ID: 926312097

View in Genome Browser
Species Human (GRCh38)
Location 2:11682207-11682229
Sequence TCACCTCCAGGGGGCGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926312097_926312104 9 Left 926312097 2:11682207-11682229 CCTTGAGCGCCCCCTGGAGGTGA 0: 1
1: 0
2: 3
3: 25
4: 145
Right 926312104 2:11682239-11682261 ACTACACATAGGAAACCACCTGG 0: 1
1: 0
2: 1
3: 9
4: 91
926312097_926312102 -2 Left 926312097 2:11682207-11682229 CCTTGAGCGCCCCCTGGAGGTGA 0: 1
1: 0
2: 3
3: 25
4: 145
Right 926312102 2:11682228-11682250 GACACTCTGCCACTACACATAGG 0: 1
1: 0
2: 1
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926312097 Original CRISPR TCACCTCCAGGGGGCGCTCA AGG (reversed) Intronic