ID: 926310282

View in Genome Browser
Species Human (GRCh38)
Location 2:11669952-11669974
Sequence GTCCGCGCACGTGGTGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926310282_926310291 26 Left 926310282 2:11669952-11669974 CCTTCAGCACCACGTGCGCGGAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926310291 2:11670001-11670023 CCAGATGAGTGCGTAGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926310282 Original CRISPR GTCCGCGCACGTGGTGCTGA AGG (reversed) Exonic