ID: 926310291

View in Genome Browser
Species Human (GRCh38)
Location 2:11670001-11670023
Sequence CCAGATGAGTGCGTAGAGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926310285_926310291 -7 Left 926310285 2:11669985-11670007 CCGCCGCGCCCAGCGCCCAGATG 0: 1
1: 1
2: 11
3: 100
4: 952
Right 926310291 2:11670001-11670023 CCAGATGAGTGCGTAGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 45
926310284_926310291 -6 Left 926310284 2:11669984-11670006 CCCGCCGCGCCCAGCGCCCAGAT 0: 1
1: 0
2: 0
3: 11
4: 187
Right 926310291 2:11670001-11670023 CCAGATGAGTGCGTAGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 45
926310282_926310291 26 Left 926310282 2:11669952-11669974 CCTTCAGCACCACGTGCGCGGAC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926310291 2:11670001-11670023 CCAGATGAGTGCGTAGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 45
926310283_926310291 17 Left 926310283 2:11669961-11669983 CCACGTGCGCGGACAGCGCATTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 926310291 2:11670001-11670023 CCAGATGAGTGCGTAGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 45
926310286_926310291 -10 Left 926310286 2:11669988-11670010 CCGCGCCCAGCGCCCAGATGAGT 0: 1
1: 0
2: 3
3: 14
4: 180
Right 926310291 2:11670001-11670023 CCAGATGAGTGCGTAGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926310291 Original CRISPR CCAGATGAGTGCGTAGAGCG CGG Exonic