ID: 926308551

View in Genome Browser
Species Human (GRCh38)
Location 2:11657902-11657924
Sequence CTGGCGTCCCCTCCTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926308551 Original CRISPR CTGGCGTCCCCTCCTGCCTC TGG (reversed) Intergenic
900213344 1:1468073-1468095 CTGCAGTTCCCACCTGCCTCTGG + Intronic
900405470 1:2491030-2491052 CTGGGTTCCCGTCCTGCCTGTGG + Intronic
900537601 1:3186560-3186582 CTGGCCGCGCCTCCCGCCTCGGG - Intronic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
900656511 1:3761417-3761439 CTGGCTCACCCTCCTGCCTGGGG - Exonic
901290117 1:8117582-8117604 CTGGCTGCCCCTGCTGCATCAGG - Intergenic
902621211 1:17652055-17652077 CTGGAGTCACCCCCTGCCCCAGG - Intronic
903185614 1:21627190-21627212 CTGGCTTCCGCTGCTGCCTAGGG + Intronic
903659803 1:24970088-24970110 CAGTCCTCACCTCCTGCCTCGGG + Intergenic
904293703 1:29504183-29504205 GTGGAGTTCCCTCCTGCCTCTGG + Intergenic
904677655 1:32208174-32208196 CTGGCTTCTGCTCCTGCCCCTGG + Exonic
905478829 1:38247480-38247502 CAGGGGTCCCCTCTGGCCTCCGG + Intergenic
906146542 1:43563972-43563994 CAGTCATCCCCTCCTTCCTCGGG - Intronic
909024515 1:70467613-70467635 CTGCTGTCCCCTCGAGCCTCTGG + Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
913650996 1:120913599-120913621 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
913699732 1:121362649-121362671 CCGCCCTGCCCTCCTGCCTCTGG - Intronic
913995781 1:143651327-143651349 AAGGGGTCCCCTCCTGCCTCAGG + Intergenic
914137809 1:144917387-144917409 CCGCCCTGCCCTCCTGCCTCCGG + Intronic
914170118 1:145215468-145215490 CTGGCGCCCCCTCCCGCTTTTGG + Intergenic
914386287 1:147172688-147172710 CTGGCGCCCCCTCCTGGCGCTGG - Intergenic
914474718 1:148013724-148013746 AAGGGGTCCCCTCCTGCCTCAGG + Intergenic
914492344 1:148160309-148160331 AAGGGGTCCCCTCCTACCTCAGG + Intergenic
914525235 1:148459431-148459453 CTGGCGCCCCCTCCCGCTTTTGG + Intergenic
914598441 1:149176399-149176421 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
914641167 1:149607703-149607725 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
914844506 1:151274476-151274498 CTCCCTTCCCTTCCTGCCTCTGG - Intergenic
915023740 1:152806527-152806549 CCAGCCTCCCCTCCTGCCTAGGG + Intronic
915446793 1:155978646-155978668 CTGGCGTCCCGTCCTGCGCGCGG - Intronic
916051792 1:161041650-161041672 CAGGCGACCCCTCCTGGCACTGG - Exonic
916132856 1:161626487-161626509 CTGGCTTTCCCTTATGCCTCAGG - Intronic
916438380 1:164797900-164797922 CTGGGTTCAGCTCCTGCCTCTGG - Intronic
920418424 1:205813527-205813549 TGCGCGTCCTCTCCTGCCTCTGG + Intronic
920487145 1:206381358-206381380 CCGCCCTGCCCTCCTGCCTCCGG - Intronic
920948810 1:210553883-210553905 CTGCCTTCCACTCCTGCCTGGGG + Intronic
922179660 1:223223860-223223882 CTCTCGTGTCCTCCTGCCTCTGG + Intronic
922619327 1:226980569-226980591 CTGGCGTCTGCTGCTGCCTAAGG + Intronic
922849938 1:228723836-228723858 ATGGCCTCACCTCCTGCCTTAGG + Intergenic
923521976 1:234741996-234742018 CTGGCTTCCTCTCTTGCTTCTGG - Intergenic
1063371962 10:5527921-5527943 CTGGCGTGCCCTCCTGGCCCAGG - Intergenic
1063433819 10:6014621-6014643 CTTGCATCCTCTCCTTCCTCAGG - Intronic
1066715380 10:38280446-38280468 CTGGCCTCCCCTCCTGCAGGAGG + Intergenic
1066782715 10:38970266-38970288 CTGGCCTCCCCTCCTGCAGGAGG - Intergenic
1069915139 10:71782665-71782687 CTGGTGTCTCCTCCTGGCTTTGG + Intronic
1070158009 10:73848188-73848210 CTGGCATCCACTTCTGACTCTGG - Intronic
1070539222 10:77404097-77404119 CTGGGGACCCCTTCTGGCTCTGG - Intronic
1071601756 10:86961883-86961905 CTGGCCTCAGCACCTGCCTCTGG - Intronic
1074104196 10:110376465-110376487 CTCCACTCCCCTCCTGCCTCCGG + Intergenic
1075087248 10:119421930-119421952 CGGGCGTCCCCTCCACCCCCAGG + Intronic
1075625754 10:123963438-123963460 TTGGCTTCCCATCCTGCCTGGGG + Intergenic
1075838236 10:125474669-125474691 CTGGCTTTTCCTCCTCCCTCTGG + Intergenic
1076317412 10:129552153-129552175 GTGGCCTCCCCTCCTGTCTGCGG - Intronic
1076650357 10:131982649-131982671 CTGGGGTCCGCGCCTCCCTCGGG - Intergenic
1076781247 10:132725817-132725839 CTGGCAGCCCCACCTGGCTCTGG + Intronic
1077103556 11:832591-832613 CTGCCGACCCCTGCAGCCTCTGG + Intergenic
1077138702 11:1014077-1014099 CCGGGGTCCCCACCTGTCTCTGG + Intronic
1077218295 11:1404266-1404288 CTGTGTTCCCCTCCTGTCTCTGG + Intronic
1078249801 11:9607634-9607656 CTGGCTTCACTTCCAGCCTCAGG + Intergenic
1078681928 11:13485495-13485517 CTGGCTGCCCCTCCTGGCTCAGG - Intergenic
1079172048 11:18105822-18105844 CTGGCGAATCCTCCTGCCCCGGG - Intronic
1080419166 11:32094811-32094833 CTGGATCCCCGTCCTGCCTCTGG - Intronic
1081679355 11:44990787-44990809 CTGGCCTCTCCTCTTCCCTCAGG - Intergenic
1081852156 11:46281370-46281392 GTGCTGTCCCCTCCTTCCTCTGG + Intronic
1083296197 11:61716956-61716978 CTGGGGGCTCCTCCTGCCTCTGG - Intronic
1083876420 11:65526390-65526412 CTGGAGGCCCCTGCAGCCTCAGG + Intronic
1084459321 11:69287377-69287399 CTCGCCTCCACTCCTTCCTCTGG - Intergenic
1084770402 11:71339445-71339467 CTGGCCCCCGCGCCTGCCTCCGG + Intergenic
1085743966 11:79099198-79099220 CTGGATTCCCCTCCTGCCAGGGG + Intronic
1086225249 11:84500609-84500631 CTGGTGTCCTATCCTGCCTTAGG - Intronic
1088753893 11:112869095-112869117 CTGGATTCCACTCCTGGCTCTGG + Intergenic
1088920262 11:114255469-114255491 CCGCCCTCCCCTCCTCCCTCTGG + Intergenic
1089054959 11:115577947-115577969 CTAGCTTCCCCTCCTGCCCGTGG - Intergenic
1089070362 11:115695377-115695399 CAGGTGTCCCCTCCTGGCTCTGG - Intergenic
1089126967 11:116183327-116183349 CTGCCTTCCCCTCCTGCTCCAGG - Intergenic
1089496182 11:118909725-118909747 CTGGCTGCGCCTCCTGCCTCGGG + Intronic
1089613944 11:119684788-119684810 CTGGGGTCCCCTCCTTTCACAGG + Intronic
1090247160 11:125224673-125224695 CTGGTGTCCCCACCTGGATCTGG - Intronic
1092350071 12:7749115-7749137 GTGCGGTGCCCTCCTGCCTCAGG - Exonic
1094512114 12:31103120-31103142 CTGGCGTCTCCTGCCCCCTCCGG + Intronic
1097251165 12:57632897-57632919 GTGGGGGACCCTCCTGCCTCTGG + Exonic
1098595953 12:72273103-72273125 CTGGCCACCCCACCCGCCTCGGG - Exonic
1100349297 12:93763776-93763798 CTGGAGTCCCCTTCTGCCAGGGG - Intronic
1103724035 12:122989149-122989171 CTGTGGTCCCTTCCTGACTCTGG + Intronic
1104044369 12:125151491-125151513 CTGGCCTCTCCTCCTGCCGCAGG - Intergenic
1104981980 12:132577267-132577289 CTGGCCACCCCTCCTCCCTGGGG + Intronic
1107549092 13:41458204-41458226 GTGGCGGCCCCTCCTGGCCCTGG + Intronic
1109478807 13:62919941-62919963 CAGGCCTCCCCTGCTGCATCTGG + Intergenic
1110119435 13:71865234-71865256 CTGGCTTCCCCTCCGGGCTTCGG + Intronic
1110492333 13:76124389-76124411 CTGGCAGCCCCTCCTATCTCAGG + Intergenic
1111929561 13:94499750-94499772 CTGACCTCCCCTCATGACTCTGG + Intergenic
1113429967 13:110241225-110241247 TTGGCGGCCCCTCCTGGCTCTGG - Intronic
1113587509 13:111475432-111475454 CTGGGGTCCTCTCCAGCCTATGG - Intergenic
1113594092 13:111519275-111519297 CTGGCTTCTCCTCCTGCATCTGG + Intergenic
1113820448 13:113209274-113209296 CGGGCACCCCCTCCTGGCTCGGG - Intronic
1113931977 13:113973521-113973543 CTGGAAGCCCCTCCTGCTTCAGG + Intergenic
1118796678 14:69151684-69151706 CCGTCGTCCCCTCCTCCCTGGGG - Intronic
1119681957 14:76599235-76599257 CTTATGTCCCCTCCTGCCTGGGG - Intergenic
1119743351 14:77027925-77027947 CTCGCGTTCCCTCCAGCCCCTGG - Exonic
1119749588 14:77067968-77067990 CTGGCGTCCACTAGTGGCTCTGG - Intergenic
1119758333 14:77134153-77134175 CAGTCTTCCCCTCTTGCCTCAGG - Intronic
1121072465 14:91037039-91037061 CTTGAATCCCCTCCTGCCTTTGG + Intronic
1121118107 14:91357809-91357831 CTGGCGTCCCCGCCCTTCTCTGG + Intronic
1121828996 14:97033687-97033709 TTCGCGTCCCTTCCAGCCTCTGG - Intergenic
1122060532 14:99133981-99134003 CAGGTGTGCCCTCCTGCCCCGGG - Intergenic
1122278157 14:100605786-100605808 GTGCCGCCCCTTCCTGCCTCTGG + Intergenic
1122775986 14:104117153-104117175 CCGGCGTCCCCTCGTCCCGCGGG - Intergenic
1122893276 14:104742746-104742768 CTGTCTTCCCCTCCTGCCATGGG - Intronic
1124007590 15:25807255-25807277 CTGGCTGCCCCACCTGCCTGGGG - Intronic
1124638142 15:31378084-31378106 CTGGCTTCCCCTCCTGCCCATGG + Intronic
1125462569 15:39920590-39920612 CGGGGGTCCCCTCGTGGCTCCGG - Exonic
1125606192 15:40941329-40941351 CAGGGTTCCTCTCCTGCCTCAGG + Intergenic
1127994334 15:64144335-64144357 CTGTCGTCCTCTTCAGCCTCTGG + Intronic
1128308200 15:66613818-66613840 CTGGCTTCTCTCCCTGCCTCAGG - Intronic
1129428537 15:75481597-75481619 CTGACCTCCCCACCTCCCTCCGG - Intronic
1129450429 15:75648295-75648317 GTCGCGCCCCCTCCTTCCTCCGG + Exonic
1129608277 15:77035326-77035348 CTGGGGAGCCCTCCTGCCTGAGG + Intronic
1130564473 15:84981887-84981909 CGGCCGTCGGCTCCTGCCTCAGG + Intronic
1132146279 15:99431827-99431849 CTGCCTTCCGCTGCTGCCTCAGG - Intergenic
1132349696 15:101132230-101132252 CTGGCCTCCCCTCTGCCCTCAGG + Intergenic
1132590195 16:723246-723268 CAGGTGTCCCCTCCCGGCTCTGG - Intronic
1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG + Exonic
1133239227 16:4404673-4404695 CAGGCCTCTCCTACTGCCTCAGG + Intronic
1133323834 16:4931448-4931470 CTGGTGCCCCTTTCTGCCTCCGG - Intronic
1133326413 16:4944911-4944933 CTGGCCTCCCCTCTGGCCCCAGG - Intronic
1133762819 16:8813541-8813563 CTGGTGTCCTCTCCTGTTTCAGG - Intronic
1133809014 16:9146903-9146925 CTGGGCTCACCTCCAGCCTCTGG + Intergenic
1133814708 16:9187924-9187946 CTGGACTCCACTCCTGGCTCTGG - Intergenic
1134302041 16:13000621-13000643 CTGGGGACCCCTTCTGCCTGCGG - Intronic
1135732579 16:24907122-24907144 CTGGAATCACCTCCGGCCTCGGG + Exonic
1137613795 16:49835487-49835509 CTGGCTTCCCTTCCTGGCTAGGG - Intronic
1137640514 16:50025013-50025035 CTGGCGTCGCCTGCTGCCCCGGG - Exonic
1138506648 16:57481502-57481524 CTGTCTTCACCGCCTGCCTCTGG + Intronic
1139205915 16:65028276-65028298 CTGGTGTCTGCCCCTGCCTCTGG + Intronic
1139507990 16:67409142-67409164 ATGGTGACTCCTCCTGCCTCAGG - Intronic
1139747097 16:69083399-69083421 CTGCCCTCTCCTCCTGCCTGAGG - Intronic
1139942183 16:70613307-70613329 CTGGCATCCCTTCTTGGCTCAGG + Intronic
1141492323 16:84382502-84382524 CTGGCTGCCCATCCTGCCCCAGG - Intronic
1141550454 16:84803405-84803427 CTGGAGCCCCTACCTGCCTCGGG + Intergenic
1141630814 16:85287054-85287076 CTGGCCTCCCTGCCTGTCTCCGG + Intergenic
1141712853 16:85710048-85710070 CTTGCGTCCCCACCTCCCACTGG - Intronic
1141855004 16:86674738-86674760 CTGGCTTTGCCTCCTGCCCCAGG + Intergenic
1142637683 17:1268264-1268286 CGGGCGTTCCGTCCTCCCTCGGG + Intergenic
1143091396 17:4451016-4451038 CTGGCTGCCCCTCCTGCTTAGGG + Intronic
1143352582 17:6299514-6299536 CTGGCTTCCCCATCAGCCTCAGG + Intergenic
1143596121 17:7915384-7915406 AGGGCGTTCCCTCCTGCCTTCGG + Intergenic
1143763816 17:9124364-9124386 GTGGTGTGCCCTCCTCCCTCCGG + Intronic
1144942366 17:18950591-18950613 CTGCCGTCTCCCCTTGCCTCTGG - Intronic
1146804526 17:35854816-35854838 CTGTCCTTCCCTCCTTCCTCTGG + Intronic
1147663093 17:42128121-42128143 CTGCTGTCCTCTCGTGCCTCAGG - Intronic
1148497104 17:48059602-48059624 TTGGCTTCCTCTCCTGCCGCCGG - Exonic
1148612552 17:48973994-48974016 CTTGCGCCCCCTCCTGCCCCTGG + Intergenic
1149468196 17:56895765-56895787 TTGTCCTCCCCTCCAGCCTCAGG + Intronic
1149563364 17:57625238-57625260 CTGGGTTCCAGTCCTGCCTCTGG - Intronic
1149604651 17:57916283-57916305 CTGGCCTGCCCTCATGCCTCAGG - Intronic
1149986956 17:61354626-61354648 CTGGCCTCCCATCCTGACTGGGG - Intronic
1151194923 17:72424628-72424650 CTGCCATCCCCTCCTCCCACTGG + Intergenic
1151405859 17:73885653-73885675 GTGGCTTCCCCTCCTCTCTCAGG - Intergenic
1151557649 17:74854658-74854680 CTCATGTCCCCTCGTGCCTCAGG - Intronic
1151558470 17:74859013-74859035 CTGGCTTCCCCTCCTGGGTGGGG + Intronic
1151558678 17:74859818-74859840 CTCGCGCCCCCTCCTCCCGCGGG - Exonic
1151678257 17:75610802-75610824 CAGCTGTCCCCTCCTGCCCCTGG - Intergenic
1151679407 17:75615671-75615693 CTGGCTGCTCCTCCTGCTTCAGG + Intergenic
1151699590 17:75736266-75736288 CTGGTGCCCCCTCCTACCCCAGG + Exonic
1151927588 17:77210333-77210355 CTGCAGGCCCCTCCTGCTTCAGG - Intronic
1151954930 17:77375411-77375433 CTGGCCTCCCCTCCCGCCACAGG - Intronic
1152025417 17:77805736-77805758 CTGGCGTCCCCTCCCCCATCTGG - Intergenic
1152275404 17:79353789-79353811 GTGGGGGCCCCTCGTGCCTCAGG - Intronic
1152594997 17:81233637-81233659 CTGGGGACCCCGCCTGCCACAGG - Exonic
1152675264 17:81636929-81636951 ATGGCGGCTGCTCCTGCCTCCGG + Exonic
1152736752 17:82000992-82001014 CTGCCTGCCCCTCCCGCCTCGGG + Intronic
1152815248 17:82404121-82404143 CGAGCGTCCCCTCCCGCCTGGGG - Intronic
1152924200 17:83080025-83080047 CTCGCGTCCCCTCCCGTCCCGGG + Intronic
1153227632 18:2910354-2910376 CTGGCGTGTCCCCCTGCCCCGGG + Intronic
1153522763 18:5967818-5967840 TTGCCGTCCCCTCCTGCCCCAGG - Intronic
1153883921 18:9446401-9446423 CTGGCTTGCCCACCAGCCTCAGG - Intergenic
1155228735 18:23753214-23753236 CTGGTGGCCCCTCCAGTCTCAGG + Intronic
1156149085 18:34222738-34222760 CTGGCCTCCCTCCCCGCCTCGGG - Intronic
1156681673 18:39597184-39597206 TTGGCTTCCTCTCCTCCCTCGGG + Intergenic
1158536159 18:58309809-58309831 CTGATGTCCCCACCTCCCTCTGG - Intronic
1160357280 18:78239036-78239058 TTCGCGTCCACTCCTGCGTCAGG - Intergenic
1160461959 18:79046289-79046311 CTGCCTTCCCCACCTGGCTCAGG - Intergenic
1160805173 19:989476-989498 CTGCCCTTCCCTGCTGCCTCAGG - Intronic
1160810869 19:1012403-1012425 GGGGCCTCCCCTCCTCCCTCGGG - Intronic
1160989114 19:1853399-1853421 CTGGCCTCCCCTCCTTCTCCTGG - Exonic
1161136841 19:2624981-2625003 CAGGCGTCCACCCCTGCCTGGGG - Intronic
1161256943 19:3314889-3314911 CGGCCGCCCCCTCCTGCCCCCGG - Intergenic
1161428333 19:4216687-4216709 CTCGTGTCTCCTGCTGCCTCAGG - Exonic
1161514706 19:4690016-4690038 CTGGCCTTCCCACCTGGCTCTGG - Intronic
1161777003 19:6269083-6269105 CTGGCTGCCCCTCCTGCACCAGG - Intronic
1162367661 19:10259229-10259251 CTGGCTTCCCCACCTCTCTCAGG + Intronic
1162536787 19:11267311-11267333 CTCCCGTCCCCTCCAGCCCCTGG + Intergenic
1162917405 19:13881753-13881775 CTTTCCTCCCCTCCTGCATCAGG + Intergenic
1163440959 19:17322380-17322402 CTGTCTACCCCTCCTGCCTTTGG + Exonic
1163768963 19:19179258-19179280 CAGGCAGCCCCTCCTGCTTCAGG + Intronic
1165022957 19:32938712-32938734 CAGGCGATCCCACCTGCCTCGGG - Intronic
1165180984 19:33968925-33968947 CTTGCTACCCCTCCAGCCTCTGG + Intergenic
1165462846 19:35954214-35954236 CTGCAGTCCCCTCCTTCCTCAGG + Intergenic
1166295536 19:41887675-41887697 CTCCCATCCCCTCTTGCCTCTGG + Intronic
1166408913 19:42543291-42543313 CCGTCCTACCCTCCTGCCTCAGG - Intronic
1168125795 19:54281939-54281961 TTGGGGTCCACTCCAGCCTCAGG - Intergenic
1168171471 19:54592792-54592814 TTGGGGTCCACTCCAGCCTCAGG + Intronic
1168176177 19:54629617-54629639 TTGGGGTCCACTCCAGCCTCAGG + Intronic
1168328762 19:55553842-55553864 CTGGCCTCCCCTCTCGCCTCTGG + Intergenic
1168353184 19:55687871-55687893 CTGGCGGCCCCACCTGCACCGGG - Intronic
1168404325 19:56102988-56103010 CTGGCCTCCCCTCCCGCCCTGGG - Intronic
925411768 2:3643641-3643663 CTGCCGGCCCCTGCTGCCTGTGG + Intronic
926051001 2:9744798-9744820 CTGGAGTCCACACCTGCCACAGG + Intergenic
926308551 2:11657902-11657924 CTGGCGTCCCCTCCTGCCTCTGG - Intergenic
927256305 2:21043706-21043728 CTGGCGGCCCCTGCAGGCTCAGG - Intronic
927794258 2:26034324-26034346 ATGGCCTCCCCTCCCCCCTCAGG - Exonic
928115393 2:28542375-28542397 CTAGCTTCCCCTCCTAGCTCTGG + Intronic
930029038 2:47047217-47047239 CTGGGGTCCCCTGAGGCCTCAGG - Intronic
930608021 2:53512106-53512128 CAGGCTTCCCATACTGCCTCTGG - Intergenic
933919299 2:87028445-87028467 CTGTCTGCTCCTCCTGCCTCTGG - Intergenic
934003695 2:87741462-87741484 CTGTCTGCTCCTCCTGCCTCTGG + Intergenic
934680210 2:96278224-96278246 CTGCTGTCCTCACCTGCCTCAGG + Exonic
935173646 2:100629476-100629498 CCTGGGTCCCCTCCTGCCCCAGG - Intergenic
935765070 2:106359000-106359022 CTGTTCTTCCCTCCTGCCTCTGG + Intergenic
936158864 2:110069211-110069233 TTGGGGAGCCCTCCTGCCTCTGG - Intergenic
936185796 2:110302121-110302143 TTGGGGAGCCCTCCTGCCTCTGG + Intergenic
936251337 2:110870453-110870475 ATGCCCTCCCCTCCTGCCCCTGG - Intronic
936786145 2:116095817-116095839 GTGGAGCCCCCTACTGCCTCTGG - Intergenic
937869150 2:126775421-126775443 CTGGGCTCCCCTCGTCCCTCTGG - Intergenic
937956364 2:127423633-127423655 CTGGCGTCCCCGCCTTCCTCCGG + Intronic
937968661 2:127533747-127533769 CGGGGGTCTCCTCCTGTCTCTGG + Intergenic
937970460 2:127545383-127545405 CAGGGGCCCCCTCCTTCCTCAGG + Intronic
938066038 2:128282583-128282605 CCGACATGCCCTCCTGCCTCGGG - Intronic
941705067 2:168649752-168649774 CTTCCCTCCCCTCCTCCCTCTGG + Intronic
946496681 2:220202520-220202542 CTGGCATCTCCTCTGGCCTCAGG + Intergenic
947455371 2:230249214-230249236 CTGGCGCCCCAGCCTACCTCTGG - Intronic
947747926 2:232518904-232518926 CTGGGCCTCCCTCCTGCCTCTGG - Intergenic
947793093 2:232878861-232878883 CTGGGGACCCCTCCCGCCTCTGG - Exonic
948112216 2:235465069-235465091 CTGTCCTCCCCTCCTCTCTCAGG - Intergenic
948668863 2:239553619-239553641 CCTGGGTCCTCTCCTGCCTCTGG + Intergenic
948738214 2:240025081-240025103 TGGGGGACCCCTCCTGCCTCCGG - Intronic
948961077 2:241337801-241337823 CTGGCGTCCTGCCCTCCCTCTGG + Intronic
1170505836 20:17024939-17024961 CTGGTCTCCTCTCCTCCCTCGGG - Intergenic
1171036199 20:21714580-21714602 CTGCCGTTCCCTCCGGGCTCGGG - Exonic
1171308496 20:24126333-24126355 CTGGCCTCCTCTCCCTCCTCAGG + Intergenic
1171385885 20:24769350-24769372 GGGGGGTCCCCTCTTGCCTCTGG + Intergenic
1172229562 20:33327679-33327701 CTGGTGTCCCATCCTTCCTCAGG + Intergenic
1172553551 20:35821014-35821036 CTGGGCTCACCTCCTACCTCTGG - Intronic
1173707567 20:45123886-45123908 TTGGCCTCCCATCCTGGCTCAGG + Exonic
1173800417 20:45891391-45891413 CGGGGATCCCCTCCAGCCTCCGG - Intronic
1174117610 20:48237980-48238002 CTTGAGAACCCTCCTGCCTCAGG + Intergenic
1174163902 20:48571167-48571189 CTTGAGAACCCTCCTGCCTCAGG - Intergenic
1174396424 20:50249879-50249901 CTGGACTGCCCTCCTGCTTCCGG + Intergenic
1174810080 20:53637992-53638014 CTGGCTCCCTCACCTGCCTCAGG - Intergenic
1175050261 20:56148942-56148964 CTGGTGTCTCCTCCAGTCTCTGG - Intergenic
1175806916 20:61834547-61834569 CACGCGTCCCCACCTGTCTCTGG - Intronic
1175858767 20:62137892-62137914 CTGGGTTCACATCCTGCCTCTGG + Intronic
1176101942 20:63368395-63368417 CTGGCTGCCCCTCCTCCCTAGGG + Intronic
1178376394 21:32071022-32071044 CTGCCCTCACCTCCTGCCTCTGG + Intergenic
1178440833 21:32596939-32596961 CAGGCCTCACCTGCTGCCTCAGG - Intronic
1179052091 21:37896797-37896819 CTGGGGTCCTCCGCTGCCTCTGG - Intronic
1179320590 21:40287501-40287523 CTGGAGTCCCCTCCTACTTTAGG - Intronic
1180179336 21:46111088-46111110 CTGGCGCCCCCCACTGCCTGGGG - Intronic
1180724905 22:17939511-17939533 CAGGCTTCCCGCCCTGCCTCTGG - Intronic
1181673326 22:24436254-24436276 CTGGAGTCACAGCCTGCCTCAGG + Intronic
1182122899 22:27798535-27798557 CTGGCGCCCCCTCCTCCGCCTGG - Exonic
1183583467 22:38738988-38739010 CTGCCTTCCTCTCCTGTCTCAGG - Exonic
1183605550 22:38865266-38865288 CAGGCCTCCCCTCCTGGCCCAGG - Exonic
1184479742 22:44739311-44739333 GGGGCCTCCCCTCCTGCCCCAGG - Intronic
1185281071 22:49970135-49970157 CTGGCCCCTCCGCCTGCCTCAGG - Intergenic
1185299617 22:50072561-50072583 CCGCAGACCCCTCCTGCCTCGGG - Intronic
949124143 3:425225-425247 CTGGCATCACCTCCTGTCTGAGG - Intergenic
950054192 3:10011871-10011893 CCGTGGTCCCTTCCTGCCTCAGG + Intergenic
950306093 3:11916059-11916081 CTGTGGTCCCCTCCCGCCTCAGG + Intergenic
950618068 3:14178387-14178409 CTGGACTCCCGCCCTGCCTCTGG + Exonic
952262607 3:31755060-31755082 CTTGCTTCATCTCCTGCCTCTGG + Intronic
952788036 3:37175877-37175899 CTGGGGTCGCCCCCTGCCTGCGG - Intronic
953411420 3:42692537-42692559 CTGGTGTCCCCTCCACCCTATGG + Exonic
953850958 3:46465037-46465059 GTGGAGTCCTGTCCTGCCTCAGG - Exonic
954265658 3:49469118-49469140 CTGGCTTTCCCTCCCTCCTCAGG - Intronic
955364273 3:58298291-58298313 CTGGTGTCCCCAGCTGCCGCAGG + Intergenic
955752263 3:62195177-62195199 CTGGCTTCCCCTCCTGTGGCCGG + Intronic
956173232 3:66449602-66449624 CTGGGGGCCCTGCCTGCCTCTGG + Intronic
957201343 3:77139991-77140013 CTTTCATCCCCTCCTGCCTCTGG - Intronic
961657543 3:128451678-128451700 CTGGCCTCTCCTCCTCTCTCTGG + Intergenic
961738433 3:129016726-129016748 GTTCCGCCCCCTCCTGCCTCAGG - Intronic
966931937 3:184681014-184681036 CTGGGGTCTCCTCCAGTCTCAGG + Intronic
967840865 3:194003635-194003657 CTGGCCTCCCCTCCTTGCCCCGG + Intergenic
967876872 3:194273491-194273513 CTTTCCTCCCCTCCTGCCTCGGG - Intergenic
968056018 3:195692412-195692434 CTGGCACCCCCTCCTGTCTTGGG - Intergenic
968581421 4:1397085-1397107 CTGTGGCCCCCACCTGCCTCTGG - Intergenic
969600651 4:8174101-8174123 CTGGGGCCCCCTCCTGGCTGTGG + Intergenic
975653975 4:76622409-76622431 CTGGCTTCCTTCCCTGCCTCAGG - Intronic
982323640 4:154107069-154107091 CTGGTGTTCCCTCCTTCCTCTGG - Intergenic
985540044 5:483616-483638 CTGGCGGCCCAGCCTGGCTCGGG - Intronic
986015704 5:3755022-3755044 CTGCCCTCCTCTCCTGCCTTGGG - Intergenic
987363535 5:17127983-17128005 CTGGCGGCCCCTTCTCCTTCTGG + Intronic
997600935 5:135137913-135137935 CTGGTGTCCTCGCCAGCCTCAGG + Intronic
997634521 5:135395146-135395168 GTGACCTCTCCTCCTGCCTCTGG + Intronic
997638419 5:135432371-135432393 CCAGAGTCACCTCCTGCCTCTGG - Intergenic
998148485 5:139744063-139744085 CTGCCTTCTCCTCCTGGCTCTGG + Intergenic
998299216 5:141002047-141002069 CTGGCGGCTGCTGCTGCCTCTGG - Intronic
999437067 5:151571233-151571255 CAGGCGTCCCCTTCTGCTTGTGG - Intergenic
1001095051 5:168769524-168769546 CTGGCCTCTCCTCCTTCCTAAGG + Intronic
1004012453 6:11702686-11702708 CTGGCCTCACCTCCTTTCTCTGG - Intergenic
1004143984 6:13047675-13047697 ATGGGCTGCCCTCCTGCCTCTGG + Intronic
1004360423 6:14966008-14966030 GTGGCTTTCCCTCCTGCCCCTGG - Intergenic
1004823989 6:19400601-19400623 ATTGCATCCACTCCTGCCTCAGG - Intergenic
1006606311 6:35259924-35259946 CCGGCGTGCCCACCTCCCTCCGG + Intronic
1006678826 6:35782567-35782589 CTGCCTCCCCCTCCTGCCTCAGG - Intronic
1006735739 6:36271151-36271173 CTGTCTACCCCTCCAGCCTCAGG - Intronic
1007109273 6:39303684-39303706 CGGGAGTCCCCGCCTCCCTCCGG - Intronic
1007493519 6:42243123-42243145 CTGTTGTCACCTCCTTCCTCTGG + Intronic
1008555214 6:52666899-52666921 TGTGCCTCCCCTCCTGCCTCTGG + Intergenic
1010463144 6:76135900-76135922 CAGGCTTCCCATCCTTCCTCAGG - Intergenic
1010492803 6:76494867-76494889 CTGGAGTCACCTGCTGGCTCCGG - Intergenic
1017002530 6:150006033-150006055 CTGGGCTCCCCACCTCCCTCTGG - Intergenic
1018101695 6:160446124-160446146 GTCTCGTGCCCTCCTGCCTCGGG - Intronic
1018149049 6:160921432-160921454 CTGTCTGCACCTCCTGCCTCTGG - Intergenic
1019315243 7:381113-381135 CAGGGGTCTCCTGCTGCCTCAGG - Intergenic
1019373488 7:676355-676377 CTGCTGTCACCTCCTGCCTCAGG + Intronic
1019593145 7:1845800-1845822 CTGGCGTCCTCTCTGCCCTCAGG + Intronic
1019765184 7:2844445-2844467 CGGGCATCCCTTCCGGCCTCGGG + Intergenic
1022482954 7:30755847-30755869 CTGGCTGGCCCTCCTGGCTCAGG - Exonic
1023627957 7:42135535-42135557 CTGGGATCCCTTCCTGTCTCTGG - Intronic
1024161741 7:46683111-46683133 CTGGCGTCTCCTCATGACACAGG - Intronic
1024268652 7:47625836-47625858 GTGGCCTCCCCTCCTTCCTTTGG - Intergenic
1029111470 7:98214896-98214918 GGGGCGTCCCCTCTGGCCTCAGG - Exonic
1029278165 7:99419879-99419901 CTGGTGTCACCTCCTGCCTGGGG - Exonic
1029448569 7:100628019-100628041 CTGGGGTCCACCCTTGCCTCTGG - Intronic
1033318993 7:140322719-140322741 CTGGCTTCCCCTCCTGTCAGGGG - Intronic
1033858742 7:145598497-145598519 CTGGTCTTCCTTCCTGCCTCAGG - Intergenic
1034946586 7:155266435-155266457 CTGCCTTCCCCTCCTGTCACTGG + Intergenic
1035265776 7:157689791-157689813 GAGGCGTCCCCACCTGCCTCTGG + Intronic
1035775772 8:2186907-2186929 CTGGCGACCCCACCTGCCCCTGG - Intergenic
1036645013 8:10607481-10607503 TGGGCCTCCCCTTCTGCCTCTGG + Exonic
1036645026 8:10607529-10607551 TGGGCCTCCCCTTCTGCCTCTGG + Exonic
1036645087 8:10607766-10607788 TGGGCCTCCCCTTCTGCCTCTGG + Exonic
1036645261 8:10608516-10608538 TGGGCATCCCCTTCTGCCTCTGG + Exonic
1037323361 8:17664671-17664693 GTAGTGTCCCCTCCTGCTTCTGG - Intronic
1038062995 8:23932763-23932785 CTGGCCTTCTCTCCTGTCTCTGG + Intergenic
1038335439 8:26641857-26641879 CAGCTGCCCCCTCCTGCCTCAGG - Intronic
1038452537 8:27649219-27649241 CTGTCATCTCCTCCTCCCTCTGG + Intronic
1040110987 8:43567134-43567156 CTGGCCTCCTCTCCTTCCACGGG + Intergenic
1041165797 8:55091003-55091025 AGGGCATCCCCTCCTGCTTCTGG - Intergenic
1041966593 8:63685589-63685611 CTGGGTTCCCACCCTGCCTCTGG - Intergenic
1042737572 8:72005675-72005697 CTGGGGGACCATCCTGCCTCGGG - Intronic
1043848611 8:85190168-85190190 ATGCCCTCTCCTCCTGCCTCAGG + Intronic
1046073071 8:109282107-109282129 CTGGTGTCCACACCTGCCACTGG + Intronic
1046803019 8:118449674-118449696 CTGTAGTCCCAGCCTGCCTCGGG + Intronic
1048896692 8:138998633-138998655 CTGGCCTCCAGTCCTGTCTCCGG - Intergenic
1048924762 8:139261615-139261637 CTGTCGTCCCTTCCAGCCTCTGG + Intergenic
1049324949 8:142016978-142017000 CTGGCAGCCCCTCCTCCCCCGGG - Intergenic
1049576881 8:143393676-143393698 TTGGAGTCCCCTCAGGCCTCTGG + Intergenic
1049604622 8:143523561-143523583 CTGTGGTCTCCTACTGCCTCTGG - Intronic
1049748173 8:144271770-144271792 CTGGTGGCTCCTCCTGCCTGGGG - Intronic
1055939377 9:81635068-81635090 CTGCAGTCCCCTCTTGCCTAGGG - Intronic
1057452678 9:95178600-95178622 CCTGCGTCTCTTCCTGCCTCCGG - Intronic
1059929450 9:119246643-119246665 CTGGCTTCTAGTCCTGCCTCCGG - Intronic
1060235760 9:121861624-121861646 CTAGCTTCCCCTCCTCCTTCTGG - Intronic
1060880650 9:127115934-127115956 CTGCCCTCCCCTCCTGGCTGAGG + Intronic
1061042619 9:128148849-128148871 CTGGGGTCCCCTCCTGCAAATGG + Intergenic
1061942253 9:133890102-133890124 CTGGCTGCCACTCCTGCCTGGGG - Intronic
1062446320 9:136596887-136596909 CTGGTGCCCTCTCCTGCCCCAGG + Intergenic
1062619376 9:137412610-137412632 CTGCTGTGCCCTCGTGCCTCTGG - Intronic
1186794273 X:13029461-13029483 GAGGCTTCCCCGCCTGCCTCCGG + Intergenic
1187258343 X:17661547-17661569 CAGGAGTCCCTGCCTGCCTCAGG + Intronic
1188811336 X:34657053-34657075 CTGGCGTCCTCGCCTGCGGCGGG - Exonic
1189229561 X:39441765-39441787 CTGGTGTCCCCTTCTGCATCAGG + Intergenic
1195129581 X:101839833-101839855 CTGCCTTCCACTCCTGCCTCAGG + Intronic
1195176658 X:102319996-102320018 CTGCCTTCCACTCCTGCCTCAGG - Intronic
1195182206 X:102367097-102367119 CTGCCTTCCACTCCTGCCTCAGG + Intronic
1195202523 X:102564687-102564709 CTGCCTTCCACTCCCGCCTCAGG - Intergenic
1195254928 X:103081614-103081636 CTGCCTTCCACTCCTGCCTCAGG + Intronic
1197487280 X:127068718-127068740 CTGACTACCCTTCCTGCCTCTGG + Intergenic
1200039251 X:153353902-153353924 ATGCTGTCCCCTCCTGCCTTGGG - Intronic
1200211587 X:154349036-154349058 CTGAGGACCCCTCTTGCCTCAGG - Exonic