ID: 926308893

View in Genome Browser
Species Human (GRCh38)
Location 2:11660188-11660210
Sequence AGTTACACCATTGCAAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926308890_926308893 1 Left 926308890 2:11660164-11660186 CCAGGAGAAAGCAAACACATTCT 0: 1
1: 0
2: 0
3: 33
4: 340
Right 926308893 2:11660188-11660210 AGTTACACCATTGCAAAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926308893 Original CRISPR AGTTACACCATTGCAAAGGG AGG Intronic
900137770 1:1125653-1125675 AGTTACCCCAGGGCAAAGAGTGG + Intergenic
901110780 1:6792519-6792541 ATGTACCCCATTGCAAAGAGAGG + Intronic
901157570 1:7150664-7150686 AGTTACATCTTTGCATTGGGTGG - Intronic
903337007 1:22631475-22631497 AGTATCACCATTGTAAATGGTGG - Intergenic
907288754 1:53398997-53399019 AGTTACACCACTGGGAAGGGCGG + Intergenic
907640593 1:56185205-56185227 AGTTACACCTTTGAAAAAGGAGG + Intergenic
907913575 1:58848560-58848582 AGTTTCCCCATTGCAAAATGGGG - Intergenic
915313010 1:155013803-155013825 AGTGACACCCCAGCAAAGGGTGG + Intronic
916711905 1:167418476-167418498 AGTTTCACCACTCCCAAGGGAGG - Exonic
919792711 1:201302570-201302592 AGCCTCACCCTTGCAAAGGGTGG - Intronic
921616305 1:217271830-217271852 AGTTACATCATTACAAAGTTAGG - Intergenic
922795129 1:228336025-228336047 AGTTTCCCCATTGTAAAGTGAGG + Intronic
1070054061 10:72917426-72917448 ACTTAAACCAAAGCAAAGGGTGG + Intronic
1073204823 10:101763293-101763315 AGTTCCACTATTGCCAAGAGAGG + Intergenic
1073564946 10:104526920-104526942 AGTGACAACAGTGCAAAGGATGG - Intergenic
1077952611 11:6977150-6977172 AGTGAAACCATGGAAAAGGGGGG - Intronic
1080118814 11:28650748-28650770 AGTTACAACAGTTCAAAGGTTGG + Intergenic
1080406206 11:31981703-31981725 ATTTACACCAGTGAAAAGGGAGG + Intronic
1083545432 11:63545726-63545748 AGCTACACCTTTGCACAGGGAGG - Intronic
1083730010 11:64647819-64647841 AGACACACTATTGCACAGGGAGG - Intronic
1086153148 11:83635664-83635686 AATTACACTATTAAAAAGGGGGG - Intronic
1088569021 11:111203225-111203247 AGTAATACCATGGCAATGGGAGG - Intergenic
1088611281 11:111579700-111579722 AGTTACACCATAGCAAATTCAGG - Intergenic
1091010036 11:131992765-131992787 AGTTACACCAGTGCAAGTGTAGG - Intronic
1093807814 12:23456201-23456223 AGTTACACCATTGGTAAGTTGGG + Intergenic
1095971881 12:47907525-47907547 AGGTACACAACTGGAAAGGGAGG + Intronic
1099601392 12:84743105-84743127 AATAACACCATTTCAAGGGGAGG - Intergenic
1099669652 12:85673984-85674006 GGTTACACTGATGCAAAGGGTGG + Intergenic
1111457979 13:88508591-88508613 GGGTACACCAGTGCAAAGGGTGG + Intergenic
1111566882 13:90028132-90028154 AGTCACACCAATGCAAGAGGTGG - Intergenic
1114490903 14:23101358-23101380 ACTTACATCAATGCACAGGGAGG - Intergenic
1118049153 14:62007243-62007265 AGTTCCAGTATTGCAAAGGAAGG - Intronic
1118622255 14:67624299-67624321 AGTGACACCATTGAAAATGGTGG + Intronic
1119356952 14:74015384-74015406 AGTCACACCATTGCTCAGGCTGG + Intronic
1124047184 15:26161187-26161209 ATTTATCCCATTGCAAAGGCAGG - Intergenic
1126814483 15:52441248-52441270 AAATACACCATTACTAAGGGGGG - Intronic
1129230713 15:74195794-74195816 AGTTCCTCCATTGCAAAATGGGG + Intronic
1131215938 15:90535228-90535250 AACTACACCATTTGAAAGGGAGG + Intronic
1144802430 17:17939140-17939162 AATTAAACCTTTGCAAAGAGAGG + Intronic
1148646456 17:49222291-49222313 ATTCACACCTTTGCAGAGGGAGG - Intronic
1149083267 17:52683647-52683669 AGTTACCTCATAGCACAGGGTGG + Intergenic
1150886795 17:69096107-69096129 AATTACACCATAGAAAAGAGAGG - Intronic
1153602320 18:6793219-6793241 AGGTCCATCATTGCAATGGGCGG + Intronic
1156278736 18:35611377-35611399 AGTTAAACTATGGCACAGGGTGG - Intronic
1159406513 18:68009702-68009724 ATTTTCACCATTGCAGTGGGAGG - Intergenic
1159659369 18:71075089-71075111 TGTTACACTGTGGCAAAGGGTGG + Intergenic
1162847274 19:13403025-13403047 AGATACAGCATTGAATAGGGTGG - Intronic
926308893 2:11660188-11660210 AGTTACACCATTGCAAAGGGAGG + Intronic
928512163 2:32011679-32011701 AAGTACACCATTGCAAAAGTAGG + Intronic
929535988 2:42784413-42784435 AGTGACACCTTGGCAAGGGGTGG + Intronic
931445871 2:62326726-62326748 GGTTACACCAGTGTCAAGGGAGG + Intergenic
934138566 2:89021649-89021671 ATTTTCACCATTACAAATGGAGG - Intergenic
935254005 2:101292206-101292228 AGTTAAACCATTGGAAGGTGGGG + Intronic
937264078 2:120605234-120605256 AGCTACACCACTGCACATGGGGG - Intergenic
942439795 2:176020518-176020540 AGATAAAACATTGCAAATGGTGG - Intergenic
942515794 2:176751479-176751501 AGTTACACAATGGAATAGGGGGG + Intergenic
944140373 2:196449868-196449890 AATCACACCATTGCAAAGGGTGG - Intronic
944974628 2:205034612-205034634 AGTTAGAGCATTGCAAAATGTGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1170880857 20:20295753-20295775 ACTCACACCATTGCATGGGGTGG - Intronic
1172017113 20:31883088-31883110 AATTACACCTTTACTAAGGGTGG - Intronic
1178067473 21:28921627-28921649 AGTTTCACCATTGTCAAGGTGGG - Intergenic
949569031 3:5273955-5273977 ACTTACACCATTACAAAGTGAGG - Intergenic
950859409 3:16134456-16134478 TATTGCACCATTTCAAAGGGAGG + Intergenic
951234463 3:20218364-20218386 AGTTCCAGTATTGCAAAGCGTGG + Intergenic
952488449 3:33840667-33840689 AGTTACATGATGGCGAAGGGAGG - Intronic
956755074 3:72377604-72377626 AGTTATTCCATTGCAAATGCAGG + Exonic
960354273 3:116632026-116632048 AATTACATCATTGAAGAGGGTGG + Intronic
961949836 3:130737940-130737962 AGCTGAACCATTGCAAAGTGGGG + Intronic
963783968 3:149514293-149514315 TTTTAGACCATAGCAAAGGGAGG + Intergenic
964427020 3:156564436-156564458 GGTGAAACCCTTGCAAAGGGTGG - Intergenic
967539563 3:190649670-190649692 TGTTGCTCCATTGTAAAGGGCGG + Intronic
968139876 3:196247035-196247057 AGTTACACCATTGGCAGGGCTGG - Intronic
968552805 4:1232605-1232627 AGTAACAGCATTGCAAGGTGGGG - Intronic
970040171 4:11787409-11787431 AGTTCCACCTTTGGAAAGAGTGG + Intergenic
975410172 4:74039474-74039496 AGTTCCAACATTTCAGAGGGAGG - Intergenic
979084985 4:116396855-116396877 AGTTACAGTTTTGCAAAAGGCGG + Intergenic
981033094 4:140145373-140145395 TGTTAAGCCATTGCAAAAGGGGG + Intronic
985857635 5:2442675-2442697 ACTTGCACCATTGACAAGGGAGG - Intergenic
986336669 5:6760507-6760529 AGTGGCACGATTGGAAAGGGAGG - Intergenic
986809222 5:11338514-11338536 ATTTCCACCATCGCAAAGGATGG + Intronic
988052808 5:26053205-26053227 ATTGACATCATTGAAAAGGGAGG - Intergenic
988364505 5:30278635-30278657 AGGTACACCATTGCTAACAGTGG - Intergenic
993519557 5:88883742-88883764 AGTTTCACTCTTGCAAAAGGGGG + Intronic
993959328 5:94277671-94277693 AGTTCAACCATTGCAGAAGGTGG + Intronic
994438168 5:99764164-99764186 AGTGAGACCAGTGCAGAGGGTGG - Intergenic
998211739 5:140204832-140204854 AGTATTACCATTTCAAAGGGTGG + Intronic
1000583440 5:163063589-163063611 AGTTACATCATTGCAGAGTACGG + Intergenic
1001451653 5:171830215-171830237 AGATACAGCTTTGCTAAGGGAGG + Intergenic
1002670701 5:180864119-180864141 ACTTAAACCACTCCAAAGGGAGG - Intergenic
1002855478 6:1034260-1034282 TGTTAAACCATTTCAAAGAGTGG + Intergenic
1003360823 6:5423522-5423544 AGTTATACCATTGCCAATGGTGG + Intronic
1005073453 6:21884241-21884263 AGGGACTCCCTTGCAAAGGGAGG + Intergenic
1007135981 6:39522295-39522317 AGTTACATCACTGGAAAGAGTGG - Intronic
1009959603 6:70501854-70501876 AGTGACACCATCGCAGAAGGTGG - Intronic
1010064539 6:71666419-71666441 AGATGGACCATTGCAAAGGAAGG + Intergenic
1013053265 6:106558274-106558296 AGTTTCTCCATTGCATAGGAAGG - Intronic
1015789663 6:136953595-136953617 ATCTACACAATTGCAAAGGATGG + Intergenic
1017000611 6:149994965-149994987 AATCACATCATGGCAAAGGGAGG + Intergenic
1017959047 6:159206009-159206031 AATTCCACCATTGCAAACAGAGG - Intronic
1018971603 6:168533360-168533382 AGTTCCACCATTTCAGATGGAGG - Intronic
1020107570 7:5429209-5429231 AGTGACACGACTGCAAACGGCGG + Intergenic
1022016371 7:26352391-26352413 TCTTACTCCATTGCATAGGGTGG - Intronic
1023113665 7:36839445-36839467 AGATACACTATTGCAGAGGAAGG + Intergenic
1028123925 7:87089532-87089554 AAATACACCTTTGAAAAGGGAGG + Intergenic
1036403962 8:8437697-8437719 GGTTACACCATGGCACAGTGAGG + Intergenic
1039754024 8:40503675-40503697 ATTTATACCAATGCAAAGTGGGG + Intergenic
1041564712 8:59263367-59263389 AGTTACAGCATCGCATAGGCAGG + Intergenic
1042735563 8:71984088-71984110 AATTACACAATTCCAAAGTGTGG - Intronic
1043805609 8:84669092-84669114 TATTACACCATTTCAAAGGGTGG - Intronic
1051581116 9:18675603-18675625 GGAAATACCATTGCAAAGGGTGG - Intronic
1051855916 9:21565242-21565264 AGCAACACCATTACAAAGGAAGG - Intergenic
1052462924 9:28789981-28790003 AGTTAAACCATGGGCAAGGGGGG - Intergenic
1055286934 9:74738801-74738823 AGTTACCTCAAAGCAAAGGGAGG - Intronic
1056339996 9:85619281-85619303 AGTTACACCATTCCAGAAGAGGG - Exonic
1061207828 9:129174756-129174778 AGTTCCAGCTTTGCAAAGAGGGG - Intergenic
1187878742 X:23826704-23826726 AGTTACACCATTGCTCAAGAGGG - Intergenic
1190268683 X:48845555-48845577 AGTCACACAATTGGAAAAGGTGG + Intergenic
1196616881 X:117776321-117776343 AATTACACAATTGCTAAGGTAGG + Intergenic
1197149353 X:123203328-123203350 AGTAGCAGCAGTGCAAAGGGAGG - Intronic
1198728497 X:139702020-139702042 AGGTAAACCATTGCAGTGGGAGG - Intronic
1199208429 X:145176633-145176655 TGTCACACCATGGAAAAGGGAGG + Intergenic
1199363555 X:146950688-146950710 AGTTTCTACATTGAAAAGGGAGG + Intergenic