ID: 926310356

View in Genome Browser
Species Human (GRCh38)
Location 2:11670250-11670272
Sequence GGGTGTCCCTGAGCCAACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926310343_926310356 26 Left 926310343 2:11670201-11670223 CCTCCTCTTCTCTGGGAACCTCT 0: 1
1: 2
2: 2
3: 35
4: 479
Right 926310356 2:11670250-11670272 GGGTGTCCCTGAGCCAACGTGGG 0: 1
1: 0
2: 3
3: 8
4: 102
926310348_926310356 8 Left 926310348 2:11670219-11670241 CCTCTAGAACTGGGAGGACACGC 0: 1
1: 0
2: 2
3: 11
4: 122
Right 926310356 2:11670250-11670272 GGGTGTCCCTGAGCCAACGTGGG 0: 1
1: 0
2: 3
3: 8
4: 102
926310344_926310356 23 Left 926310344 2:11670204-11670226 CCTCTTCTCTGGGAACCTCTAGA 0: 1
1: 0
2: 3
3: 15
4: 191
Right 926310356 2:11670250-11670272 GGGTGTCCCTGAGCCAACGTGGG 0: 1
1: 0
2: 3
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926310356 Original CRISPR GGGTGTCCCTGAGCCAACGT GGG Intergenic
900176407 1:1293319-1293341 GGGTGTCCCTCACCCCACCTGGG - Exonic
900527967 1:3138387-3138409 GGCTGTCCCTGAGCAACCCTGGG + Intronic
902922062 1:19672021-19672043 GGGTGGCACTGAGCCATCCTTGG + Intronic
903619632 1:24688631-24688653 GTGTGTCCCTGAGCTAACTCAGG - Intergenic
906060139 1:42943191-42943213 TGGTGTCCATAAGCCAACGATGG + Intronic
915145651 1:153794537-153794559 AGATGTCCCTGAGCCAACCAAGG + Intergenic
918296772 1:183164576-183164598 GGCTGTGCCTGACCCAAGGTGGG + Intergenic
920409676 1:205749661-205749683 GGGTGTCCCTGAGCCGCCAGCGG - Intronic
922202926 1:223421661-223421683 GTGTGTCCCTGTGACAAAGTAGG - Intergenic
922796397 1:228341770-228341792 GGTTGGCCCTGATCCAAGGTCGG + Intronic
923309657 1:232723922-232723944 GGAAGTCCTTGAGCCAAAGTTGG - Intergenic
923650709 1:235870488-235870510 GGGAGTCTCTGAGCCTACCTTGG + Intronic
1070919467 10:80175124-80175146 GGGTGTCCCTGAGGCTGGGTGGG + Intronic
1072700816 10:97640450-97640472 GGGCGTGCCTGACCCAAGGTTGG + Intronic
1074361215 10:112825305-112825327 GGGTGTGCCTGTGCCCAGGTTGG - Intergenic
1075558461 10:123449974-123449996 GGGTGTCACTGACTCAACCTGGG - Intergenic
1076816475 10:132917457-132917479 GGGAGTCTCTGAGCCTGCGTGGG + Intronic
1076829347 10:132986214-132986236 GGGTGTCCCTGAGGGAGGGTTGG + Intergenic
1077531119 11:3095519-3095541 GGGGGCCCCTGAGCCAACTATGG + Intronic
1080614659 11:33935540-33935562 CGGAGTCCTTGAGCCAAAGTTGG + Intergenic
1083892738 11:65604845-65604867 GTGGGTCCCTGTGCCAACCTAGG - Intronic
1089749872 11:120643397-120643419 GGGTGTGCCTGAGGCACCGTGGG + Intronic
1091217526 11:133912135-133912157 GGGTGTCATGGAGCCATCGTGGG - Intronic
1093019301 12:14188260-14188282 GGGTATCCCTGCGCCAATATGGG + Intergenic
1095194738 12:39300232-39300254 GGGTGTCCCACAGCCAATGTGGG + Intronic
1097985012 12:65773760-65773782 CAGTGTCCCTGAGCCTAGGTTGG - Intergenic
1102523639 12:113495045-113495067 TGGTGTCCCTGAGACACCTTGGG + Intergenic
1104031255 12:125066789-125066811 GGGAGTCCCTGCGCCAGCGGAGG - Intronic
1105913218 13:24890641-24890663 GGCTGTACCTGGGCCAACCTGGG - Intronic
1107836730 13:44417671-44417693 GGGCGTCCCTCAGCCACAGTGGG + Intergenic
1113885642 13:113657190-113657212 GGGGGTCCCAGAGCCGAGGTGGG - Intronic
1115755193 14:36521729-36521751 GCGTCTCCCTGCGCAAACGTAGG - Intergenic
1120880105 14:89409004-89409026 GGGTGTACCTGAGCATACCTGGG + Intronic
1121021663 14:90584027-90584049 GGGTGTCCCAGAGCACACGCAGG - Intronic
1122873560 14:104652293-104652315 GGGGCTCCCTGAGCCAACGTGGG - Intergenic
1123551789 15:21386390-21386412 GGGTGCCCCTGAGCGAAGGGGGG - Intergenic
1124516617 15:30371986-30372008 TGGTGTCCTGGAGCCACCGTGGG + Intronic
1124726302 15:32158745-32158767 TGGTGTCCTGGAGCCACCGTGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1126317545 15:47386569-47386591 GGGAGTCCTGGAGCCAAGGTTGG + Intronic
1128529239 15:68432500-68432522 AGGTGTTCCTGAGCCAGCTTGGG - Intergenic
1130050372 15:80479201-80479223 TGGGGTCCCTGAGCCAACATGGG - Intronic
1130919291 15:88330629-88330651 GGGTGTCGCTGAGACAGGGTGGG + Intergenic
1141744762 16:85918498-85918520 GCCTGTCCCTGAGCCAGCCTGGG + Exonic
1142500701 17:331412-331434 GGGTGGCCCTGAGCAAAGGTCGG + Intronic
1151004965 17:70424048-70424070 GGGTCTCACTGAGCAAAAGTTGG + Intergenic
1152437472 17:80285257-80285279 GTGGGTCACTGAGCCACCGTGGG - Intronic
1152756753 17:82090247-82090269 GGGTGTCCCCGGGCCAGCGGGGG + Intronic
1160967151 19:1751779-1751801 GGGTGTCTCTGGCCCAAGGTGGG - Intergenic
1162812539 19:13172863-13172885 GGGGGGCCCTGAGCCAGTGTGGG + Intergenic
1164145763 19:22511580-22511602 AGGTGTCCCTGAGCCATCCCAGG + Intronic
1168003645 19:53468288-53468310 GGCTTCCCCTGAGCCCACGTTGG + Intronic
1168139187 19:54373810-54373832 GGGTGTCCCTGAGTCATCCTGGG - Intergenic
1168158819 19:54494428-54494450 GGATGTCCCTGAGTCATCCTGGG + Intergenic
925935359 2:8752490-8752512 GGGTGACCCTTAGCCAGCTTAGG - Intronic
926310356 2:11670250-11670272 GGGTGTCCCTGAGCCAACGTGGG + Intergenic
926524176 2:13955797-13955819 AGCTGTACCTAAGCCAACGTTGG - Intergenic
929901252 2:46005600-46005622 GTGTGTCCCTCAGCCAGCATGGG - Intronic
931705313 2:64942112-64942134 GGGAGTCCCTGAGCCAAAGCTGG - Intergenic
932713150 2:74082464-74082486 GGGTGTCACTGAGCCCTGGTGGG + Intronic
944479283 2:200138814-200138836 TGGTGCCCCTAATCCAACGTAGG + Intergenic
948855345 2:240727709-240727731 GGCTGGCCCTGAGCCACCCTGGG - Intronic
949039610 2:241841856-241841878 GGGGGTCCCTCAGCCAAGGCGGG - Intergenic
949050766 2:241896247-241896269 GGGTGACCCTGAGCCGACCCAGG - Intronic
1170149693 20:13216735-13216757 GGGTGTTCTTGGGCAAACGTAGG + Intergenic
1174343784 20:49915140-49915162 GGGCGGCCCTGAGCCACCCTCGG + Intronic
1175972369 20:62693161-62693183 GGGTGTCCCTGAGGGTACCTTGG - Intergenic
1180008556 21:45034721-45034743 GCCTGTCCCTGAGCCACCCTGGG - Intergenic
1183671126 22:39273516-39273538 AGGTGTCCCTGCCCCAAGGTGGG + Intergenic
1183724389 22:39580474-39580496 GGCTGTCCCTGATCCAACCTGGG + Intronic
1184843085 22:47063916-47063938 GGGGGGCCCTGATCCAACGATGG - Intronic
1185219823 22:49623733-49623755 CTGTGTCCCTCACCCAACGTGGG - Intronic
950484770 3:13266687-13266709 GGGTCTCCCTGTGCCTACCTTGG - Intergenic
954454241 3:50588468-50588490 AGGTGCCCCACAGCCAACGTGGG + Intergenic
954755187 3:52835369-52835391 GGGTGTCCCTGAGGGAATGGAGG + Exonic
957312636 3:78540343-78540365 GGGTCTTCCTGAGGCAAGGTAGG + Intergenic
958751416 3:98196216-98196238 GGGTGTCCCTCAGACACTGTGGG - Intronic
962009875 3:131382200-131382222 GCGTGGCCCTGACCCGACGTGGG - Exonic
962929943 3:140026890-140026912 GCAGGTCCCTGAGCCAAGGTGGG + Intronic
963844788 3:150144272-150144294 GGGTGTCACTGAACCAAACTGGG - Intergenic
963946888 3:151155552-151155574 GGGTGTCCCTGACACATCCTGGG + Intronic
969179145 4:5424008-5424030 AGGTGCCCCTGAGCCTACGGGGG - Intronic
969316460 4:6384137-6384159 GGGTGTCCCTGGGCCAGGGCAGG - Intronic
969572848 4:8020184-8020206 GCGTGTCCCGGAGCCTACCTGGG + Exonic
973004375 4:44990202-44990224 TGGTGTCTCTGAGTCAATGTTGG - Intergenic
973872847 4:55184045-55184067 GGGTGTCCCTGAGCAAGCTGTGG - Intergenic
985728092 5:1526163-1526185 GGTTGTCCTTGAGCCAAGGTCGG + Intergenic
989701342 5:44268831-44268853 GGGTCTCCCTGAGCCAAAGTAGG + Intergenic
1001243006 5:170084345-170084367 AGGTGTCCCAGAGACAATGTAGG - Intergenic
1006024426 6:31138219-31138241 GGGGGGCCCTGAGGCAATGTTGG + Exonic
1006509076 6:34512107-34512129 GGGTGTCCCTGTGCCAGCGTGGG + Intronic
1007452083 6:41947826-41947848 GGGTCTCCCTGACCCACCCTTGG + Intronic
1015182591 6:130377193-130377215 GGGACTCCCTGAGTCTACGTTGG + Intronic
1016832069 6:148444155-148444177 GGGGGTCCCTGAGACAAGCTGGG - Intronic
1021469270 7:20982876-20982898 GGGTGCCCCTGAGCAAACTGTGG - Intergenic
1022814175 7:33898275-33898297 GGGTGACCCTGAGTAAATGTTGG - Intergenic
1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG + Intronic
1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG + Intergenic
1031056881 7:117001598-117001620 GGTTGTTCCTGGGCCAACCTTGG + Intronic
1032139071 7:129309911-129309933 TGGTGTCCCAGATCCAAGGTGGG - Intronic
1032852708 7:135808859-135808881 GGGTGGCCCTGAGCCATCACAGG - Intergenic
1035301527 7:157900696-157900718 GGGTGCCCCTGAGCACATGTAGG - Intronic
1037993337 8:23336155-23336177 GGGTTTTCCTGAGCCAAGGCAGG - Intronic
1037997182 8:23361351-23361373 GGCTGTCTCTGAGCCAGCGATGG - Intronic
1039793227 8:40891735-40891757 GGGTGTCCCTGTGCTAACAAAGG - Intronic
1039796875 8:40923287-40923309 GGGTGACCCTGAGGCACAGTAGG + Intergenic
1048982414 8:139709893-139709915 GGGTGTCCTTGTGGCCACGTGGG + Intergenic
1053251835 9:36580666-36580688 GGGTGTCTCTGAGCCTACTCTGG - Intronic
1056792481 9:89634938-89634960 GGGTGTTCCTGGGCAAACTTGGG + Intergenic
1061792669 9:133066765-133066787 GGGTGTCCTTGTCCCAGCGTGGG + Intronic
1187739717 X:22342320-22342342 GGATGTCCCCCAGCCAACCTTGG + Intergenic
1190624223 X:52320873-52320895 GGGAATCCTTGAGCCAAAGTTGG - Intergenic
1197029432 X:121796317-121796339 GGGAGTTCTTGAGCCAAAGTTGG + Intergenic
1199501293 X:148509472-148509494 GGTTGTCCCTCAGCAAATGTTGG - Intronic