ID: 926313307

View in Genome Browser
Species Human (GRCh38)
Location 2:11691170-11691192
Sequence AGGGTCCACCCTCAGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926313299_926313307 23 Left 926313299 2:11691124-11691146 CCAACTCCTAGTCCTTTGTTCTC 0: 1
1: 0
2: 1
3: 30
4: 294
Right 926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 214
926313300_926313307 17 Left 926313300 2:11691130-11691152 CCTAGTCCTTTGTTCTCTAGCAA 0: 1
1: 0
2: 0
3: 16
4: 191
Right 926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 214
926313298_926313307 30 Left 926313298 2:11691117-11691139 CCTCACACCAACTCCTAGTCCTT 0: 1
1: 0
2: 1
3: 18
4: 233
Right 926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 214
926313302_926313307 11 Left 926313302 2:11691136-11691158 CCTTTGTTCTCTAGCAACAAGGC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926313307 Original CRISPR AGGGTCCACCCTCAGTCCTG TGG Intronic
900091140 1:921216-921238 AGGCTCCAGCCTCAGCCCAGCGG + Intergenic
900238709 1:1604661-1604683 AGGGTCCACCGTGAGCCCTGAGG - Intergenic
900238715 1:1604681-1604703 AGGGTCCACTCTGAGCCCCGAGG - Intergenic
901239016 1:7682161-7682183 AGGGTCCCCCCTCACCCCTGAGG - Intronic
901684272 1:10935023-10935045 AGTGTCCCCCTGCAGTCCTGGGG + Intergenic
902361959 1:15946779-15946801 AGAGGCCACCCTCAGACCTGAGG + Intronic
902562284 1:17285009-17285031 TGGGTCCACCCAGAGCCCTGTGG - Intergenic
902698015 1:18153449-18153471 AGGGTCCAGCCCTAGGCCTGGGG - Intronic
903500469 1:23797622-23797644 AGGGCCCACCCTGAGCCCAGGGG - Intronic
903623462 1:24714831-24714853 AGCCTCCTCCCTCAGACCTGAGG + Intergenic
904006775 1:27366996-27367018 AAGCTCCACCCTCGGCCCTGGGG + Intergenic
904160196 1:28517642-28517664 GGGGTCCAGCCTCTATCCTGAGG - Intronic
904284813 1:29447046-29447068 AGGCTGCACGCTCAGCCCTGGGG + Intergenic
904484196 1:30814155-30814177 GGCCTCCACCCTCAGTCCAGTGG + Intergenic
905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG + Intergenic
905364510 1:37442265-37442287 ATGTTCCACACACAGTCCTGGGG + Intergenic
905712421 1:40117765-40117787 AGTGTCACCCCTTAGTCCTGCGG + Intergenic
908253707 1:62285336-62285358 TGGGTCCACCCTCAGTGCCCAGG + Intronic
909129630 1:71718184-71718206 AGGTTCCACCTTCAGCACTGAGG - Intronic
911978183 1:104529932-104529954 AGAGTCCACCCACAGTCCTTGGG + Intergenic
914420371 1:147523189-147523211 AGGGTGCCCACTCAGTCCAGAGG + Intergenic
918996848 1:191773042-191773064 AGGTTCCTCCCTGAGTCCTGAGG - Intergenic
920256124 1:204655716-204655738 AAGATCCAGCCTCTGTCCTGAGG + Intronic
921055298 1:211538488-211538510 AGGAGCCACGCTCAATCCTGGGG + Intergenic
922758486 1:228109626-228109648 TGGATCCTCCCTCAGCCCTGCGG - Intergenic
922758497 1:228109667-228109689 TGGGTCCTCCCTCAGCCCTCCGG - Intergenic
922801183 1:228365430-228365452 AGGCTGCACCCTCCATCCTGGGG - Exonic
1062901155 10:1147871-1147893 AGTCTCCACCCACAGTCCTGGGG - Intergenic
1062943301 10:1440000-1440022 AAGGACCTGCCTCAGTCCTGGGG - Intronic
1063098239 10:2926962-2926984 AGGCTCCACCCTCACCCATGTGG + Intergenic
1063993429 10:11592357-11592379 AGGGGCCACTGTCAGACCTGTGG - Intronic
1065065630 10:21960663-21960685 AGGGTCTTCCCTCTGTCCTCTGG - Intronic
1067203670 10:44195866-44195888 AGAATCCACACTCAGTCCTTGGG - Intergenic
1070911375 10:80121637-80121659 AGGGTATAACCTCACTCCTGTGG + Intergenic
1073350520 10:102816454-102816476 TGGGTCCACACTCTGTTCTGAGG + Intergenic
1073470084 10:103716823-103716845 AGGCTGCAACCTCAGCCCTGAGG + Intronic
1073711662 10:106049947-106049969 AAGGTCCTCCCTCAGTCAGGTGG + Intergenic
1073726129 10:106233123-106233145 AGAGTCCACGCTCTGTCCTGGGG - Intergenic
1074249594 10:111731178-111731200 AGGGGTCTCCCTCAGCCCTGTGG - Intergenic
1074392938 10:113073029-113073051 AGGGTCCACTTCCATTCCTGGGG - Intronic
1076549860 10:131271376-131271398 AGGAGCCAGCCTCAGTCCAGAGG + Intronic
1077013548 11:390465-390487 TGGGTCCACACACCGTCCTGAGG + Intergenic
1078944800 11:16052816-16052838 AGGGTATAACCTCAGTACTGGGG - Intronic
1079105650 11:17570630-17570652 TGAGTCCACCCTAAATCCTGGGG - Intronic
1083138395 11:60701349-60701371 AGGATCCACGCCCAGCCCTGTGG + Intronic
1083385922 11:62310297-62310319 AGGCCCCACCTTCAGCCCTGGGG + Intergenic
1084541935 11:69792420-69792442 AGGGACCACCATGGGTCCTGGGG - Intergenic
1084547919 11:69823657-69823679 GAGGTACACCCCCAGTCCTGTGG + Intergenic
1085826976 11:79858210-79858232 GCGGCCCACTCTCAGTCCTGTGG + Intergenic
1086403185 11:86477717-86477739 AAGGTCCAGCCTCAGGACTGAGG - Intronic
1086931644 11:92700009-92700031 AGGGACTGCCCTAAGTCCTGGGG + Intronic
1088045409 11:105444131-105444153 AGGGTCCAGGCTACGTCCTGTGG + Intergenic
1088210843 11:107454055-107454077 TGGACCCACCCTCAGGCCTGGGG + Intronic
1088444368 11:109908449-109908471 AGGGCCCACCCCCAGTACTGAGG + Intergenic
1089168718 11:116498054-116498076 AGGGTCCAGAGACAGTCCTGGGG + Intergenic
1090354587 11:126131502-126131524 AGGTTCCACCCACACTCCAGAGG - Intergenic
1092654272 12:10668288-10668310 AGAGTCCTCTCTCAGTCCGGGGG - Intronic
1095696639 12:45151308-45151330 AGGATCCATGCTCAGTTCTGAGG + Intergenic
1096229076 12:49887564-49887586 AGGGGCCACTGTCAGTCCTGGGG - Intronic
1096411662 12:51381357-51381379 AGGCTCCACCCCCAGGCATGTGG + Intronic
1096553992 12:52391916-52391938 AGAGTCCCACCTTAGTCCTGAGG - Intergenic
1096965902 12:55627516-55627538 AGGGTCAACCCCCATTACTGGGG + Intergenic
1101840558 12:108324754-108324776 AGGGTGCACCCTCAGCCCTCAGG - Intronic
1102412013 12:112728253-112728275 AGGGTCCTCCCCCAGTCTAGTGG - Intronic
1102799705 12:115721259-115721281 AGGGTCATCACTCAGGCCTGAGG - Intergenic
1102985945 12:117278384-117278406 AGGGTTTGCCCTCTGTCCTGTGG - Intronic
1106570566 13:30923722-30923744 ATGGCTCACCCTCTGTCCTGTGG + Intronic
1111155350 13:84314359-84314381 AGGGTTCCACCTCAGTGCTGCGG + Intergenic
1113421848 13:110176994-110177016 AGGGTCTCCCCTGGGTCCTGAGG + Exonic
1117547023 14:56801938-56801960 AGGGGCCACACTCAGTCCCATGG - Exonic
1119942406 14:78655623-78655645 AGGGTCCACTCTAGGTGCTGGGG - Intronic
1120933241 14:89869579-89869601 AGAGTGCACACTCGGTCCTGTGG - Intronic
1122798513 14:104218265-104218287 AGGGGCCCCCCTGGGTCCTGGGG + Intergenic
1122974037 14:105163795-105163817 AGGGGCCCCACTCAGGCCTGGGG + Intronic
1122974059 14:105163859-105163881 AGGGACCCCGCTCAGGCCTGGGG + Intronic
1123083931 14:105708785-105708807 AGGGTCCAACTGCAGGCCTGTGG - Intergenic
1125673927 15:41492762-41492784 AGGGGGGACCCTCACTCCTGTGG + Intergenic
1127763775 15:62165265-62165287 AGGCGCCACCTTCAGTACTGCGG + Exonic
1128565821 15:68699943-68699965 AGGGTCCAACCTGGGTGCTGGGG + Intronic
1129673788 15:77621613-77621635 AGGGCCTTCCCTCAGCCCTGGGG - Intronic
1129891964 15:79077536-79077558 AGGATCCAGCCACTGTCCTGAGG + Intronic
1131120577 15:89820948-89820970 GGGATCCCCCCACAGTCCTGGGG + Intergenic
1132181122 15:99753721-99753743 AGCTTCCACCCTGAGTCATGGGG + Intergenic
1132871048 16:2115933-2115955 AGAGGCCACCCCGAGTCCTGCGG + Intronic
1133927838 16:10207715-10207737 AGGCTCCACCCCCAGTCTTGAGG - Intergenic
1134521481 16:14920948-14920970 AGAGGCCACCCCGAGTCCTGCGG - Intronic
1134709152 16:16319599-16319621 AGAGGCCACCCCGAGTCCTGCGG - Intergenic
1134716361 16:16359628-16359650 AGAGGCCACCCCGAGTCCTGCGG - Intergenic
1134753204 16:16642827-16642849 AGGCTCCACCTTCAGCACTGGGG + Intergenic
1134950453 16:18349046-18349068 AGAGGCCACCCCGAGTCCTGCGG + Intergenic
1134958389 16:18392531-18392553 AGAGGCCACCCCGAGTCCTGCGG + Intergenic
1134992853 16:18716257-18716279 AGGCTCCACCTTCAGCACTGGGG - Intergenic
1135477466 16:22789555-22789577 AGGGTGCAGCCTCAGCACTGGGG - Intergenic
1136590809 16:31216622-31216644 GGGGTCCTCCCTCAGACCTCCGG - Intronic
1136595718 16:31248562-31248584 ATGCTCCACCCTCAGACCTGGGG + Intergenic
1136687624 16:32004328-32004350 AGGTTCCACCTCCAGACCTGGGG - Intergenic
1136788233 16:32947879-32947901 AGGTTCCACCTCCAGACCTGGGG - Intergenic
1138107863 16:54299876-54299898 AGGGGCCACCCACAATTCTGAGG + Intergenic
1139386196 16:66573002-66573024 TGGGTCCATCCTCTGTCCAGAGG - Intronic
1142379528 16:89723517-89723539 GGGTTCCACCCTCGGTGCTGGGG - Exonic
1143104206 17:4520262-4520284 GGAGTCCACCTGCAGTCCTGGGG + Intronic
1144788894 17:17846723-17846745 ATGGGCCACACTCAGTGCTGTGG - Intronic
1144875956 17:18397364-18397386 AGGATCCACCCACATTCCTGCGG - Intergenic
1145156272 17:20547056-20547078 AGGATCCACCCACATTCCTGCGG + Intergenic
1146662811 17:34675906-34675928 AGGGCACATCCTCTGTCCTGGGG - Intergenic
1146883253 17:36455218-36455240 AGGATCCACCCACATTCGTGCGG + Intergenic
1147561325 17:41511163-41511185 AGGGGCCAGCCACAGTCCTCAGG + Intergenic
1147607911 17:41784828-41784850 TGGGTTCTCTCTCAGTCCTGGGG - Intronic
1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG + Intronic
1148694458 17:49550536-49550558 AGCCTCCGTCCTCAGTCCTGTGG + Intergenic
1149683044 17:58518742-58518764 AGCGGCCACCCTCCGTCTTGTGG - Intergenic
1150605449 17:66686729-66686751 AGGGTGCACCATTACTCCTGGGG + Intronic
1152749953 17:82058075-82058097 AGGCTCCAGCAGCAGTCCTGGGG + Exonic
1152831608 17:82500749-82500771 AGTGTCCACCCTGCCTCCTGGGG - Intergenic
1156398326 18:36718488-36718510 TGGGACCACCCTAAGCCCTGAGG - Exonic
1156464571 18:37340591-37340613 GGGGTCCACCCTCAGGCCTGTGG - Intronic
1160754958 19:752236-752258 AGGGGCCATCTTCCGTCCTGGGG + Intronic
1160805213 19:989616-989638 AGGGTCACCCCGCAGTCCTGGGG + Intronic
1160807848 19:1000498-1000520 GGGGGCCACCCTCAGCCGTGCGG + Exonic
1160857477 19:1224018-1224040 AGGGTCCACCCCCGGGCCCGAGG + Intronic
1163560650 19:18017421-18017443 AGGGCTCACCCTCAGGCCAGAGG - Intergenic
1163566496 19:18054954-18054976 AGGGGCTACCCTGAGTCCAGGGG + Intergenic
1165183246 19:33991304-33991326 AGGGTAACCCCTCAGTCTTGGGG - Intergenic
1165461612 19:35947133-35947155 TGGGACCAGCCTGAGTCCTGGGG + Intergenic
1166278260 19:41770930-41770952 AGGGAAAACCCTCAGGCCTGAGG + Exonic
925246770 2:2390422-2390444 AGGCTCCACCCCCAATACTGGGG + Intergenic
925521663 2:4753353-4753375 TCTGTCCACCCTGAGTCCTGGGG - Intergenic
926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG + Intronic
928291526 2:30041980-30042002 TGGGTCGACCCTAAGTCCAGAGG + Intergenic
931287013 2:60840642-60840664 AGGGACCACTCACAGTCATGAGG - Intergenic
931433895 2:62231049-62231071 ATGGACCTCCCTCAGGCCTGGGG - Intergenic
934474598 2:94586101-94586123 AGGGGTCAGCCGCAGTCCTGGGG - Intergenic
937207543 2:120246227-120246249 AGGGGCCAGTCCCAGTCCTGGGG + Intronic
937908384 2:127063770-127063792 AGTGTCCAGCCTGAGTGCTGCGG - Intronic
939730673 2:145781169-145781191 AAGGTCTTCCCTCAGTACTGAGG - Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
944848103 2:203689112-203689134 TGGGTCCACCCTCAGACATTTGG - Intergenic
946365618 2:219247241-219247263 AGGGTCCTCCCACTGACCTGTGG - Exonic
947507377 2:230718882-230718904 AGGCTCCAGATTCAGTCCTGTGG - Intronic
948595005 2:239074078-239074100 TGCGGCCCCCCTCAGTCCTGTGG - Intronic
1168932172 20:1632700-1632722 AGGGCTGTCCCTCAGTCCTGAGG - Intronic
1169027771 20:2384857-2384879 GGGGTACAGCCTCAGCCCTGGGG + Intronic
1170713758 20:18814766-18814788 GGGTTCCACCCACAGACCTGTGG - Intronic
1170855714 20:20052228-20052250 AGGGGCATCCCTCAGCCCTGAGG - Intronic
1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG + Intergenic
1175604069 20:60298275-60298297 TGGGGCCACACTCACTCCTGAGG + Intergenic
1175968656 20:62672919-62672941 GGCGTCCATCCTCAGTGCTGGGG - Intronic
1176289420 21:5036298-5036320 ATGCACGACCCTCAGTCCTGGGG - Intronic
1179867810 21:44227289-44227311 ATGCACGACCCTCAGTCCTGGGG + Intronic
1181015567 22:20066614-20066636 AGGCTGCACCCCCAGGCCTGAGG + Intergenic
1181469422 22:23128580-23128602 TGGGACAATCCTCAGTCCTGGGG + Intronic
1181668933 22:24416815-24416837 TGGGTCCAGCATCAGGCCTGAGG + Exonic
1182096310 22:27628333-27628355 AGGGCCCACCTTCAGCACTGGGG - Intergenic
1184039961 22:41937000-41937022 GGGGTCCATCCTGAGGCCTGAGG + Intergenic
1184109111 22:42384750-42384772 AGGGTCCTCCCTCAGCTCAGAGG + Exonic
1184795349 22:46728933-46728955 TGAGTCCAGCCTCACTCCTGAGG + Intronic
1184968074 22:47995950-47995972 AGGGGCCAGCCTTTGTCCTGGGG + Intergenic
1185139419 22:49092110-49092132 AGGGTCCTCCCCCAGACCTGGGG + Intergenic
949611478 3:5707920-5707942 AGGTTCAACCCTCCCTCCTGGGG + Intergenic
954289880 3:49644027-49644049 CTGCTCCTCCCTCAGTCCTGTGG + Intronic
958041318 3:88230179-88230201 TAAGTCCACCCTCAGTCATGAGG - Intergenic
961739216 3:129022339-129022361 GGGTTCCACCCTCAGGACTGTGG - Intronic
965692451 3:171372089-171372111 AGGGTCCCCTCTCAGAGCTGGGG + Intronic
968598860 4:1499701-1499723 AGGGTCCAGGCCCAGCCCTGAGG - Intergenic
968958818 4:3732456-3732478 AGTGGCCACCCCCAGGCCTGTGG + Intergenic
969503123 4:7566628-7566650 GGGGACCACCCACAGGCCTGGGG - Intronic
969635972 4:8369729-8369751 AGGACCCTCCCTCAGTCCTCAGG - Intronic
969677150 4:8620448-8620470 TGTGTCCTCCCACAGTCCTGGGG + Intergenic
969678103 4:8626087-8626109 TGTGTCCTCCCACAGTCCTGGGG + Intergenic
969679058 4:8631724-8631746 TGTGTCCTCCCACAGTCCTGGGG + Intergenic
969993462 4:11288097-11288119 ATGGTGCAGGCTCAGTCCTGTGG - Intergenic
977741360 4:100487382-100487404 TGGGTGCCCTCTCAGTCCTGAGG + Intronic
979985098 4:127304058-127304080 AGGCCCCACCTTCAGTACTGGGG + Intergenic
984957338 4:185058429-185058451 AGGCCCCACCATCAGGCCTGAGG - Intergenic
985509949 5:307867-307889 AGTGTCCACCCCCGGCCCTGTGG - Intronic
988302612 5:29450393-29450415 AGGCTCCACCTTCAGCACTGGGG - Intergenic
988523069 5:31963597-31963619 AGGCTCCACCTTGAGTCTTGGGG + Intronic
988914992 5:35883279-35883301 AGGGTCCACCTCCAATACTGGGG - Intergenic
989382909 5:40826746-40826768 AGTATCCAGCCTCAGTCCTGAGG - Exonic
997630013 5:135360302-135360324 AGGGTCCTCCCTCAGCATTGTGG + Intronic
997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG + Intronic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
1001660892 5:173392230-173392252 AGGGTCCCTCCTCAGCCCTAGGG - Intergenic
1001890304 5:175332879-175332901 ACGGACAACCCTGAGTCCTGAGG - Intergenic
1002359046 5:178655507-178655529 TGTGTGCACCCTCAGTTCTGAGG + Intergenic
1003399314 6:5778848-5778870 AGGCTCGACCCTCAGCACTGGGG - Intergenic
1004256282 6:14067812-14067834 CTGCTCCACCCACAGTCCTGGGG + Intergenic
1005106391 6:22228773-22228795 TGGGCCAACCCTCACTCCTGTGG - Intergenic
1006333143 6:33406330-33406352 TGGGGCCCCCCTCAGTCTTGTGG + Exonic
1006391454 6:33761370-33761392 AAGATCCACCCCCACTCCTGAGG + Intergenic
1009005900 6:57786299-57786321 AGGCTCCACCTTCAGCACTGGGG - Intergenic
1011153963 6:84308272-84308294 AGGGACCACCCACATTCCTTAGG + Intergenic
1013290701 6:108716915-108716937 AGGGCGCATCCTCAGACCTGAGG - Intergenic
1014620496 6:123661163-123661185 GGGCTCCACCCTCGGGCCTGTGG - Intergenic
1015470845 6:133604395-133604417 AAGATCCACCCTCAATGCTGTGG - Intergenic
1015598222 6:134886894-134886916 AGGGCCCACCCTTAGTCCCTGGG - Intergenic
1016965801 6:149717881-149717903 AGCGTCCGCCCTCAGGCCCGTGG - Exonic
1017653119 6:156601261-156601283 AGGGTCCACACCCAGCCCTCTGG + Intergenic
1018093330 6:160363617-160363639 AGGGTCTATGCTCTGTCCTGTGG - Intronic
1018263099 6:161989864-161989886 TGGGCCCATCCTCAGTCCTCTGG - Intronic
1018534360 6:164804730-164804752 AGGGCCCACTCTGAGTGCTGTGG - Intergenic
1018688000 6:166318488-166318510 AGGGCCGGCCCTCAGCCCTGCGG - Intergenic
1019367884 7:644642-644664 AGCGTCCACCCCCAGGCCTCCGG + Intronic
1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG + Intergenic
1023021929 7:36018827-36018849 AGGCTCCAATCTCAGACCTGGGG + Intergenic
1026326914 7:69318316-69318338 AGGATGCAACCTGAGTCCTGTGG - Intergenic
1026901232 7:74038520-74038542 AGGGTCCACTCTCAGCTCTGGGG + Intronic
1028732663 7:94169835-94169857 GCGGGCCACGCTCAGTCCTGAGG - Intergenic
1029272252 7:99384244-99384266 AGGGTTCCCCTTCAGTGCTGGGG + Intronic
1030434505 7:109499763-109499785 AGGATCCAACCTCAGTCTTTTGG + Intergenic
1034940666 7:155228301-155228323 AGGGACCTCCCTGAGTCCGGAGG + Intergenic
1035024351 7:155816274-155816296 AGGCTGCACCCACAGTCATGGGG - Intergenic
1037752650 8:21692780-21692802 AGGGTCCACCTTCAGCCCTTTGG - Exonic
1037801731 8:22039753-22039775 AGGGTCCATCCTCATTGCTAGGG + Intergenic
1039889387 8:41673896-41673918 AGGGTCCCCCTTCAGCTCTGTGG - Intronic
1040806150 8:51398357-51398379 TGGGGCCCCCCACAGTCCTGGGG + Intronic
1041716474 8:60937092-60937114 AGTGTCCACCATCAGTCCCTTGG + Intergenic
1042213625 8:66406456-66406478 ATGGTCCTTCCTCAGTGCTGTGG - Intergenic
1042737548 8:72005494-72005516 AGGGACCTCCCTCAACCCTGTGG + Intronic
1044193812 8:89351529-89351551 TGGGAACACCCTCAGTCTTGGGG + Intergenic
1045016144 8:98003350-98003372 AGGGGCCTCACTGAGTCCTGGGG - Intronic
1048377241 8:133833548-133833570 CTGTTCCACCCTCAGGCCTGAGG + Intergenic
1049217721 8:141415583-141415605 AGGGCCCACCCGGAGTCATGTGG - Intronic
1049563834 8:143327092-143327114 AAGGCCCTCCCTCTGTCCTGTGG + Intronic
1052237933 9:26235071-26235093 GGGGTGCCCCCTCATTCCTGAGG - Intergenic
1055766086 9:79664917-79664939 TGGGTCAACCCTCTTTCCTGGGG + Intronic
1055962640 9:81834984-81835006 AGGGTCCCCCCTCAATCCGTAGG + Intergenic
1059319194 9:113454745-113454767 AGGGTCTTCCCTCAGTTGTGGGG - Intronic
1060401132 9:123350144-123350166 AGTCTCTACCCTCACTCCTGGGG + Intergenic
1061990277 9:134154940-134154962 TGCGTGCACCCTCAGCCCTGTGG + Intronic
1062083906 9:134638730-134638752 ATGGTTCACCACCAGTCCTGAGG - Intergenic
1062480638 9:136749266-136749288 AGGGTCCTCCCCCAGTGCCGTGG + Intergenic
1185711159 X:2304444-2304466 AGGGTCCACCTCCAGCACTGGGG - Intronic
1198326326 X:135577359-135577381 AGGGACCACCCTCAGCCTCGTGG + Exonic
1200124783 X:153808123-153808145 AGGGTCCTCCCTCGGCCCTGGGG + Intronic
1201392479 Y:13513233-13513255 AGGGTCCAGCCTGAAACCTGGGG - Intergenic
1202042774 Y:20702327-20702349 AGGGGTCACCCCAAGTCCTGTGG - Intergenic