ID: 926309762

View in Genome Browser
Species Human (GRCh38)
Location 2:11667038-11667060
Sequence CAGGACAAGAACATGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926309762_926309766 -9 Left 926309762 2:11667038-11667060 CCAGCAGCCATGTTCTTGTCCTG 0: 1
1: 0
2: 1
3: 16
4: 207
Right 926309766 2:11667052-11667074 CTTGTCCTGTGGACAGACCTGGG 0: 1
1: 2
2: 2
3: 27
4: 262
926309762_926309765 -10 Left 926309762 2:11667038-11667060 CCAGCAGCCATGTTCTTGTCCTG 0: 1
1: 0
2: 1
3: 16
4: 207
Right 926309765 2:11667051-11667073 TCTTGTCCTGTGGACAGACCTGG 0: 1
1: 0
2: 1
3: 9
4: 199
926309762_926309769 22 Left 926309762 2:11667038-11667060 CCAGCAGCCATGTTCTTGTCCTG 0: 1
1: 0
2: 1
3: 16
4: 207
Right 926309769 2:11667083-11667105 CGCTACCCACAGACACCCAGAGG 0: 1
1: 0
2: 6
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926309762 Original CRISPR CAGGACAAGAACATGGCTGC TGG (reversed) Intronic
900797380 1:4716867-4716889 AAGGTCAGGGACATGGCTGCAGG - Intronic
901801645 1:11711689-11711711 AAGGACATAAAGATGGCTGCCGG - Intronic
904600672 1:31671021-31671043 CTGGAGAAGAAAATGGCTGGTGG - Intronic
906250705 1:44308733-44308755 CAGGACAACAGCCTGTCTGCTGG - Intronic
907570897 1:55482684-55482706 CAGGTCAATTACATGACTGCTGG - Intergenic
907778562 1:57542941-57542963 CTGCTCAAGAACATGGCAGCTGG - Intronic
909403890 1:75264259-75264281 CAGCAGCAGCACATGGCTGCAGG - Intronic
910471271 1:87555374-87555396 TATGACAAGGTCATGGCTGCAGG - Intergenic
910536163 1:88300249-88300271 AAGAAGAAGAAGATGGCTGCAGG + Intergenic
911433596 1:97825457-97825479 CAGGACAAGAACACCACTGTGGG + Intronic
911839445 1:102661295-102661317 CAGGACAAGAACCTGGCACCTGG + Intergenic
912595940 1:110875738-110875760 CAGGACTCCAGCATGGCTGCTGG + Intronic
915004092 1:152621014-152621036 CAGGCCAAGAACATGGGCACTGG - Intergenic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
920722498 1:208400663-208400685 AAGGATAAAAACAAGGCTGCAGG - Intergenic
923294551 1:232581049-232581071 CAGGTCAGGAACATGGGTGGAGG - Intergenic
923550391 1:234958768-234958790 CAGGAGAAGCACCTGTCTGCGGG + Intergenic
924439541 1:244074731-244074753 CAGGAGAAAAAAAAGGCTGCAGG - Intergenic
1067152917 10:43751218-43751240 CAGTAACAGAACATGGCTGCTGG + Intergenic
1067224957 10:44369623-44369645 GAGGACCAGAACCTGTCTGCTGG + Intergenic
1068360116 10:55966778-55966800 CTGGAGAAGAATTTGGCTGCAGG + Intergenic
1069315057 10:67088232-67088254 CAGGACAAGAACTTGGCATATGG + Intronic
1070533275 10:77356163-77356185 CAGCACAAGCACATAGATGCTGG + Intronic
1070807126 10:79277174-79277196 CAGGAGGACAACAAGGCTGCAGG - Exonic
1071912291 10:90250101-90250123 CTGGAAAAGAACATGCCTGGTGG - Intergenic
1072706787 10:97686908-97686930 CAGCACAAGAGCATGGCAGAGGG + Exonic
1072753387 10:98000144-98000166 CAGGACAAGAACTTGGGACCTGG + Intronic
1072760517 10:98052503-98052525 CAGCAAAAGAACATGGCTTGGGG + Intergenic
1073128317 10:101167145-101167167 CAGGAGAAGGATCTGGCTGCAGG - Intergenic
1074567623 10:114595609-114595631 TGGGAGTAGAACATGGCTGCAGG - Intronic
1075667365 10:124240669-124240691 AAGGATAAGAACATGGATGGCGG - Intergenic
1076269132 10:129135259-129135281 CAGGACAAGCCCAGTGCTGCAGG + Intergenic
1076652087 10:131996918-131996940 CAGGTCAAGGACCTGGCTTCTGG + Intergenic
1077311624 11:1891371-1891393 CAAGGCAAGAACAGAGCTGCTGG + Intronic
1078377365 11:10807897-10807919 CAGGGCCACAACATGGCAGCAGG + Exonic
1078904591 11:15671965-15671987 CAGGAAAGGAACATGGCAACAGG + Intergenic
1080928168 11:36780111-36780133 CATGAAAAGAATATGGCAGCTGG - Intergenic
1084154408 11:67305506-67305528 CAGGGCGAGGTCATGGCTGCAGG + Intronic
1088178767 11:107084876-107084898 CAGGACAAGGACAAGGCTCAGGG - Intergenic
1088583585 11:111337769-111337791 CAGGATAAGATGATGTCTGCTGG - Intergenic
1088688659 11:112305944-112305966 CGGGACAAGCACCTTGCTGCAGG - Intergenic
1090359795 11:126164325-126164347 GGGGACAAGCACATCGCTGCAGG - Intergenic
1091686934 12:2569191-2569213 CAAGACAAGGACAGGGCTGAGGG + Intronic
1093268519 12:17028371-17028393 CTGGACAAGAACTTGGGTGTGGG + Intergenic
1096602939 12:52743024-52743046 CAGGACAAGAACTTGGGTAAAGG + Intergenic
1096807209 12:54148234-54148256 CAGGGCAGGAAGATGGCTGAAGG + Intergenic
1097882354 12:64697975-64697997 CAGGGCAAGAACAGGGGTGGAGG - Intergenic
1098584410 12:72138913-72138935 CAGCACATGAACTTGGCTGTGGG + Intronic
1101473211 12:105018814-105018836 CTGGACAAGAATTTGGGTGCAGG - Intronic
1104045810 12:125162048-125162070 CAGGAGGGGAACAAGGCTGCAGG - Intergenic
1104585404 12:130044593-130044615 CAGGAGAAGGTCAGGGCTGCCGG + Intergenic
1104879560 12:132061109-132061131 CAGGACAATAACATGCAAGCTGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1108381211 13:49856294-49856316 CAGGATAAGACAATGGCTGAAGG - Intergenic
1109726099 13:66343783-66343805 TAGGACATGAACATCGCTGTGGG + Intronic
1112019148 13:95356704-95356726 CCAGACAAGAACCTGGGTGCCGG - Intergenic
1112048133 13:95617730-95617752 CAGCAAAATAACCTGGCTGCTGG - Intronic
1113250677 13:108449149-108449171 CAGGACAGGTACATGGCTATAGG - Intergenic
1113760329 13:112842020-112842042 GAGGAAAAGAACTTGGCTCCGGG - Intronic
1114884640 14:26833233-26833255 CTGGAAGATAACATGGCTGCTGG - Intergenic
1115630036 14:35235604-35235626 CAGGCCAAGAAGAAAGCTGCTGG - Intronic
1118419263 14:65582632-65582654 CAGGAGCAGGCCATGGCTGCTGG - Intronic
1118621210 14:67615776-67615798 CAGAACAAGAAAAAGGCTGAAGG - Intergenic
1118885190 14:69860191-69860213 CAGGTCAAAAACCAGGCTGCAGG - Intronic
1121137944 14:91515206-91515228 AAGGACAGGGACAAGGCTGCTGG + Intergenic
1125377654 15:39048895-39048917 CAAGACAAGAACTTGGTTACAGG - Intergenic
1125770389 15:42161569-42161591 GAGAAGGAGAACATGGCTGCTGG - Intronic
1127800998 15:62477506-62477528 GAGGACAAGCACATAGATGCAGG - Intronic
1127888091 15:63221699-63221721 CAGGACCAGAGCATGGTTGGGGG + Intronic
1131375948 15:91923410-91923432 CAGGAAAAGAAGAGCGCTGCTGG - Intronic
1131519331 15:93101470-93101492 CAGGGGAAGTACAGGGCTGCTGG + Intergenic
1132888672 16:2193943-2193965 CAGGAGCAGAGCATGGCTGGAGG + Intronic
1133817940 16:9212484-9212506 CAGGTCCTGAACATGGCTGGAGG + Intergenic
1133928595 16:10213803-10213825 TGGGACAAGGACATGGGTGCAGG - Intergenic
1135233377 16:20730640-20730662 GAGGATGAGAACATGGCAGCAGG - Intronic
1135407555 16:22208811-22208833 GAGGACGAGAACATGGGTACTGG - Intronic
1135676136 16:24416559-24416581 CAGGAGAAGAACCTGAATGCTGG + Intergenic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1142375707 16:89706149-89706171 CAGCACTTGAACATGTCTGCCGG + Intergenic
1143203269 17:5126794-5126816 CGGCACAAGCACAGGGCTGCAGG + Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144874435 17:18390119-18390141 CGGCACAAGCACAGGGCTGCAGG + Intergenic
1145157790 17:20554301-20554323 CGGCACAAGCACAGGGCTGCAGG - Intergenic
1148230543 17:45930836-45930858 CAGGAATAGGTCATGGCTGCGGG + Intronic
1148956306 17:51356498-51356520 CAGAAGAAGAACGTGGCTTCTGG - Intergenic
1149848723 17:60022356-60022378 CGGCACAAGCACAGGGCTGCAGG - Intergenic
1149861446 17:60124168-60124190 CGGCACAAGCACAGGGCTGCAGG + Intergenic
1151270884 17:72995160-72995182 CATGACAAGGGCATGGTTGCAGG - Intronic
1151559881 17:74864473-74864495 CAGGACAAGATCAAGGGTGAGGG - Exonic
1153064008 18:1024232-1024254 CAGGACAAGACTATAGATGCAGG - Intergenic
1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG + Intergenic
1157313001 18:46566307-46566329 CTGGACAAGAACCAGGCTGACGG - Intronic
1157490569 18:48120919-48120941 AAGGACAGAAGCATGGCTGCAGG + Intronic
1160175465 18:76590527-76590549 CTGGACAGGGACATGGCTGCTGG - Intergenic
1161717693 19:5886222-5886244 CAGGACAAGAGCAGGGCTCTGGG - Intronic
1162622582 19:11855747-11855769 CAGGCCAAGAACATGGCATCAGG + Intronic
1164436910 19:28238241-28238263 CAGGAAGGAAACATGGCTGCTGG + Intergenic
1165825701 19:38704661-38704683 CAGGAGAAGGAGCTGGCTGCGGG + Intronic
925030557 2:647437-647459 CAGGCCAGGAACAAGGGTGCAGG + Intergenic
925192065 2:1892814-1892836 CAGGCCCAGAAGGTGGCTGCCGG - Intronic
926034881 2:9628910-9628932 CCGGACAAAATCATGGCTGATGG - Intronic
926309762 2:11667038-11667060 CAGGACAAGAACATGGCTGCTGG - Intronic
926506478 2:13721986-13722008 CCGGACAAGAACCTGGCAGGGGG + Intergenic
927076287 2:19581108-19581130 AGGGTCAAGAACATGGCAGCTGG + Intergenic
927683959 2:25158239-25158261 CATGACCAGAAAATGGCAGCTGG + Exonic
927867014 2:26595689-26595711 CAGGACAAGAAAATTGATGCAGG - Intronic
928338291 2:30417881-30417903 CAGGACAGGAAGATTGCTTCAGG + Intergenic
930014483 2:46960933-46960955 AATGCCAAGAAAATGGCTGCAGG - Intronic
933544689 2:83695337-83695359 CTGGACAAGAACCTGGGTGTCGG - Intergenic
933943320 2:87263457-87263479 CATGACAAGAACAGGGATTCTGG - Intergenic
936038563 2:109130702-109130724 CAGGAGAAGACCTTGGCTTCTGG - Intronic
936336894 2:111598104-111598126 CATGACAAGAACAGGGATTCTGG + Intergenic
937928875 2:127189323-127189345 CAGTACAGGAACATGCCTGAAGG - Intronic
941144809 2:161831863-161831885 CAGAACATGAAGATGGCTGTTGG + Intronic
941166436 2:162087861-162087883 AAGGACAAGAACAGGGCTGGAGG + Intergenic
944317707 2:198301030-198301052 CAGGACAAGGAGATGGTTCCTGG - Intronic
947605261 2:231481952-231481974 AAAGACAGGAAGATGGCTGCAGG - Intronic
948793757 2:240391913-240391935 CAGGCCAGGGGCATGGCTGCAGG - Intergenic
949076752 2:242064100-242064122 CAGGATCAGGACATAGCTGCTGG + Intergenic
1169584157 20:7061131-7061153 CAGGACATCTGCATGGCTGCAGG - Intergenic
1170065666 20:12307320-12307342 CAATAAAAGAACATGGCTTCAGG + Intergenic
1172303164 20:33863676-33863698 TATGACAAAAACATGGCTTCTGG - Intergenic
1172408671 20:34706961-34706983 CAGGACTAGAGCTTGGCTGGGGG - Intronic
1172777266 20:37414938-37414960 GAGGACAAGGTCATGTCTGCAGG - Intergenic
1173226498 20:41165242-41165264 CAGCACAAGAAGCTGGCTGAGGG + Exonic
1178627644 21:34231643-34231665 CTGGACAAGAAAATGCCTCCAGG - Intergenic
1178718579 21:34988753-34988775 CAGGACAGGATTATGGGTGCCGG - Intronic
1179391955 21:41002242-41002264 GAGGACAAAAACAAGGGTGCTGG - Intergenic
1181402000 22:22655301-22655323 CAGCAGAATAACATGGCTGCAGG - Intergenic
1181596995 22:23922189-23922211 CAGGGCCAGAAAATGGGTGCTGG - Intergenic
1182391181 22:29998106-29998128 TAGGACAAGAGCATGGCTTCTGG + Intronic
1183979309 22:41530480-41530502 CAGTAAAGGTACATGGCTGCTGG - Intronic
1184144307 22:42599863-42599885 CATGGCAAGGAAATGGCTGCTGG + Intronic
1184927246 22:47651477-47651499 CAGGGCAAGAACAGGGTGGCAGG + Intergenic
1185058031 22:48591454-48591476 CAGGGCAAGGCCATGGCTGCAGG - Intronic
1185408464 22:50671019-50671041 CAGGACAGAAACGTGCCTGCGGG + Intergenic
950565826 3:13768971-13768993 CAGGCCAAGCCCATGGCTGCTGG - Intergenic
951515929 3:23559565-23559587 CAGGACAGCCACAGGGCTGCTGG - Intronic
951625973 3:24663382-24663404 CAGACCATGAACATGTCTGCAGG + Intergenic
952807732 3:37372976-37372998 CAGGACAAGGACAGAGCTGCAGG - Intergenic
952862378 3:37824127-37824149 CAGAACAGGACCAGGGCTGCTGG + Intergenic
954296141 3:49675401-49675423 GGGGGCAAGAACCTGGCTGCTGG - Intronic
954444853 3:50541086-50541108 CAGGGCAAGGACTAGGCTGCTGG + Intergenic
954754238 3:52830595-52830617 CAGGACGAGAACTTTGCTGCAGG + Exonic
954789443 3:53120590-53120612 CAGGACAAAAGAATGGCTTCTGG + Intronic
956714656 3:72068005-72068027 CAGGAGGAGCACATGGCTGTTGG - Intergenic
958638312 3:96774452-96774474 CAAGGCAAGAAGATGGCTTCAGG + Intergenic
961819444 3:129567790-129567812 CAGAAGACGAACAGGGCTGCGGG + Exonic
964269473 3:154939896-154939918 CAGGCCAAGGACATGTCTGGGGG - Intergenic
964607914 3:158577740-158577762 CATGACTAGGACATGGTTGCTGG + Intronic
964780587 3:160332614-160332636 CAAGACAACAAAATGGATGCTGG + Intronic
965604422 3:170484691-170484713 CATGAGAAGAACAAGGTTGCTGG - Intronic
967782143 3:193451280-193451302 TAGGCCAAGAAAATGGCTGCAGG + Intronic
970599206 4:17627597-17627619 CTGGGCAGGAACATGGCGGCAGG - Exonic
971053099 4:22883136-22883158 CAGGACAATAACATGGTTCCTGG + Intergenic
980819801 4:137999366-137999388 CAGGATGAGAAAATGGGTGCTGG + Intergenic
981264630 4:142767618-142767640 CATGACAAGATCTTGGATGCAGG + Intronic
982155437 4:152515917-152515939 CATGGCAAGAACATGGTGGCGGG + Intronic
984098039 4:175455397-175455419 ATGGACAAGAACCTGGGTGCAGG - Intergenic
986980969 5:13447760-13447782 CAGAACAAGATCATGTTTGCAGG - Intergenic
987294062 5:16534652-16534674 CAGAAAAGGAACATGGCAGCTGG - Intronic
989005587 5:36808486-36808508 CTGGATAAGAACTTGGCTCCTGG - Intergenic
994136077 5:96288426-96288448 GAGGAAAGGAGCATGGCTGCAGG - Intergenic
996242079 5:121216005-121216027 CTGGACAACAACCTGGGTGCGGG + Intergenic
998186130 5:139981386-139981408 CAGGCCAGGGCCATGGCTGCTGG - Intronic
998715230 5:144875974-144875996 CATAACAAGAACATGGCTGAAGG + Intergenic
1001184969 5:169561637-169561659 CAGAAGAAGAACTTGACTGCTGG - Intergenic
1001637964 5:173226270-173226292 CAGGCCAAGAAGAAAGCTGCTGG - Intergenic
1002368063 5:178729012-178729034 CAGAAAGAGGACATGGCTGCTGG - Exonic
1002385263 5:178861036-178861058 CAGAAAGAGGACATGGCTGCTGG + Exonic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1002695803 5:181087526-181087548 AAGGACAAGAAACTGGCCGCGGG + Intergenic
1003646167 6:7914517-7914539 GAGGACAAGCAGATTGCTGCAGG - Intronic
1005928026 6:30460870-30460892 CAGGACAATAACATTGTTTCTGG + Intergenic
1007855952 6:44857720-44857742 CAGGACAAAAACATTACAGCTGG + Intronic
1008595653 6:53039420-53039442 CTGGGCAAGAACTTGGGTGCAGG + Intronic
1010851296 6:80781508-80781530 CAGGACTAGGGCATGTCTGCAGG + Intergenic
1012077682 6:94713112-94713134 CAAAACAAGAACCTGTCTGCTGG + Intergenic
1015355823 6:132275803-132275825 AAGCACAACAATATGGCTGCCGG + Intergenic
1015455590 6:133423869-133423891 CAGGACAAGAACCTGGGTAAAGG - Intronic
1019029211 6:168995688-168995710 CAGGCCAAGAAAATGCCTGCAGG + Intergenic
1019651278 7:2160290-2160312 GAGAACAAGAACATGGCAGGAGG + Intronic
1019695126 7:2441397-2441419 AATGATAAGAATATGGCTGCAGG + Intergenic
1020832498 7:13109760-13109782 CAGGACAAGAACGTGAATGGTGG - Intergenic
1021054299 7:16027805-16027827 CAACACAAGAAGAGGGCTGCTGG + Intergenic
1021853927 7:24834680-24834702 CCGGAGAAGAACGTGCCTGCCGG - Exonic
1023356598 7:39373411-39373433 CAGAACAGGAACATGACTGTTGG - Intronic
1024973722 7:55094232-55094254 CAGGATAAGAAGCTGGATGCTGG - Intronic
1027045189 7:74986517-74986539 AAAAAAAAGAACATGGCTGCAGG + Intronic
1029239077 7:99145699-99145721 TAGGACAGGCACAAGGCTGCAGG - Intergenic
1030798900 7:113825029-113825051 CAGGAGGAGAACCTGACTGCAGG - Intergenic
1032580588 7:133099751-133099773 CAGGAAAAGAACATGGGACCAGG - Intergenic
1034528154 7:151679126-151679148 CAGGACCACAAAAGGGCTGCCGG + Intronic
1037874583 8:22535180-22535202 CTGGAATAGAATATGGCTGCAGG - Intronic
1039184726 8:34904504-34904526 CAGGGCAAAAGCATGACTGCAGG + Intergenic
1040594403 8:48823469-48823491 CAAGACAAAGACATGTCTGCAGG - Intergenic
1041360635 8:57049763-57049785 CAGGACAAGAACTTGGGGACTGG + Intergenic
1043197469 8:77315703-77315725 GGGGACATGAACATGGCTACAGG - Intergenic
1043244409 8:77979460-77979482 CAAGACAGCAACCTGGCTGCGGG - Intergenic
1043277830 8:78422347-78422369 AAGGAAAAAAACATGGATGCTGG + Intergenic
1043513078 8:80969111-80969133 CAAGACATGAGCATTGCTGCAGG + Exonic
1047762446 8:127964111-127964133 CAGGACAAGCAGATGGGTTCAGG + Intergenic
1049215298 8:141405108-141405130 CAAGTCACGAACAGGGCTGCAGG + Intronic
1052501557 9:29298346-29298368 TAGGACAAGAATGAGGCTGCAGG + Intergenic
1053370491 9:37557502-37557524 CAAGCCAAGAACATGGTTGGAGG - Intronic
1057216889 9:93234033-93234055 CAGGGCAAGATGATGTCTGCAGG - Intronic
1059243737 9:112831670-112831692 CCTGACAGGAACATGGTTGCAGG - Intronic
1060015433 9:120082558-120082580 CAGGCTAAGAAACTGGCTGCTGG - Intergenic
1060067877 9:120519772-120519794 CAGGACTAGGACATGGCAGTGGG - Intronic
1060633636 9:125182407-125182429 CAAGGCAAGAAGATGGCTGGAGG + Intronic
1060867321 9:127010661-127010683 GAGGCCAAGAACATGGCTGCAGG + Intronic
1062361550 9:136190654-136190676 CTGGAGAAGCACATGCCTGCTGG + Intergenic
1062491761 9:136808245-136808267 CGGGACAAGAACATCCCCGCCGG + Exonic
1185776996 X:2811283-2811305 CGAGAAAAAAACATGGCTGCAGG - Intronic
1187395084 X:18912387-18912409 CAGTACAGGAACATGGATACAGG - Intronic
1187695963 X:21920672-21920694 CAGGATAATAAGATGGCAGCTGG - Intergenic
1187863670 X:23704578-23704600 CAGCACAAGAGCATGTCTTCAGG - Intronic
1189737594 X:44087402-44087424 CAGGACAAAGACCTGGCTTCTGG + Intergenic
1189821539 X:44873612-44873634 GAGGAAAAGAAAATGGCGGCGGG + Exonic
1192765148 X:74132430-74132452 CAGGGCAAGAATAAGACTGCAGG - Intergenic
1198134174 X:133730842-133730864 CAGAACTAAAACATGGCTTCTGG - Intronic
1200181982 X:154156179-154156201 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1200187631 X:154193293-154193315 CAGGGCTGGAAGATGGCTGCTGG + Intergenic
1200193280 X:154230433-154230455 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1200199035 X:154268237-154268259 CAGGGCTGGAAGATGGCTGCTGG + Intronic