ID: 926312606

View in Genome Browser
Species Human (GRCh38)
Location 2:11685431-11685453
Sequence TGCAATAATCCAAGTGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926312601_926312606 -7 Left 926312601 2:11685415-11685437 CCTGTTGGGAGGCTGTTGCAATA 0: 1
1: 9
2: 39
3: 201
4: 782
Right 926312606 2:11685431-11685453 TGCAATAATCCAAGTGGGAGGGG 0: 1
1: 1
2: 4
3: 30
4: 179
926312594_926312606 29 Left 926312594 2:11685379-11685401 CCTCCTGGGCTTTCGGGGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 241
Right 926312606 2:11685431-11685453 TGCAATAATCCAAGTGGGAGGGG 0: 1
1: 1
2: 4
3: 30
4: 179
926312596_926312606 26 Left 926312596 2:11685382-11685404 CCTGGGCTTTCGGGGCAGGGCAG 0: 1
1: 0
2: 1
3: 31
4: 282
Right 926312606 2:11685431-11685453 TGCAATAATCCAAGTGGGAGGGG 0: 1
1: 1
2: 4
3: 30
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926312606 Original CRISPR TGCAATAATCCAAGTGGGAG GGG Intronic
901485734 1:9559761-9559783 TACAATAATCCAGGTGAGAGAGG - Intronic
903874384 1:26463209-26463231 TGCAGTAGTCCAGGTGAGAGAGG + Intronic
904395630 1:30219617-30219639 TGCAATCATCCAGGAGAGAGGGG + Intergenic
905973903 1:42162002-42162024 TGCAATTATCCATGTGGGTCTGG + Intergenic
906251805 1:44316156-44316178 TGTATTAACCCAAGTGGGACTGG - Intronic
907014093 1:50994255-50994277 TAGAATAATCCATGTGGTAGTGG + Intergenic
907703963 1:56816979-56817001 TGCAGTAATCCAAGCAAGAGAGG - Intronic
907740521 1:57161207-57161229 TGCAATAATCCAAGAATGACAGG + Intronic
908701763 1:66909949-66909971 TGCAATAATCCAAGAGAGATAGG - Intronic
908855537 1:68422864-68422886 TGCAGTAATCCAGGTGAAAGAGG - Intergenic
913513292 1:119581834-119581856 TGCAAAGACCCAAGTGGGAAAGG + Intergenic
914196065 1:145448706-145448728 AGCAGTGATCCAGGTGGGAGTGG - Intergenic
914223808 1:145703910-145703932 TGCTTGAATCCAAGTGGCAGAGG - Intronic
919773734 1:201179864-201179886 TGCAATAATCTAAGTGAGAGAGG - Intergenic
920126079 1:203694820-203694842 TGCTATAATCCAGATGAGAGAGG + Intronic
920441280 1:205982391-205982413 TGCAATAGTCCAGGTGTGAGAGG - Intronic
921353250 1:214259612-214259634 TGCAACAATCCAAGCAAGAGAGG - Intergenic
921558635 1:216629604-216629626 TGCAATACACCAAATGGCAGAGG + Intronic
922253670 1:223872896-223872918 TGCAAAAATTGAAGTGGGATAGG + Intergenic
922577486 1:226672087-226672109 TGTAATTGTCCAAGTGAGAGAGG + Intronic
923073183 1:230584341-230584363 TGCAATAATACAAGTATTAGGGG + Intergenic
923289676 1:232532125-232532147 TGCAATAATCCAGGCAAGAGAGG + Intronic
924049296 1:240064147-240064169 AGCAATTATGAAAGTGGGAGGGG + Intronic
1064484099 10:15767043-15767065 TGCAATATTCTAATTGGGACAGG - Intergenic
1065037836 10:21658746-21658768 TGCATTAACCCAAGAGGCAGAGG - Intronic
1065703289 10:28446075-28446097 TGCATGAACCCAAGTGGCAGAGG - Intergenic
1065734432 10:28738746-28738768 TGCAATGATTCAAGAGGGAGAGG + Intergenic
1071251819 10:83826600-83826622 TGCACAAATCCAGGTGGAAGAGG - Intergenic
1073234400 10:102001468-102001490 TGCAAGAGTGGAAGTGGGAGAGG - Intronic
1073617039 10:105006417-105006439 TACAATAATCCATGTGAGAGAGG - Intronic
1073842557 10:107514491-107514513 GGCTATGACCCAAGTGGGAGCGG - Intergenic
1074828812 10:117233621-117233643 TGCAATATTCCAAGTGAGAGTGG + Intergenic
1075266072 10:121000432-121000454 TGCCATCATCCAGGAGGGAGTGG + Intergenic
1075763999 10:124878565-124878587 TGGAAGAAGCCAAGTGGGAAGGG - Intergenic
1075833087 10:125427911-125427933 TTGAATAATCCAGGTGTGAGGGG - Intergenic
1075884435 10:125885824-125885846 TGCAGTAATCCAGGTGAGAGGGG - Intronic
1076701001 10:132272653-132272675 TGCAGGAATCCAGGCGGGAGTGG - Intronic
1079074302 11:17374100-17374122 TGCAAAAATCCAATGGGGAAGGG + Exonic
1080484064 11:32686108-32686130 TGCAATAATCCAGATGAAAGAGG + Intronic
1080701893 11:34650985-34651007 TGGAAAAATCCTAGAGGGAGGGG + Intronic
1080716692 11:34809421-34809443 TGCAAAAATACAAGTGACAGTGG - Intergenic
1080871003 11:36236946-36236968 AGCAATATTCCAAGTGGCTGTGG - Intergenic
1083456668 11:62783616-62783638 TGCTTAAATCCAAGAGGGAGAGG - Intronic
1084576259 11:69989741-69989763 TGCAATAATCCAGGTGCACGAGG + Intergenic
1087148918 11:94840450-94840472 TGCAAAAATGACAGTGGGAGGGG + Intronic
1087696282 11:101379878-101379900 TGCAAAAATCCAGGTGAGAAGGG + Intergenic
1088260137 11:107935987-107936009 TGCTTGAATCCAAGAGGGAGAGG - Intronic
1088824814 11:113484506-113484528 TTAAATAGTCCAAGTGGGAGAGG - Intergenic
1089758096 11:120701780-120701802 TGCAGTAATCCAGGTGAGAGAGG + Intronic
1090981491 11:131726393-131726415 GGCAGCAATCCAAGTGTGAGAGG - Intronic
1093114165 12:15189045-15189067 TGCAATAATCCAAGTAAGGCAGG - Intronic
1093500598 12:19807553-19807575 TGGAATAATCCAAGATAGAGGGG - Intergenic
1094400013 12:30052550-30052572 TGCAGTAATCCAGGTGAGACAGG + Intergenic
1095130744 12:38539411-38539433 TGCAGCAATCCAAGATGGAGAGG + Intergenic
1095670697 12:44856934-44856956 TGCAGTAATCCAAGTGAAAGAGG + Intronic
1098524391 12:71469970-71469992 TTCAATAATCCAGGTGAGAAGGG - Intronic
1098609814 12:72442592-72442614 AGCATTAATCAAAGTGGTAGAGG - Intronic
1099868681 12:88318702-88318724 TGCAATAAAACATGTGGGAAAGG + Intergenic
1101261764 12:103039426-103039448 TGCAATAATCCAAGCAAGAGAGG - Intergenic
1102797379 12:115700563-115700585 TGCAATAATCCAGGTGAAATAGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105721186 13:23116289-23116311 TGCAATGGTCCAGGTGGGAGGGG - Intergenic
1107880830 13:44830597-44830619 TGCAATAATCCAGGAGAGACAGG - Intergenic
1109411384 13:61973561-61973583 TGCAAAGAACCAATTGGGAGAGG - Intergenic
1109897351 13:68711077-68711099 TTCAATAATTCAGGTGGGAAAGG - Intergenic
1116482213 14:45405036-45405058 TGCAATAATTCATGTGGAAGGGG + Intergenic
1117473196 14:56067510-56067532 TGCAATAATCTAGGTGAGATGGG + Intergenic
1117847285 14:59924556-59924578 TGTAATAATGTAAGTGGGAGAGG - Intronic
1118777487 14:68982062-68982084 TGCAATAATCCAGGTCGAAATGG + Intergenic
1122500548 14:102195990-102196012 TGCAACAATGCAAAAGGGAGGGG - Intronic
1122597266 14:102902343-102902365 TGCCACCATCCAGGTGGGAGGGG + Intronic
1126736007 15:51732838-51732860 TGCAGTAATGCAGGTGGGAGAGG - Intronic
1127369232 15:58321708-58321730 TGCAGACTTCCAAGTGGGAGGGG + Intronic
1128229601 15:66025335-66025357 TTCAATAAGCCAAGCAGGAGTGG - Intronic
1129535775 15:76312571-76312593 TGCAATGATCCAGGCGAGAGAGG - Intergenic
1139221926 16:65192026-65192048 TGAAATGATCCATGTGGTAGTGG - Intergenic
1141232264 16:82179787-82179809 TGCAATAATTCCAGTGTAAGAGG + Intergenic
1144930432 17:18854734-18854756 TGCAAACATCCAAGTGGGCAAGG + Intronic
1146434671 17:32833429-32833451 TACAATAATTCAGGTGGGAGAGG - Intronic
1149564590 17:57632040-57632062 TACAAGAAGCAAAGTGGGAGGGG - Intronic
1149573067 17:57688784-57688806 AGAAATAAGACAAGTGGGAGAGG + Intergenic
1151413695 17:73947809-73947831 TGCTAGAAACCAGGTGGGAGCGG + Intergenic
1153271489 18:3326930-3326952 TGCAATAATCCAGGTGTCAGGGG + Intergenic
1153344158 18:4008078-4008100 TGGAAAAATCCCAGTGGGTGAGG - Intronic
1153453056 18:5250985-5251007 TACAATAATCCAAATGAGAAAGG + Intergenic
1158308997 18:56138979-56139001 TACAATATTCCAGGTGGGACAGG + Intergenic
1160168539 18:76533565-76533587 CGCAATATTGCAAGTGGGAAAGG + Intergenic
1161143263 19:2661587-2661609 TGCATGAATCCAAGAGGCAGAGG + Intronic
1161996196 19:7713149-7713171 TGCCTGAATCCAAGAGGGAGAGG + Intergenic
1163125135 19:15240452-15240474 TGCAATCATCCAGGTGGGCCAGG - Intronic
1164030707 19:21401506-21401528 TGAAATAATCTTAGTAGGAGTGG + Intronic
1164118274 19:22242828-22242850 TGCAATTACCCAAGTTGGGGGGG + Intergenic
1165198528 19:34126428-34126450 TTCAAAAAAGCAAGTGGGAGAGG + Intergenic
1166699276 19:44872972-44872994 AGCAAAAAACCCAGTGGGAGGGG - Intronic
1167946867 19:52995194-52995216 TCCGATAATCCATTTGGGAGAGG - Intergenic
926312606 2:11685431-11685453 TGCAATAATCCAAGTGGGAGGGG + Intronic
926511616 2:13787797-13787819 TGCAATAATTTAAGCAGGAGAGG - Intergenic
928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG + Intergenic
928939536 2:36713606-36713628 TGCAATAATCTAGGTGGGAGAGG + Intronic
929655198 2:43723898-43723920 TGCAGTAATCCAGGTGAGAGGGG + Intronic
929826622 2:45313883-45313905 TGCAGTAATCCAGGTGAGAAAGG + Intergenic
930393865 2:50795450-50795472 TGCAATCTTCCAGGTTGGAGTGG - Intronic
930879330 2:56253633-56253655 TGCAATATTCTAAGCTGGAGAGG + Intronic
933843692 2:86308210-86308232 GGCAATAATGCAAGTGGTAAAGG + Intronic
941533106 2:166693374-166693396 CGCAATATTCCAAGGTGGAGAGG - Intergenic
942487990 2:176459297-176459319 TGCAATCATCCAGGTGAGAGAGG + Intergenic
944835339 2:203573724-203573746 AGCAAAAATCCATGAGGGAGAGG + Intergenic
946322904 2:218963827-218963849 TGCCATAATCCGATTAGGAGGGG + Intergenic
948163512 2:235843997-235844019 TGCCAGATTCCAAGAGGGAGAGG - Intronic
948218418 2:236249782-236249804 GGCAAGAATCCAAGCAGGAGAGG + Intronic
1168879079 20:1191259-1191281 TGCAATATTCCAAAAGGTAGTGG + Intergenic
1169481374 20:5985148-5985170 TGAAATAATCCAAGTCGGCCTGG + Intronic
1172082397 20:32352376-32352398 AGCCCTAATCAAAGTGGGAGGGG + Intergenic
1173127903 20:40357157-40357179 TGAAAAAAACAAAGTGGGAGAGG - Intergenic
1174548399 20:51343643-51343665 TCCAATAGCCCAGGTGGGAGAGG + Intergenic
1175570837 20:60020378-60020400 TGCCCTACCCCAAGTGGGAGAGG - Intronic
1175623177 20:60467920-60467942 TGCAAGAGTCAAGGTGGGAGGGG - Intergenic
1175649450 20:60705710-60705732 TAGAATAATCCATGTGGTAGTGG - Intergenic
1179956003 21:44738972-44738994 GGCAATAATCCCAGTGAGAGAGG + Intergenic
1181646925 22:24236393-24236415 TGCAATAACCCAGCTGAGAGAGG - Intronic
950200102 3:11036643-11036665 TGCAATAACCCAAGTGAGAGGGG + Intronic
952186303 3:30973330-30973352 TGCAATAATCCAGGCAAGAGAGG - Intergenic
952318938 3:32258098-32258120 AGCAATAACCAAAGTTGGAGAGG - Intronic
952500795 3:33959954-33959976 TGCAAAAATCCAGGAGAGAGAGG + Intergenic
954750293 3:52809757-52809779 TGCAGTTGTCCAGGTGGGAGAGG - Intergenic
955029147 3:55199674-55199696 TGCAATAATCCAGATGAAAGGGG + Intergenic
957014553 3:75047741-75047763 TACAATAATTCAAGGGAGAGAGG + Intergenic
960467503 3:118015206-118015228 TGCAATAATCCACAAAGGAGAGG - Intergenic
963869377 3:150398567-150398589 TGGATTATTCCAAGAGGGAGAGG - Intergenic
967801756 3:193669795-193669817 TTAAATAATCAAATTGGGAGCGG - Intronic
969017439 4:4113323-4113345 TGCAATACACCAAGTGAGACAGG + Intergenic
969861409 4:10038579-10038601 TGGAAGAATCCAAGTGATAGAGG - Intronic
970716999 4:18937952-18937974 CCCAATATTCCCAGTGGGAGTGG + Intergenic
971440976 4:26685161-26685183 TAAAATAATGCAAGTGGAAGTGG + Intronic
974099781 4:57403872-57403894 TGCAACAATCCAGGTGAGAAGGG + Intergenic
975379669 4:73684575-73684597 TGTAATAATCCAAGTAAGAAAGG + Intergenic
977162020 4:93646688-93646710 TGCAGTAATCCAGGAGAGAGAGG + Intronic
977437018 4:97011145-97011167 TGAAATAATCAAAATGGAAGTGG - Intergenic
978794938 4:112699693-112699715 TACAATAATCCAAGAAAGAGGGG + Intergenic
980156846 4:129117859-129117881 TGCCTTCTTCCAAGTGGGAGAGG + Intergenic
983062536 4:163175342-163175364 TGCAAAAATCCAATGGGGAATGG + Intergenic
985081569 4:186270597-186270619 TTAAATAATCCAATTAGGAGGGG + Intronic
985585225 5:728927-728949 TGCAAGAATCCAAGTGGCAAAGG + Intronic
985598734 5:813242-813264 TGCAAGAATCCAAGTGGCAAAGG + Intronic
986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG + Intergenic
989531219 5:42510246-42510268 TGCAATAATCCAAGTGAATGAGG - Intronic
990567250 5:57041969-57041991 TGGAATTATCCAAGTGATAGAGG - Intergenic
991244880 5:64499808-64499830 TATAATAATCCAAGTGGAAGAGG - Intergenic
994048171 5:95332327-95332349 GGCAATAATGCATGTGGGAATGG + Intergenic
994394305 5:99215710-99215732 TACTAATATCCAAGTGGGAGAGG - Intergenic
996605764 5:125319576-125319598 TGCAAAAATCCAAGTAAGAGAGG - Intergenic
997682697 5:135767209-135767231 TGTAATATCCAAAGTGGGAGAGG + Intergenic
997882000 5:137599938-137599960 TGCTTTCATCCAGGTGGGAGTGG + Intergenic
1002274315 5:178094545-178094567 TGCAGGAAGCCAGGTGGGAGGGG + Intergenic
1004489112 6:16097347-16097369 AGCAATAATCCCTGTGAGAGAGG + Intergenic
1007743440 6:44027107-44027129 TGCAATAATCCAGCTGAGAGAGG + Intergenic
1009047469 6:58248062-58248084 TGTAATATTCCGGGTGGGAGAGG + Intergenic
1009225986 6:61020456-61020478 TTCTAATATCCAAGTGGGAGAGG - Intergenic
1009283776 6:61786169-61786191 TCCAATAATGAAAGAGGGAGAGG + Intronic
1009366721 6:62862335-62862357 TGTAATATTCCATGGGGGAGAGG - Intergenic
1009366782 6:62862640-62862662 TGTAATATTCCAGGAGGGAGAGG - Intergenic
1009367104 6:62864217-62864239 TGTAATATTCCGGGTGGGAGAGG - Intergenic
1009367385 6:62866099-62866121 TGTAATATTCCAAAGGGGAGAGG - Intergenic
1010143696 6:72641232-72641254 TGAAATCAAGCAAGTGGGAGTGG + Intronic
1013708968 6:112875058-112875080 TGGAATTTCCCAAGTGGGAGGGG + Intergenic
1014372094 6:120622730-120622752 TGCAATAATCCAGGTGATGGAGG + Intergenic
1015159440 6:130136120-130136142 TGCACTAATCCAAGTGGGAGAGG - Intronic
1016502251 6:144734701-144734723 TGCAATCATCCAAGGGGTAGTGG - Intronic
1018356206 6:163020441-163020463 TGCAAAAATCAGATTGGGAGGGG - Intronic
1018635899 6:165859216-165859238 GGAAATAATCCACGTGGTAGAGG - Intronic
1019737361 7:2657177-2657199 AGCCACAGTCCAAGTGGGAGAGG - Intronic
1020544128 7:9501756-9501778 TGTTGTAGTCCAAGTGGGAGAGG + Intergenic
1022228545 7:28389816-28389838 TTAAATAATACAAGGGGGAGGGG - Intronic
1024041417 7:45559038-45559060 TGTAATCATCCAAATGGGAGTGG + Intergenic
1024272785 7:47655227-47655249 TGCAAGAATCGAATGGGGAGAGG - Exonic
1024641649 7:51333830-51333852 TGTAATAAACCAAGTGGCCGTGG - Intergenic
1025191448 7:56898723-56898745 TGGAGTAAGCCACGTGGGAGAGG - Intergenic
1025680500 7:63678211-63678233 TGGAGTAAGCCACGTGGGAGAGG + Intergenic
1028286227 7:89004993-89005015 TTTAATAATCCAAGTATGAGTGG - Intronic
1029403126 7:100357559-100357581 TGCAGGGATCCAGGTGGGAGGGG + Intronic
1029405743 7:100373300-100373322 TGCAGGGATCCAGGTGGGAGGGG + Intronic
1030105278 7:105982002-105982024 TGCAACAATCCAGGTGAGATGGG - Intronic
1031150111 7:118044434-118044456 TTCAGTAGTCCAGGTGGGAGAGG + Intergenic
1032961271 7:137037505-137037527 TGGAAAATTACAAGTGGGAGTGG + Intergenic
1034911090 7:154999502-154999524 TGCAATAACCCAGGTGAAAGAGG + Intronic
1037812834 8:22097066-22097088 GACAAGAATCCTAGTGGGAGAGG + Intronic
1038327421 8:26582466-26582488 ATCAAGAATCCAAGTTGGAGGGG + Intronic
1039719858 8:40151614-40151636 TTCAATAATCCAAGAAAGAGAGG - Intergenic
1040576589 8:48657223-48657245 TGAAATAACCCAAGTGGCAAAGG + Intergenic
1041492108 8:58444497-58444519 TGAAATAATGCATGTGGCAGAGG + Intronic
1041719044 8:60959944-60959966 TGCCATTATACAAATGGGAGTGG - Intergenic
1041854456 8:62434889-62434911 TGCAAAAACTCAAGGGGGAGAGG - Intronic
1041931614 8:63293553-63293575 TGCATTAAGCCAAGTTGGATGGG + Intergenic
1042273943 8:66984037-66984059 TGAGATCATACAAGTGGGAGTGG + Intronic
1043156313 8:76785443-76785465 AGAAATAATCCCATTGGGAGAGG + Intronic
1043383131 8:79723842-79723864 TGCAATAGTCCAAGAGGTGGTGG + Intergenic
1044488150 8:92778130-92778152 TGCAATAATTCAACTTGGAAGGG - Intergenic
1045718556 8:105078116-105078138 TGCACTAATCCAAATGGGTCAGG + Intronic
1046065958 8:109197003-109197025 TGAAATATTCCAAGTTAGAGTGG - Intergenic
1046087624 8:109458317-109458339 TGTAATATTCCAGGTGTGAGAGG - Intronic
1047202743 8:122780713-122780735 TCCAATGTTCCCAGTGGGAGCGG - Intergenic
1050351753 9:4746430-4746452 AGTAATAATGCAAGTGAGAGAGG + Intergenic
1053431656 9:38045840-38045862 TGAAAGAAACCAAGAGGGAGTGG + Intronic
1056447265 9:86678037-86678059 TGGAATAGGACAAGTGGGAGAGG - Intergenic
1059484198 9:114614398-114614420 AGCATTAAACCAAATGGGAGGGG - Intronic
1060120943 9:120988791-120988813 TGTAAGAATCCAGGTGGGAGAGG + Intronic
1062698667 9:137888129-137888151 AGCAGTGATCCAGGTGGGAGTGG + Intronic
1188306202 X:28562213-28562235 TGCAATTTCCAAAGTGGGAGGGG + Intergenic
1189400920 X:40667757-40667779 TGCAATAATTCAGGTGAGAGAGG + Intronic
1190277381 X:48907658-48907680 TGCATTCATCCATGTGGCAGAGG - Intronic
1195941700 X:110172861-110172883 TGCAATCAATCAAGTGGGGGTGG - Intronic
1196143820 X:112295388-112295410 TTCTATACTTCAAGTGGGAGTGG - Intergenic
1197416157 X:126175863-126175885 CCCAATAATCCAGATGGGAGAGG - Intergenic
1199140849 X:144310156-144310178 TGCAATAATCCAAGAAAGAGAGG + Intergenic
1201339606 Y:12919385-12919407 TACAGAATTCCAAGTGGGAGAGG - Intronic