ID: 926307192

View in Genome Browser
Species Human (GRCh38)
Location 2:11646846-11646868
Sequence CCTCACTTACCCTTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926307192_926307197 28 Left 926307192 2:11646846-11646868 CCCATGGCAAAGGGTAAGTGAGG No data
Right 926307197 2:11646897-11646919 TAATGGTGTTCCCTGCATGTAGG No data
926307192_926307196 11 Left 926307192 2:11646846-11646868 CCCATGGCAAAGGGTAAGTGAGG No data
Right 926307196 2:11646880-11646902 AGCTAGAAATGTTACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926307192 Original CRISPR CCTCACTTACCCTTTGCCAT GGG (reversed) Intergenic
No off target data available for this crispr