAAAACCTGGGAAATCAGG - Intronic
1087077824 11:94142045-94142067 TTTCCAGAGCCTGGGTTCTCAGG + Intronic
1088014432 11:105041434-105041456 TTACCTAAACCTGGGATTCTAGG + Exonic
1089348725 11:117809176-117809198 TCTCCTGAGCCTGGGGTCTCAGG - Intronic
1092149880 12:6240523-6240545 TCACCTGAGCCTGGGAGGTCAGG + Intergenic
1096014132 12:48252202-48252224 TCACCTGCACCTGGCATCACGGG - Intergenic
1096047934 12:48580775-48580797 ATACATGAACCTGGGAACCCAGG + Intergenic
1096146568 12:49282892-49282914 TTGCCTGAGCCTGGGAGTTCAGG - Intergenic
1101801198 12:108023266-108023288 TTACATGAACCTGTGTGCTCTGG - Intergenic
1102357897 12:112255235-112255257 TCACCTGAACCTGGGAAATGGGG + Intronic
1102377560 12:112435101-112435123 TTGCCTGAGCCTGGGACGTCGGG - Intronic
1102401255 12:112631605-112631627 TCACTTGAACCTGGGAGGTCAGG - Intronic
1102655546 12:114479924-114479946 CTACCTGAATCTGCGACCTCAGG - Intergenic
1107114110 13:36727960-36727982 TTACCAGAACCTGGGAGCAGAGG + Intergenic
1107771496 13:43791903-43791925 TTACCTTTCCCTGGGATCACTGG + Intergenic
1108014064 13:46054833-46054855 TTACTTGAACCTGGGAGGTGGGG - Intronic
1108173133 13:47764437-47764459 TTACCTGAACGTATAATCTCAGG + Intergenic
1110602842 13:77395688-77395710 TTACCTGAACCCAGGAGGTCGGG + Intergenic
1111229180 13:85318522-85318544 TTACTTGTACCTGGGATTACAGG - Intergenic
1111293246 13:86195287-86195309 TCACTTGAACCTGGGACCACAGG + Intergenic
1113797999 13:113069899-113069921 GCACCTAAACCTGGGATCTGCGG - Intronic
1113884744 13:113652564-113652586 TTACCTGGCCCTGGCATCTCTGG + Intronic
1114043123 14:18697806-18697828 TGACCAGAACCTGGGTTCTAGGG - Intergenic
1114047415 14:18888246-18888268 TGACCAGAACCTGGGTTCTAGGG - Intergenic
1114116799 14:19631155-19631177 TGACCAGAACCTGGGTTCTAGGG + Intergenic
1114158401 14:20133604-20133626 TCACCTGAGCCTGGGAAGTCAGG - Intergenic
1114832576 14:26163154-26163176 TCACCTGATCCTGGGAGGTCAGG - Intergenic
1117362970 14:54996513-54996535 TCACCTGAACCTGGAAGGTCAGG + Intronic
1118580093 14:67287132-67287154 TCACTTGAGCCTGGGAGCTCAGG + Intronic
1119743823 14:77030382-77030404 TTACTTGAGCCTGGGAGGTCAGG - Intergenic
1202830740 14_GL000009v2_random:26719-26741 TTACTTGAACCTGGGAGGCCGGG + Intergenic
1124200319 15:27673709-27673731 TTGCCTGAACCTGGGAGGTTGGG - Intergenic
1130193529 15:81758575-81758597 TTACCTGAACCTGGCAGCGAAGG + Intergenic
1130521109 15:84661191-84661213 TCACTTGAACCTGGGAGGTCAGG + Intergenic
1130895336 15:88166119-88166141 AGACCTGACCCTGGGAGCTCTGG + Intronic
1131030174 15:89179839-89179861 TTACCTGAACCAAGGAGGTCAGG - Intronic
1132800137 16:1747964-1747986 TTGCTTGGACGTGGGATCTCTGG + Intronic
1133681187 16:8121655-8121677 TCGCCTGAACCTGGGAACCCAGG - Intergenic
1134137213 16:11685264-11685286 TCACCTGAACCTGGGAGGTTGGG + Intronic
1138428453 16:56951944-56951966 TTACTTGAACCTGGGAGCCAGGG - Intergenic
1139382216 16:66539797-66539819 TGGCCTGAACCTGGGAGTTCAGG + Intronic
1140689865 16:77471510-77471532 GTACCTGAAGCTGGTATCTGAGG - Intergenic
1141558940 16:84854011-84854033 TTTCCTGCCCCTGGGAACTCCGG + Intronic
1142499329 17:323580-323602 TTCCCTGAACCTGGGGGCCCTGG - Intronic
1143448356 17:7021846-7021868 GGACCTGAGCCTGGGAACTCCGG - Intergenic
1144469900 17:15529365-15529387 TTGCTTGAACCTGGGAGCTGGGG + Intronic
1144843593 17:18203980-18204002 TTCCCTGAACATGGGCTCCCTGG + Intronic
1145268390 17:21391535-21391557 TTGTCTGAACCTGTGCTCTCTGG + Intronic
1145806008 17:27730729-27730751 TGACCAGAACCTGGGTTCTCAGG + Intergenic
1145861856 17:28217754-28217776 TCACCTGAGCCTGGGAGGTCAGG - Intergenic
1146176885 17:30670827-30670849 TTACCTGAACTCAGGATCTTAGG + Intergenic
1146350349 17:32086927-32086949 TTACCTGAACTCAGGATCTTAGG + Intergenic
1146874858 17:36401203-36401225 TGACCAGAACCTGGGTTCTAGGG + Intronic
1146960558 17:36972361-36972383 CAACCAGAACCTGGAATCTCAGG - Intronic
1147064529 17:37911676-37911698 TGACCAGAACCTGGGTTCTAGGG - Intergenic
1147408068 17:40227880-40227902 TTATATGTACCTGGTATCTCTGG - Intronic
1147619995 17:41859662-41859684 TTGCCTGAACCTGGGGTCAGAGG + Intronic
1148491472 17:48026347-48026369 TCTCCTGACCCTGGGATCTTTGG + Exonic
1149971910 17:61227335-61227357 TTACCTTAATCTGGGATCCAGGG - Intronic
1152111442 17:78359600-78359622 TTCCGGGAACCTGGGATCTCCGG + Intronic
1152444299 17:80332124-80332146 TTTCTTGGACCTGGGAGCTCAGG - Exonic
1155687687 18:28575551-28575573 TTCACTTAACCTGGGATTTCAGG + Intergenic
1156001263 18:32387104-32387126 TTACCTAAAGCTGGTGTCTCGGG - Intronic
1156359304 18:36370148-36370170 TACTCTGAACCTGGGATCTGGGG + Intronic
1158295864 18:55996361-55996383 TTCCCTGACCCTGTCATCTCAGG + Intergenic
1159183738 18:64944103-64944125 TTATCTGGACCTGGGAAGTCGGG - Intergenic
1160048913 18:75413384-75413406 CTACCTGAACCAGTGGTCTCTGG + Intronic
1160576912 18:79861360-79861382 TTGCCTGAACCTGGGAACGGAGG - Intergenic
1161261294 19:3339198-3339220 TTGCTTGAACCTGGGAGCTGAGG - Intergenic
1161470463 19:4454505-4454527 TTCCTTGAGCCTGGGAGCTCAGG - Intronic
1161638287 19:5403136-5403158 TCACCTGAGCCTGGGAACTGAGG - Intergenic
1162640144 19:12002074-12002096 TTGCCTGAACCTGGGAGCAGAGG + Intergenic
1163095967 19:15057295-15057317 AAATCTGAACCTGGGATCTGAGG - Exonic
1163560053 19:18013749-18013771 TACCCTGAACCTGGGTTCCCTGG - Exonic
1163838587 19:19591943-19591965 TCACTTGAACCTGGGATGTGAGG - Intronic
1164643194 19:29841292-29841314 TTCCCTGAGCCTGTGCTCTCTGG - Intergenic
1165527151 19:36365873-36365895 TCACCTGAGCCTGGGAGGTCGGG + Intronic
1167097242 19:47381010-47381032 TTCCCTGAAGGTGGGATTTCAGG + Intronic
1167490126 19:49788029-49788051 TCACCTGAGCCTGGGAGGTCAGG - Intronic
1168425161 19:56234280-56234302 TGACCTGAACCGGGGAGCCCAGG - Intronic
1168473322 19:56658573-56658595 TCACCTGAACCCGGGAGGTCGGG + Intergenic
1168488075 19:56781953-56781975 TTACCGGAACCTGGTCTCCCTGG - Exonic
1202641953 1_KI270706v1_random:101057-101079 TTACTTGAACCTGGGAGGCCGGG - Intergenic
925332504 2:3069688-3069710 TTTCCTGAGCCTGTGGTCTCTGG + Intergenic
926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG + Exonic
926813321 2:16775757-16775779 TTTCCTCATCCTGGGACCTCAGG - Intergenic
927613292 2:24563946-24563968 TTACCTGAAACTGGATACTCAGG + Intronic
928272786 2:29872059-29872081 TTTCCTGAAGCTTGGATCTGTGG - Intronic
928531074 2:32191806-32191828 TTACTTGAGCCTGGGAGTTCAGG + Intronic
929234209 2:39589285-39589307 TTGCTTGAACCTGGGAGGTCAGG + Intergenic
931274546 2:60733124-60733146 TCACTTGAACCTGGGATGTGGGG + Intergenic
932341739 2:70966841-70966863 TTACTTGAGCCTGGGAGGTCAGG + Intronic
934746752 2:96764330-96764352 TAAACTGAACCTGGGGACTCTGG - Intronic
937373527 2:121319392-121319414 TTGTCTGAGCCTGGGGTCTCTGG + Intergenic
938424792 2:131176784-131176806 TGACCAGAACCTGGGTTCTAGGG - Intronic
939971916 2:148671527-148671549 TTGCCTGAACCTGGGAGGTGGGG + Intronic
940159786 2:150698974-150698996 TTAACTGACTCTGGAATCTCTGG + Intergenic
940282467 2:152001778-152001800 TTACATGAGTCTGGGATGTCAGG + Intronic
941413438 2:165188662-165188684 GTACCTGTACCTGGGATTACAGG - Intronic
947329658 2:229015326-229015348 CAACCTGAACCTGGAATTTCAGG + Intronic
947977746 2:234382110-234382132 TTGCTTGAACCTGGGAGTTCAGG - Intergenic
1171145582 20:22778650-22778672 TTTCCTGAACCTTGGTTCCCAGG + Intergenic
1171889063 20:30691247-30691269 TTACTTGAACCTGGGAGGCCGGG - Intergenic
1173209427 20:41020578-41020600 TTACTTGAACCTGGGAGGTGAGG + Intergenic
1173829309 20:46070206-46070228 GTACCTGTACATAGGATCTCGGG + Exonic
1173938213 20:46887176-46887198 TCACTTGAACCTGGGAGCCCGGG + Intergenic
1174243708 20:49159643-49159665 TCACCTGAACCTGGGAGGTGGGG - Intronic
1174797283 20:53532773-53532795 TTACCAGAGCCAGGGATTTCAGG - Intergenic
1175681885 20:60995125-60995147 TTCCCTGAAGCTGGGTTCCCTGG - Intergenic
1176609928 21:8871557-8871579 TTACTTGAACCTGGGAGGCCGGG + Intergenic
1180359993 22:11880807-11880829 TTACTTGAACCTGGGAGGCCGGG + Intergenic
1180465948 22:15610901-15610923 TGACCAGAACCTGGGTTCTAGGG - Intergenic
1180986882 22:19910174-19910196 CTGCCTGGACCTGGGACCTCGGG + Intronic
1182318165 22:29461582-29461604 TTACTTGAGCCTGGGAGGTCAGG - Intergenic
1183416825 22:37687293-37687315 TTGCCTGAACCTGAGATCCCTGG + Intronic
1183551488 22:38489450-38489472 TTACCCGAACCCAGGTTCTCCGG - Intronic
1184052956 22:42022338-42022360 TTACCTGAACAAGGCATCTGTGG - Exonic
954945183 3:54417869-54417891 TCACCTGAGCCTGGGAGGTCCGG - Intronic
957374718 3:79340842-79340864 TAGCCTGAACCTGGTATTTCTGG + Intronic
958967827 3:100578605-100578627 TTACATGAAGCTGGCATCACTGG + Intergenic
959579236 3:107967236-107967258 TGCCCTCAACCTGGGACCTCTGG - Intergenic
959701911 3:109306886-109306908 TTGCTTGAACCTGTGACCTCAGG + Intronic
961461604 3:127053585-127053607 TTGCCTGCAGCTGGGAACTCTGG - Intergenic
962351945 3:134662922-134662944 ATTCCTGACCCTGGGCTCTCTGG + Intronic
962592613 3:136906527-136906549 TTACCTGAACCTGCTAACACTGG - Intronic
963197908 3:142554310-142554332 TCACTTGAACCTGGGAGGTCAGG - Intronic
966256660 3:177924960-177924982 TGACCCGAACCTGGGCCCTCTGG - Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967046267 3:185739938-185739960 TCACCTGAACTTGGGAAGTCAGG - Intronic
967048278 3:185757547-185757569 TCACCTGAACCCGGGAAGTCAGG - Intronic
1202736612 3_GL000221v1_random:6346-6368 TTACTTGAACCTGGGAGGCCGGG + Intergenic
968875570 4:3265761-3265783 TCACCTGAGTCTGGGATGTCAGG + Intronic
970019958 4:11557122-11557144 TTACCTGCACCTGGAATTTCAGG + Intergenic
971237277 4:24854136-24854158 TTTCCTGAACCTGGGATTCCTGG + Intronic
973812151 4:54581774-54581796 TTGCCTGAACCTGGGAGGTGGGG + Intergenic
974853601 4:67432745-67432767 TTACCTGAACCAGAAACCTCTGG + Intergenic
974877116 4:67714434-67714456 TTCCCTGAGCCTGGGAGCACAGG + Intergenic
977089648 4:92654168-92654190 TTTCCTTAACCTTGGATTTCTGG - Intronic
979912783 4:126390711-126390733 ATACCTAAAACTGGGATTTCCGG + Intergenic
984378896 4:178965408-178965430 TTACCGAAACATGAGATCTCTGG - Intergenic
984459821 4:180019942-180019964 TTACCTGAATCTGAGATCCTTGG + Intergenic
1202769321 4_GL000008v2_random:186923-186945 TTACTTGAACCTGGGAGGCCGGG - Intergenic
987045734 5:14105976-14105998 ATAACTGAACCTGTGGTCTCTGG + Intergenic
988622424 5:32836526-32836548 ATACCTTAACCTCGGATCTTTGG + Intergenic
993150314 5:84153545-84153567 TTGCTTGAACCTGGGAGGTCAGG - Intronic
995205314 5:109473225-109473247 TTGCTTGAACCTGGGAGGTCAGG - Intergenic
996999034 5:129736563-129736585 TTACCTGGAGCTGTGATTTCAGG - Intronic
1001114172 5:168924923-168924945 TTACCTTATGATGGGATCTCAGG - Intronic
1004307041 6:14510384-14510406 CTGTCTGAACCTGGGATCTAAGG + Intergenic
1005406166 6:25490157-25490179 TTACCTGACCCTGTGCCCTCAGG + Intronic
1013362845 6:109410604-109410626 TTACCTGGACCTGGGAAATTGGG + Intronic
1013467961 6:110434153-110434175 TCACCTGAACCTGGGAGGTAAGG + Intronic
1015010780 6:128344598-128344620 TCACCTGAACCTGGGAGGTCAGG - Intronic
1018312563 6:162525936-162525958 TCACCTGAGCCTGGGAGGTCGGG - Intronic
1018841623 6:167521594-167521616 TTTCCTGAGCCTGTGATCTCTGG - Intergenic
1018871490 6:167787065-167787087 TTAATTGAGCCTGAGATCTCAGG + Intronic
1019611709 7:1940084-1940106 TGACCTGGACCAGGGACCTCCGG + Intronic
1019966442 7:4502791-4502813 TTACTTGAGCCTGGGAGGTCAGG + Intergenic
1020174575 7:5871969-5871991 TTGCTTGAACCCGGGAGCTCTGG - Intergenic
1023476586 7:40585762-40585784 TCACCAGAACCTGGGAGGTCGGG - Intronic
1024472573 7:49778079-49778101 TTTCCTTTACCTGTGATCTCAGG - Intronic
1025070353 7:55892785-55892807 TTACTTGAACCTGGGAGGTGAGG + Intronic
1026429182 7:70326647-70326669 TTACTTGAACCTGGGATCCATGG + Intronic
1026896498 7:74012908-74012930 TGGGCTGGACCTGGGATCTCTGG + Intergenic
1027797385 7:82712050-82712072 TTACCTGGACCTGGGAAGTTGGG - Intergenic
1028018960 7:85747096-85747118 TTTTATGAACCTGGGAGCTCTGG - Intergenic
1029617514 7:101668379-101668401 TTTCCTTCACCTGGAATCTCAGG - Intergenic
1032392332 7:131563606-131563628 TTACCTGAACGTGGGCCCTTGGG + Intergenic
1033732583 7:144194524-144194546 TTAGCTGGAGCTGGGACCTCTGG + Intronic
1033743433 7:144293104-144293126 TTAGCTGGAGCTGGGACCTCTGG + Intergenic
1033750468 7:144356493-144356515 TTAGCTGGAGCTGGGACCTCTGG - Intronic
1034313791 7:150111740-150111762 GTCCCTGAAGCTGGGCTCTCTGG + Intergenic
1034793107 7:153989052-153989074 GTCCCTGAAGCTGGGCTCTCTGG - Intronic
1035131823 7:156661538-156661560 TCACCTGAAGCTGGGAGTTCAGG - Intronic
1037088879 8:14887907-14887929 TTACCAGAAACTGGGATCTGAGG + Intronic
1042418255 8:68552879-68552901 TTACCTCAACCTTGTATTTCAGG + Intronic
1042869806 8:73387887-73387909 TTACCTGAACCTGGTTTATCTGG - Intergenic
1043846923 8:85174213-85174235 TTGCCTGAACCCAGGAACTCAGG - Intergenic
1045884880 8:107084077-107084099 TTAACTTATCCTGGTATCTCTGG - Intergenic
1046036050 8:108842970-108842992 TTCCCTGATCCTTGGATATCTGG + Intergenic
1046431706 8:114135715-114135737 TTTCCTGAAGCTGGCATCTGGGG - Intergenic
1050162648 9:2734282-2734304 TTTCTTGAACCTGGAATCTTTGG - Intronic
1050162651 9:2734313-2734335 TTTCTTGAACCTGGAATCTTTGG - Intronic
1050768063 9:9161017-9161039 TTACCAGAGCCTGGGATATGGGG + Intronic
1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG + Intronic
1051657071 9:19393312-19393334 TCACTTGAACCTGGGAGGTCAGG - Intergenic
1053659359 9:40255952-40255974 TTACTTGAACCTGGGAGGCCGGG + Intronic
1054371486 9:64402254-64402276 TTACTTGAACCTGGGAGGCCGGG + Intronic
1054525239 9:66120264-66120286 TTACTTGAACCTGGGAGGCCGGG - Intronic
1054679107 9:67891969-67891991 TTACTTGAACCTGGGAGGCCGGG + Intronic
1059241866 9:112813060-112813082 TCACCTGAACCTGGGAGGTGTGG + Intronic
1059480583 9:114586429-114586451 TCGCCTGAACCTGGGAGCTGAGG - Intergenic
1061887950 9:133602197-133602219 CTACCTGGGTCTGGGATCTCCGG + Intergenic
1062299591 9:135857889-135857911 CTACCTGCACCTGGGGTCTGAGG + Intronic
1203694209 Un_GL000214v1:80639-80661 TTACTTGAACCTGGGAGGCCGGG - Intergenic
1203705345 Un_KI270742v1:36786-36808 TTACTTGAACCTGGGAGGCCGGG + Intergenic
1203558664 Un_KI270744v1:29019-29041 TTACTTGAACCTGGGAGGCCGGG - Intergenic
1203642064 Un_KI270751v1:23424-23446 TTACTTGAACCTGGGAGGCCGGG + Intergenic
1186450731 X:9671355-9671377 TCACCTGAACCTTGGCGCTCAGG + Intronic
1186770821 X:12816385-12816407 TTACTTGAGCCTGGGAGATCGGG - Intronic
1187419709 X:19123122-19123144 TTCCCAGAAACCGGGATCTCGGG + Intergenic
1189330565 X:40142227-40142249 TTTTCTGAAGCTGGGAGCTCTGG + Intronic
1189685118 X:43555805-43555827 TCACCTGAGCCTGGGAGATCAGG + Intergenic
1192745525 X:73934578-73934600 TTATCTGTACCTGGGACCTGGGG + Intergenic
1193194304 X:78612051-78612073 TTACCTGAGCCTGGGAAGTCGGG - Intergenic
1194662395 X:96641381-96641403 TCACCTAAACCTGGGAGGTCAGG - Intergenic
1195447664 X:104972373-104972395 TTACCTGAACCTGGGAAGTTGGG - Intronic
1198272493 X:135067657-135067679 TTACCTGGACCTGGGAGATTGGG + Intergenic
1202174610 Y:22085815-22085837 TGTTCTGAACCTGAGATCTCTGG + Intronic
1202216752 Y:22500567-22500589 TGTTCTGAACCTGAGATCTCTGG - Intronic
1202326435 Y:23695503-23695525 TGTTCTGAACCTGAGATCTCTGG + Intergenic
1202544335 Y:25974551-25974573 TGTTCTGAACCTGAGATCTCTGG - Intergenic