ID: 926312105

View in Genome Browser
Species Human (GRCh38)
Location 2:11682254-11682276
Sequence ACTGTGGTTGGGTTTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926312105_926312110 5 Left 926312105 2:11682254-11682276 CCACCTGGAAACCCAACCACAGT 0: 1
1: 0
2: 1
3: 13
4: 201
Right 926312110 2:11682282-11682304 ATGTGACTTTTCTTAGTGACAGG 0: 1
1: 0
2: 1
3: 21
4: 337
926312105_926312111 13 Left 926312105 2:11682254-11682276 CCACCTGGAAACCCAACCACAGT 0: 1
1: 0
2: 1
3: 13
4: 201
Right 926312111 2:11682290-11682312 TTTCTTAGTGACAGGAAATTAGG 0: 1
1: 0
2: 1
3: 30
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926312105 Original CRISPR ACTGTGGTTGGGTTTCCAGG TGG (reversed) Intronic