ID: 926311599

View in Genome Browser
Species Human (GRCh38)
Location 2:11679720-11679742
Sequence CGCACAGAGACTGCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926311599_926311607 2 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311607 2:11679745-11679767 GCCCATGGCCTTTTGCCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 151
926311599_926311616 28 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311616 2:11679771-11679793 GCAGGCCTCCATGGCTCTGAAGG 0: 1
1: 0
2: 2
3: 22
4: 305
926311599_926311605 0 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311605 2:11679743-11679765 GTGCCCATGGCCTTTTGCCTTGG 0: 1
1: 0
2: 1
3: 35
4: 291
926311599_926311615 19 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311615 2:11679762-11679784 TTGGGGGAGGCAGGCCTCCATGG 0: 1
1: 1
2: 2
3: 41
4: 310
926311599_926311617 29 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311617 2:11679772-11679794 CAGGCCTCCATGGCTCTGAAGGG 0: 1
1: 0
2: 2
3: 13
4: 286
926311599_926311611 6 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311611 2:11679749-11679771 ATGGCCTTTTGCCTTGGGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 190
926311599_926311606 1 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311606 2:11679744-11679766 TGCCCATGGCCTTTTGCCTTGGG 0: 1
1: 0
2: 0
3: 24
4: 191
926311599_926311613 10 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311613 2:11679753-11679775 CCTTTTGCCTTGGGGGAGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 225
926311599_926311609 3 Left 926311599 2:11679720-11679742 CCTGCCCCGGCAGTCTCTGTGCG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 926311609 2:11679746-11679768 CCCATGGCCTTTTGCCTTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926311599 Original CRISPR CGCACAGAGACTGCCGGGGC AGG (reversed) Intronic
900176653 1:1294128-1294150 ACCAAAGAGACAGCCGGGGCCGG - Exonic
900227178 1:1538800-1538822 TGCACAGAGACCCCCGGAGCAGG + Intronic
901730204 1:11273468-11273490 CGCACAGTGACCGCCCGGGAAGG - Exonic
902236422 1:15060341-15060363 TGCCCAGAAACTGCAGGGGCGGG + Intronic
903041352 1:20533153-20533175 CGCGCAGAGTGTGCTGGGGCAGG + Intergenic
904037996 1:27568955-27568977 CGCACAAAGCCTGCCAGGGTGGG + Intronic
904697255 1:32337347-32337369 CGGACACAGACATCCGGGGCCGG - Intergenic
904840290 1:33368087-33368109 CGCACAGATACTACCGTGGCTGG - Intronic
906182857 1:43836734-43836756 GGCTCCGTGACTGCCGGGGCTGG - Intronic
907268042 1:53274723-53274745 TGCAGAGGGACTGCCGGGACTGG - Intronic
907408778 1:54270357-54270379 CGCACAGGAGCTGCCGGGGGAGG - Intronic
909514310 1:76490072-76490094 CTCCCAGAGGCTGTCGGGGCAGG - Intronic
912517884 1:110227291-110227313 CCCACAGAGCCTGCATGGGCTGG - Intronic
913144609 1:115976781-115976803 CGCTCCCAGACCGCCGGGGCCGG + Intronic
914879107 1:151534049-151534071 GGCCCAGCGACTGCAGGGGCTGG + Exonic
915279683 1:154813970-154813992 CACACAGAGACTGCCAGGGCTGG + Intronic
922155947 1:223039661-223039683 CCCACAGAGACAGCTGGGCCAGG + Intergenic
924524645 1:244835463-244835485 GGCACACAGCCTGCAGGGGCGGG - Exonic
924678298 1:246203546-246203568 CGCAGAGGGACTGCCGTGTCAGG - Intronic
1067531738 10:47079127-47079149 CTGACAGAGACTTCTGGGGCTGG + Intergenic
1069748316 10:70730089-70730111 GGCTCAGGGACTGCAGGGGCCGG - Exonic
1070307418 10:75247954-75247976 CCCAGAGAGGCTGCCAGGGCTGG - Intergenic
1076207565 10:128615283-128615305 GGCAGGGAGACTGCAGGGGCTGG + Intergenic
1076734409 10:132452292-132452314 CACCCAGAGACTGCAGGGTCGGG - Intergenic
1076785571 10:132748187-132748209 AGCAAGGAGACTGCGGGGGCCGG - Intronic
1077103558 11:832594-832616 CGCCCAGAGGCTGCAGGGGTCGG - Intergenic
1078902081 11:15650890-15650912 TGCTCAGAGGCTGCCAGGGCAGG - Intergenic
1079078953 11:17400713-17400735 GTCACACAGACTGCGGGGGCTGG - Intronic
1080802180 11:35618912-35618934 CGCTCCGGGACTGCCGGGGCGGG - Exonic
1082179715 11:49102724-49102746 CGGAGAGAGACGGACGGGGCAGG + Intergenic
1084676584 11:70639066-70639088 CTCACAGAGCCAGCCTGGGCTGG + Intronic
1086685568 11:89730188-89730210 CGGAGAGAGACAGACGGGGCAGG - Intergenic
1087051428 11:93889873-93889895 GGCACAGACACTGGAGGGGCTGG - Intergenic
1088981842 11:114871295-114871317 GGCACAGAAACTGCCCGGGGGGG + Intergenic
1089393378 11:118117270-118117292 AGAACAGAGACTGCTGGGGAGGG - Intronic
1091393758 12:141333-141355 CTCACAGAGAGAGCCCGGGCAGG - Intronic
1096850204 12:54430641-54430663 CACACAGGGACTCCCTGGGCTGG + Intergenic
1103327799 12:120133081-120133103 CCCACAGAGAAGGCTGGGGCTGG + Intronic
1104980703 12:132572026-132572048 GGCACACAGACTGCCTGGGGGGG + Intronic
1105833953 13:24192421-24192443 GGCACAGAGACTGAAGGGGCAGG - Intronic
1107417311 13:40212577-40212599 AGCACAGAGTCTGTCGGGGGAGG - Intergenic
1113428960 13:110232654-110232676 GGGACAGAGGCTGCCGGTGCTGG + Intronic
1117495998 14:56304715-56304737 CGCAGCTAGACTGACGGGGCAGG - Intergenic
1117575353 14:57092047-57092069 AGCAGAGAGACTGGCGTGGCAGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1120789083 14:88562977-88562999 CGCGCAGTGCCGGCCGGGGCGGG + Exonic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1122786839 14:104167861-104167883 GGCACAGAGCCTCCCGGGCCTGG - Intronic
1122880485 14:104688637-104688659 CGCACAGGGAGTGCTGGCGCCGG + Intergenic
1124109151 15:26771832-26771854 CGGACAGAGACTGGCGGTGCCGG + Intronic
1136115475 16:28091710-28091732 CTCACAGAGCCTGCCTGGGGAGG - Intergenic
1136617953 16:31410254-31410276 GGCACAGAGGCTGCTGGTGCGGG + Intronic
1139287474 16:65828487-65828509 TGCACAGAGCCTGCGGGGGAGGG - Intergenic
1139381754 16:66536862-66536884 AGCGCAGAGAATGCCTGGGCAGG + Intronic
1142196342 16:88740942-88740964 AGCTCAGAGATTCCCGGGGCCGG + Intronic
1142232037 16:88904579-88904601 CGAACGGAGGCTGCAGGGGCAGG + Intronic
1142585126 17:967358-967380 GGCGCAGAGACAGGCGGGGCGGG + Intronic
1144620707 17:16816738-16816760 AGCAAAGTGACTGCCAGGGCAGG + Intergenic
1144884935 17:18451409-18451431 AGCAAAGTGACTGCCAGGGCAGG - Intergenic
1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG + Intronic
1146891121 17:36507072-36507094 CGCATTGAGACTGCCCTGGCAGG - Exonic
1147572097 17:41577636-41577658 AGCAAAGTGACTGCCAGGGCAGG + Intergenic
1148213296 17:45820831-45820853 CTCACAGAGGCTGCCGTGGGAGG - Intronic
1149585677 17:57784612-57784634 CGCACAGATACAGCAGAGGCTGG - Intergenic
1149626530 17:58083962-58083984 CGCAGAGAGACTCCCGGGGGCGG - Intronic
1152101788 17:78305750-78305772 GGGACAGAGGCTGCAGGGGCTGG - Intergenic
1153358388 18:4164382-4164404 CGATCAGACACTGCCGGGGCTGG + Intronic
1155158478 18:23177479-23177501 CACACATAGACCGGCGGGGCTGG - Intronic
1155801915 18:30116430-30116452 ACCAAAGAGACTGCCTGGGCCGG - Intergenic
1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG + Exonic
1159887068 18:73918936-73918958 GGCCCAGATACTGCAGGGGCGGG - Intergenic
1160415014 18:78703677-78703699 CGCTCAGACACTGCAGAGGCAGG + Intergenic
1160631200 18:80247396-80247418 CGCAGAAAGACTCCCGGGGGCGG + Exonic
1162410004 19:10499964-10499986 GGCACTGTGACTGCAGGGGCAGG + Exonic
1163157650 19:15448235-15448257 CCCAGAGAGACTGCCTGGCCCGG - Exonic
1167042683 19:47032063-47032085 CTCACAGAGACAGACGGGCCAGG - Intronic
1167263078 19:48469815-48469837 AGCCCAGCGCCTGCCGGGGCCGG + Intronic
1167293684 19:48637523-48637545 CCCATAGAGGCTGGCGGGGCTGG - Intergenic
1167715792 19:51142199-51142221 CACACAGACACTGTCAGGGCTGG - Intergenic
1167762538 19:51458536-51458558 CACACAGACACTGTCAGGGCCGG + Intergenic
1167768951 19:51501879-51501901 CACACAGACACTGTCAGGGCCGG + Intergenic
1168725429 19:58578606-58578628 AGCACAGAGACTGGCCTGGCAGG + Intergenic
926311599 2:11679720-11679742 CGCACAGAGACTGCCGGGGCAGG - Intronic
926724227 2:15984743-15984765 CGCCCAGAGACTGGCAGGCCAGG - Intergenic
928823620 2:35392163-35392185 GAAACAGAGACTGCAGGGGCAGG + Intergenic
931668256 2:64625358-64625380 GGCAGAGAGGCTGCCTGGGCTGG - Intergenic
932279374 2:70476461-70476483 CACACAGAGACTGCAAAGGCAGG - Intronic
932414546 2:71565678-71565700 AGCACAGAGGATGCCAGGGCTGG + Intronic
936068200 2:109347977-109347999 GGCACAGAGGCTGCATGGGCTGG - Intronic
937955579 2:127420188-127420210 CACACAGGGGCTGCCAGGGCAGG + Intronic
948070123 2:235114160-235114182 AGCACTGGGAGTGCCGGGGCAGG - Intergenic
948858908 2:240743497-240743519 CTCAGAGAGACTTGCGGGGCTGG - Intronic
948934858 2:241157102-241157124 CGCACAGAGGATGCCGGCTCCGG + Intronic
1172961859 20:38805739-38805761 CCCACAGACACAGCCGGGGTCGG + Exonic
1173824892 20:46041911-46041933 TGCACAGAGAATGCCCGGGGGGG + Intronic
1175859561 20:62143130-62143152 AGCCCAGAGAGGGCCGGGGCCGG - Intronic
1175917643 20:62434321-62434343 CACACAGAGGCTGCCAGAGCTGG - Intergenic
1178257213 21:31065145-31065167 TGGGCAGAGTCTGCCGGGGCGGG + Intergenic
1180170718 21:46056891-46056913 AGCACAGAGACCCCCGGGCCGGG - Intergenic
1182100607 22:27655047-27655069 TGCACAGAGCCGGCCTGGGCGGG + Intergenic
1183418553 22:37697051-37697073 CGCACAGGGGCTGCCGGGGTGGG - Exonic
1183724788 22:39582515-39582537 ATCTCAGAGACTGCCTGGGCTGG - Intronic
1183936920 22:41267893-41267915 AGCACAGAGACTGACAGGGGAGG - Intronic
1185284060 22:49992364-49992386 TGAACAGAGACTGCAGAGGCAGG - Intergenic
1185315889 22:50178966-50178988 CCCACAGAGCCAGCCCGGGCAGG + Exonic
952851211 3:37731139-37731161 GACACAGAGACTGCAGGGTCTGG - Intronic
953999084 3:47542168-47542190 CTCAGAGAGACTCTCGGGGCAGG - Intergenic
954793567 3:53149830-53149852 CCCATAGAGACTTCCAGGGCAGG + Intergenic
958418582 3:93906485-93906507 AGCACAGAGACACCCGGGTCCGG - Intronic
961167688 3:124774864-124774886 CGCACAGTGACTTATGGGGCAGG + Intronic
961175785 3:124834092-124834114 AGCACAGGGACTTCCGGGGCAGG + Intronic
961368458 3:126415655-126415677 CGTGAAGAGACTCCCGGGGCCGG + Intronic
962265609 3:133942396-133942418 AGCACAGAGCCTCCCTGGGCAGG + Intronic
963903156 3:150751921-150751943 CTTACAGAGACTCCCAGGGCTGG + Intronic
964219175 3:154324468-154324490 CGCACAGTGGCTTCCGGGCCCGG - Exonic
966912964 3:184569472-184569494 CCCACAGAGACAGGCGGGGAGGG - Intronic
976593929 4:86876342-86876364 AGCGCAGCGACGGCCGGGGCCGG + Intronic
982288780 4:153759888-153759910 GGCACAGCGCCTGCCGGGGAGGG + Exonic
984837152 4:184032745-184032767 CTCACAGAGCCTGCAGTGGCTGG + Intergenic
990122268 5:52469960-52469982 AGCACAGAGACTCCCTGGGCTGG - Intergenic
997568122 5:134905036-134905058 CGCAGGGAGACTACCAGGGCTGG + Intronic
998406702 5:141878336-141878358 CGCCCAGAGCCAGCCGGAGCCGG - Exonic
1002536034 5:179876044-179876066 GGCACAGAGACAGCCGGGGAAGG + Intronic
1007451010 6:41940597-41940619 CGCACAGTCACTGCTGGGTCTGG + Intronic
1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG + Intronic
1018959885 6:168440944-168440966 GGCACAGAGACAGCCCGGACAGG + Intergenic
1019009179 6:168827633-168827655 AGCACAGAGACGCTCGGGGCAGG - Intergenic
1019293149 7:260200-260222 CGGACAGAGGCGGCCGGCGCCGG + Exonic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1021969243 7:25950980-25951002 CGCCCAGAGGCTCCCGGGGTTGG + Intergenic
1022843389 7:34186619-34186641 CTTACAGAGATGGCCGGGGCTGG + Intergenic
1024639837 7:51319440-51319462 GGCACAGAGCCTGGGGGGGCAGG + Intergenic
1034342719 7:150368697-150368719 CGGGGAGGGACTGCCGGGGCCGG - Intronic
1034342798 7:150368935-150368957 CGCAGAGGTACGGCCGGGGCAGG + Exonic
1035553553 8:546368-546390 CGCACAGGGAGGGCGGGGGCTGG + Intergenic
1035570964 8:671889-671911 AGCACAGACAGAGCCGGGGCTGG - Intronic
1036359131 8:8065344-8065366 GGGACAGCGACTGCCTGGGCGGG + Intergenic
1036891827 8:12601608-12601630 GGGACAGCGACTGCCTGGGCGGG - Intergenic
1038394030 8:27233411-27233433 GGCACAGAGACTCCCAGGGGAGG + Intergenic
1040661675 8:49582582-49582604 CTCCCAGAGACTCCCCGGGCAGG + Intergenic
1047742554 8:127818331-127818353 CTCACTGAGACTTCCGGAGCAGG - Intergenic
1053289748 9:36872126-36872148 GGCCCAGAAACTGCTGGGGCAGG - Intronic
1056774175 9:89498961-89498983 CGCACAGTGACTGGCCAGGCTGG + Intergenic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1061192175 9:129088271-129088293 CAGACGGAGGCTGCCGGGGCTGG + Intronic
1062243124 9:135550281-135550303 CCCACTGAGACCCCCGGGGCGGG - Intergenic
1062282294 9:135757436-135757458 CGCACAGTGTCTTCCAGGGCCGG - Intronic
1062347476 9:136122037-136122059 CGAGCAGAGACTGGCGGGGCAGG - Intergenic
1186085878 X:5990394-5990416 TGCACAGAGACACCCTGGGCGGG + Intronic
1196794943 X:119494745-119494767 CAAACAGAGGCTGCCTGGGCTGG + Intergenic