ID: 926312837

View in Genome Browser
Species Human (GRCh38)
Location 2:11686805-11686827
Sequence ATCGATATGGGTCCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926312829_926312837 22 Left 926312829 2:11686760-11686782 CCCCTCACAGTGTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 181
Right 926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 46
926312832_926312837 20 Left 926312832 2:11686762-11686784 CCTCACAGTGTTTGCAGTTGGAA 0: 1
1: 0
2: 1
3: 10
4: 206
Right 926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 46
926312831_926312837 21 Left 926312831 2:11686761-11686783 CCCTCACAGTGTTTGCAGTTGGA 0: 1
1: 0
2: 0
3: 18
4: 171
Right 926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 46
926312833_926312837 -10 Left 926312833 2:11686792-11686814 CCATTAGTGATTAATCGATATGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926312837 Original CRISPR ATCGATATGGGTCCTTTTGT GGG Intronic
907822380 1:57983494-57983516 ATTCATGTGGGTCCTTTTGCAGG - Intronic
910102964 1:83598344-83598366 ATCCTTTTGGGTCTTTTTGTAGG + Intergenic
912985788 1:114429084-114429106 ATTCACATGGGTCCTTTTGGGGG + Intronic
917363234 1:174200229-174200251 ATCTATATGAGTTCTTGTGTAGG + Intronic
921428280 1:215031054-215031076 ATCTATATGGGTCTGTTTCTGGG + Intronic
1071922306 10:90364546-90364568 ATCGTTTTGGGTCTTTTTTTTGG - Intergenic
1079939184 11:26656802-26656824 ATCGATATGGATTCTTTTATTGG - Intronic
1085369413 11:75985443-75985465 ATGGATATGGGTTCTTTTTTTGG + Intronic
1100137607 12:91572746-91572768 ATCCATAAATGTCCTTTTGTTGG + Intergenic
1105931415 13:25056313-25056335 AGCTATATGGGTGCTTTTCTAGG + Intergenic
1120384047 14:83821308-83821330 AAAGATCTGGGTCCTTATGTTGG - Intergenic
1127823309 15:62679988-62680010 ATCTATATGGGTCTATTTCTGGG + Intronic
1141479257 16:84295290-84295312 ACAGATAAGGGTCCTTTTTTGGG - Intronic
1144369068 17:14572803-14572825 ATGGGTATGGGTCCTTCTTTTGG - Intergenic
1146759806 17:35467280-35467302 ATGGAGATGGGGCCATTTGTTGG - Intronic
1149362040 17:55905261-55905283 ATCCATATTGGTTCTTTGGTTGG + Intergenic
1155668087 18:28335758-28335780 ACCCATATAGGTCCATTTGTGGG - Intergenic
1159742964 18:72196084-72196106 ATAGATCTGGTTCTTTTTGTAGG + Intergenic
926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG + Intronic
928868899 2:35951319-35951341 ATCTACCTGGGTCCTTTTGAGGG - Intergenic
941167805 2:162102149-162102171 CTCGAGCTGGGTCCTTTTGGAGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1171738929 20:28835759-28835781 AGCGATTTGGGGCCTATTGTGGG + Intergenic
1175421496 20:58837474-58837496 ATAGACATTTGTCCTTTTGTGGG + Intergenic
1180191608 21:46168044-46168066 CTGGATATGAGTCCTTTTTTGGG - Intronic
1183562559 22:38587376-38587398 ATCTATGTGTGTCCTTTTCTTGG - Intronic
951839537 3:27019470-27019492 ATCAATAAGGGACCTTTTGTGGG - Intergenic
952333644 3:32386696-32386718 ATCGATTTGGTTCCTGTTGAGGG + Intergenic
961994141 3:131223265-131223287 ATGAAAATGAGTCCTTTTGTGGG + Intronic
963970843 3:151427905-151427927 ATAGATATGGGACATTTTCTGGG + Intronic
965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG + Intronic
967430358 3:189377326-189377348 ATCTATATGGGTCTATTTCTGGG + Intergenic
971203544 4:24537195-24537217 ATCGATATGGGCGTTTGTGTTGG - Intronic
983059304 4:163137938-163137960 ATAGATATCTGTACTTTTGTTGG - Intronic
988207525 5:28159322-28159344 ATCTAAATGAGTACTTTTGTGGG - Intergenic
991309218 5:65216460-65216482 ATGGATATGGGTTTTTTTCTGGG + Intronic
1000918788 5:167114102-167114124 ATCGATGTGGCTCTTTTTGGTGG - Intergenic
1004979048 6:21002204-21002226 TTGGATCTGGGTCCTTTCGTTGG + Intronic
1023190905 7:37581307-37581329 ATCGATATGGGGCTTCTTTTTGG - Intergenic
1028025267 7:85829310-85829332 ATCCATATGGGTGCTTTGGATGG - Intergenic
1032806212 7:135357258-135357280 ATGGATGTGGGTCATTTTCTAGG - Intergenic
1034403215 7:150880195-150880217 ATAAATTTGGGTCCCTTTGTAGG - Intergenic
1036018128 8:4809113-4809135 ATAGCTATGGCTCCTTTTATTGG - Intronic
1036659853 8:10700917-10700939 ATGGCTCTGGGTCCTCTTGTGGG - Intronic
1040882955 8:52228249-52228271 ATTTAAATGGGTCCTTTTGCAGG + Intronic
1043506154 8:80905134-80905156 ATGAACATGTGTCCTTTTGTAGG - Intergenic
1045158625 8:99510224-99510246 ATCGATGAGGCTTCTTTTGTAGG + Intronic
1045175347 8:99717640-99717662 ATGGATATGGGTTTTTTTGTTGG - Intronic
1045581356 8:103483871-103483893 ATGGATTTTGGACCTTTTGTAGG + Intergenic
1048416021 8:134228894-134228916 ATCTTGATGTGTCCTTTTGTAGG + Intergenic
1192940208 X:75903897-75903919 CTCGATATGGGCACTTATGTGGG - Intergenic