ID: 926310282

View in Genome Browser
Species Human (GRCh38)
Location 2:11669952-11669974
Sequence GTCCGCGCACGTGGTGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926310282_926310291 26 Left 926310282 2:11669952-11669974 CCTTCAGCACCACGTGCGCGGAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926310291 2:11670001-11670023 CCAGATGAGTGCGTAGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926310282 Original CRISPR GTCCGCGCACGTGGTGCTGA AGG (reversed) Exonic
904161247 1:28523638-28523660 GTCAGCACAGTTGGTGCTGATGG - Intronic
922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG + Intergenic
1070677846 10:78424824-78424846 CTCTGCTCATGTGGTGCTGAGGG + Intergenic
1078586905 11:12599617-12599639 CTCCGCGCTCGTGGAGCAGAAGG - Intergenic
1105323261 13:19347219-19347241 GTGCGCGCACTTGGTGGGGAGGG - Intergenic
1113981838 13:114282430-114282452 GTCCGCGGACGGGGCGCTGCGGG + Intronic
1122959249 14:105087132-105087154 GTCCGTGGACGGCGTGCTGAGGG - Intergenic
1125598028 15:40899865-40899887 GACCGGGCAGGTGGTGCTGCGGG + Exonic
1131171095 15:90178796-90178818 GACAGCCCAGGTGGTGCTGAGGG + Intronic
1131596568 15:93803915-93803937 GTGCGTGCACGTGGTGGTGGGGG + Intergenic
1131847692 15:96505221-96505243 GTTCCAGCACGTGGTGCAGAAGG + Intergenic
1131977494 15:97960975-97960997 GGCCGGGCACGTGCTGCTGGAGG + Exonic
1148856260 17:50580736-50580758 GTCCGCATACCTGGTGCTGAGGG + Intronic
1152399796 17:80059027-80059049 GTCCACGCACAGGGTGCTGGTGG + Intronic
1152618458 17:81348725-81348747 GTCTGACCACGTGCTGCTGATGG + Intergenic
1160327884 18:77967455-77967477 GTCCAAGCTCGTGGTGCTGTGGG - Intergenic
1164680652 19:30131730-30131752 GCCCGGGCAGCTGGTGCTGATGG + Intergenic
1167758642 19:51429148-51429170 GTTGGCGCACGTGGTGGTGATGG + Intergenic
926310282 2:11669952-11669974 GTCCGCGCACGTGGTGCTGAAGG - Exonic
937337629 2:121071585-121071607 GTGCACCCACCTGGTGCTGATGG - Intergenic
948670689 2:239566802-239566824 TACCACGCATGTGGTGCTGATGG + Intergenic
1183455265 22:37919085-37919107 GGCTGCGCACGTGCTGCTGGGGG - Exonic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
968883867 4:3317069-3317091 GTCCGGGCACACGGCGCTGAAGG - Exonic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
978561835 4:110042188-110042210 GTCCGCGCCCGTGGTGGGGCAGG + Intergenic
1004551356 6:16651170-16651192 GTCCAGGCAAGTGATGCTGAAGG + Intronic
1016101629 6:140108551-140108573 GTCAGCTCACGTGGTACAGAGGG - Intergenic
1017079499 6:150654192-150654214 GTCCAGGCACCGGGTGCTGAGGG + Intronic
1019701568 7:2476922-2476944 GTCTGACCACGTGGTGCTGCAGG + Intergenic
1032479911 7:132238049-132238071 GTCCCCGAATGTAGTGCTGAAGG + Intronic
1045602387 8:103732708-103732730 GTCCGCGGTGGTGGTGATGAAGG - Intronic
1049539750 8:143202888-143202910 GTCCCTGGTCGTGGTGCTGATGG - Intergenic
1060791481 9:126488540-126488562 TTCCTCCCACGTGGTGCAGAGGG - Intronic
1194382007 X:93204946-93204968 GACCGTGAACGTGGTGCTGGTGG - Intergenic
1200235859 X:154467450-154467472 GGGCTCCCACGTGGTGCTGAAGG + Exonic