ID: 926312097 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:11682207-11682229 |
| Sequence | TCACCTCCAGGGGGCGCTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 174 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 25, 4: 145} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 926312097_926312104 | 9 | Left | 926312097 | 2:11682207-11682229 | CCTTGAGCGCCCCCTGGAGGTGA | 0: 1 1: 0 2: 3 3: 25 4: 145 |
||
| Right | 926312104 | 2:11682239-11682261 | ACTACACATAGGAAACCACCTGG | 0: 1 1: 0 2: 1 3: 9 4: 91 |
||||
| 926312097_926312102 | -2 | Left | 926312097 | 2:11682207-11682229 | CCTTGAGCGCCCCCTGGAGGTGA | 0: 1 1: 0 2: 3 3: 25 4: 145 |
||
| Right | 926312102 | 2:11682228-11682250 | GACACTCTGCCACTACACATAGG | 0: 1 1: 0 2: 1 3: 6 4: 94 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 926312097 | Original CRISPR | TCACCTCCAGGGGGCGCTCA AGG (reversed) | Intronic | ||