ID: 926313889

View in Genome Browser
Species Human (GRCh38)
Location 2:11695622-11695644
Sequence GGGGCCCAGCTACCCTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926313889 Original CRISPR GGGGCCCAGCTACCCTAAGC TGG (reversed) Intronic
902038196 1:13473040-13473062 GGGGACATGGTACCCTAAGCTGG - Intergenic
903448315 1:23436590-23436612 GAGGCCCAGCTACCCTCACACGG - Exonic
903824060 1:26129864-26129886 GGGGCCCAGTTTACCTGAGCTGG - Intergenic
905922191 1:41727250-41727272 GGGGCCCAGAGAGGCTAAGCAGG + Intronic
908851644 1:68382583-68382605 AGGGCCCAGCTACAATATGCTGG + Intergenic
913044024 1:115058087-115058109 AAGGGCCAGCTAGCCTAAGCAGG - Intronic
915128105 1:153679582-153679604 GGGGCCCAGCTACGCCAAGCTGG + Exonic
923540735 1:234886278-234886300 GGTGCCCACCCACCCTGAGCTGG - Intergenic
924432504 1:244008909-244008931 GAGGCACAGATTCCCTAAGCGGG - Intergenic
1064704777 10:18060568-18060590 TGGGCCCCGCTACCCTCAGCGGG - Intergenic
1074889290 10:117721649-117721671 GGGACCCAGCCACCCTAAACTGG - Intergenic
1074910647 10:117905621-117905643 TGGGCCCTGCCTCCCTAAGCAGG + Intergenic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1080633804 11:34105784-34105806 GGGGCGCAGGTACCCAACGCGGG + Exonic
1080639494 11:34150497-34150519 CAGGCCCAGCTAAGCTAAGCTGG - Intergenic
1081630170 11:44684067-44684089 CTGGCCCAGCTACCCCAGGCTGG + Intergenic
1081794435 11:45809865-45809887 GGGGCCCAGCAGCCCAGAGCAGG + Intronic
1083291342 11:61691997-61692019 TGGGCCCAGCCAGCCTAAACTGG - Intronic
1083624934 11:64067541-64067563 GGGGCTCAGGGACCCAAAGCAGG + Intronic
1083638124 11:64131185-64131207 GGGGGCCAGCTGCCTGAAGCGGG + Intronic
1084438552 11:69157767-69157789 GGGGCCCTGCCACCCTAGCCCGG - Intergenic
1085123699 11:73983248-73983270 TGGGCCCAGCCCCCCTACGCTGG + Exonic
1089140570 11:116280697-116280719 GATGCCCAGCCTCCCTAAGCTGG + Intergenic
1089828142 11:121298117-121298139 TGGTCCCAGCTACCCTCAGGAGG - Intronic
1090051211 11:123381388-123381410 GGGACCCAGCTCTCCTAACCAGG - Intergenic
1091931219 12:4396912-4396934 GGGGTCCTGATACCCTCAGCTGG - Intergenic
1095956263 12:47808154-47808176 GGGCCCCAGCTGCCCTGAGGTGG - Intronic
1110401406 13:75096032-75096054 TAGGCTCTGCTACCCTAAGCTGG - Intergenic
1112565969 13:100551697-100551719 GGGGCACAGCTGCCCAAAGAAGG + Intronic
1113655677 13:112066894-112066916 GGGGCCCAGCAGCCATACGCCGG - Intergenic
1118847000 14:69555006-69555028 TGGGGCCAGCCACCCTCAGCTGG + Intergenic
1122114100 14:99519018-99519040 TGGGCCCATCTGCCCTAAGTGGG - Intronic
1130964987 15:88690441-88690463 GGGCCCCAGCTGCACTGAGCAGG + Intergenic
1132838350 16:1965927-1965949 GGGGCCCAGCCTCCCAAACCAGG - Intergenic
1133621672 16:7532334-7532356 GGGGCTCATCTCCCCGAAGCTGG - Intronic
1133795127 16:9040133-9040155 GGGGAGCAGATCCCCTAAGCTGG + Intergenic
1134850241 16:17473042-17473064 TGGGCCCAGCACCCCTAACCAGG + Intergenic
1137334782 16:47537428-47537450 GGGGCCCAGTTTCCCTGAGCTGG - Intronic
1139290443 16:65853543-65853565 GGGGCCCACCCACCTTAAGAAGG - Intergenic
1142204501 16:88776494-88776516 GGGGCCCAGCTTCCCTTGGAGGG + Intronic
1142302179 16:89265288-89265310 GGGTGCCAGCTTCCCTAAGAGGG + Intergenic
1148342876 17:46883965-46883987 GGGGCTCAGCTCCCCTGAGACGG - Intronic
1148872589 17:50667640-50667662 GGAGCCCAGCTTCCTGAAGCAGG + Exonic
1151788367 17:76287767-76287789 GGGGACCAGCTGCTCTTAGCTGG + Intronic
1151791890 17:76311148-76311170 GGCGCTCAGCTTCCCTAACCAGG + Exonic
1152690660 17:81716376-81716398 AGGGCACAGCTGCCCTGAGCTGG - Intronic
1153910596 18:9703160-9703182 GGGGCCCAGTTTACCTGAGCAGG + Intergenic
1158857202 18:61554629-61554651 GGGGCCCCGCTTCCGGAAGCTGG + Exonic
1162588231 19:11574611-11574633 GGAGCCCAGCCACTCTAACCAGG + Intronic
1165421811 19:35725773-35725795 GGGGCCCAGCTATCCAACCCGGG + Exonic
1167213378 19:48148072-48148094 GGCACCCGGCTTCCCTAAGCAGG + Intronic
1167701357 19:51048730-51048752 GGGGCCCAGTTGACCTGAGCTGG + Intergenic
925056036 2:858048-858070 GGGGCCCAGCCACCTCGAGCTGG - Intergenic
926313889 2:11695622-11695644 GGGGCCCAGCTACCCTAAGCTGG - Intronic
926626447 2:15094688-15094710 TGTGCCCAGCTTCCCTCAGCCGG + Intergenic
928343081 2:30462410-30462432 GGGGCACAGCTTCACTAAGCAGG + Intronic
932218648 2:69983533-69983555 CGGGCCCAGCTAGGCTGAGCTGG + Intergenic
932403109 2:71495801-71495823 GGGGCTCTGCTACCCTCTGCAGG + Intronic
932491872 2:72127710-72127732 TGGGCCCGCCTACCCTGAGCAGG + Intergenic
938275239 2:130014794-130014816 GGAGTGCAGCTTCCCTAAGCTGG - Intergenic
938604867 2:132882063-132882085 GGGGCTCACCTGCCCAAAGCTGG - Intronic
945344192 2:208693552-208693574 GGGTCCCACCTACCCCCAGCTGG + Intronic
946277494 2:218642502-218642524 GGGGCACAGCAACCCACAGCGGG + Exonic
946541288 2:220687452-220687474 GGGGCCCAGCCCGCCCAAGCAGG + Intergenic
948424113 2:237877009-237877031 AGGGCCAAGCCACCCTTAGCAGG + Intronic
948575683 2:238947992-238948014 GGGGCGGAGCCACCCAAAGCTGG + Intergenic
1170279596 20:14631241-14631263 GGGGCCCAGTTTACCTGAGCTGG + Intronic
1170368187 20:15619673-15619695 GGGGCCCAGCTTCCTTATGAAGG - Intronic
1175677463 20:60959056-60959078 AGGGCCCAGCTTCCCTCAGCAGG + Intergenic
1177993514 21:28067441-28067463 GAAGCTGAGCTACCCTAAGCTGG - Intergenic
1179316133 21:40245902-40245924 GGGGCCAAGCTTACCTAAGCTGG + Intronic
1180985335 22:19900960-19900982 GGGGCCCAGCTGCCCACAGAGGG - Intronic
1181000426 22:19985467-19985489 GGGGCCCAGAGCCCCTATGCTGG - Intronic
1182257519 22:29049606-29049628 GGGCCTCAGCTACCCGGAGCAGG + Exonic
1182429314 22:30290727-30290749 GGGACCCAGCAGGCCTAAGCAGG + Intronic
1182770142 22:32789024-32789046 GGGGCCCAGCAATCCTACCCTGG - Intronic
1184727378 22:46354911-46354933 GGGCCCCAGATACCCTAGGTTGG - Intronic
950414731 3:12862392-12862414 GGGTCTCAGTTAACCTAAGCTGG - Intronic
954004051 3:47578381-47578403 GGGTCCCGGCTACCCCAACCGGG + Intronic
956088568 3:65639629-65639651 GGGGCCCACCCACACTAAGGAGG - Intronic
957229827 3:77498744-77498766 GGTGCTCAGCTACCCTTAGGAGG + Intronic
961713490 3:128844332-128844354 GGGTCCCAGTTAGCCTATGCCGG + Intergenic
962087294 3:132205105-132205127 GGGGCCCAGCCAGCCTAAAGTGG + Intronic
962311681 3:134331400-134331422 GAGACCCAGGCACCCTAAGCTGG + Intergenic
962371228 3:134822321-134822343 GGGGCCCAGGAAGCCTAGGCTGG - Intronic
968558733 4:1264975-1264997 GGGGCCCAGTCAACCCAAGCCGG + Intergenic
968583332 4:1404872-1404894 GGGTCCCCGCGACCCTCAGCAGG + Intronic
970447205 4:16134227-16134249 GGGGCAGAGCTACCATAAACAGG + Intergenic
981778439 4:148397211-148397233 AGGGCCCAGCAACCCTGAGGGGG + Intronic
985271844 4:188200783-188200805 GGGGCCCAGTTGACCTGAGCCGG + Intergenic
985541636 5:490161-490183 GGGGCCCAGCTGGTCAAAGCTGG - Intronic
985704054 5:1390513-1390535 AGGGCCCAGCTGCCCAAGGCAGG + Intergenic
990984139 5:61626227-61626249 CGAGCCCAGCTTTCCTAAGCCGG + Intergenic
998875723 5:146597016-146597038 GGAGCCCAGCTACCCAACACTGG - Intronic
999427093 5:151497907-151497929 GGTGCCCACCTACCTTTAGCTGG + Intergenic
1003571369 6:7258545-7258567 GGGGCCCATCCACCCTGAACTGG - Intergenic
1003712562 6:8608953-8608975 GGGGGGCAGCTGCCCTAGGCTGG + Intergenic
1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG + Intergenic
1006449429 6:34097646-34097668 GTGGACCAGCTGCCCTCAGCGGG - Intronic
1007785217 6:44275975-44275997 GGTGCCCAGCTACTCTGAGGCGG + Exonic
1009702283 6:67200617-67200639 GGCTCCCAGCAACCCCAAGCTGG - Intergenic
1012847705 6:104411404-104411426 GGGGCCCAGCTTACCTGAGCAGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019747526 7:2709124-2709146 GGGGCCCAGCGCCCCTGATCTGG + Exonic
1022179855 7:27908668-27908690 GGGGCCCAGTTTACCTAAGCTGG + Intronic
1022399918 7:30027250-30027272 GGGGCCAAACAACCTTAAGCAGG - Intergenic
1027046765 7:74996133-74996155 GGGGCCCATCTACCCATTGCTGG - Intronic
1027050780 7:75019958-75019980 AGGGCCCAGCTTCCCTGGGCTGG + Intronic
1029386233 7:100245471-100245493 GGGGCCCATCTACCCCTTGCTGG + Intronic
1035355669 7:158274714-158274736 GGGGCTCAGGTACCCTACGGGGG + Intronic
1036093286 8:5693133-5693155 AGGACCCAGATGCCCTAAGCAGG + Intergenic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1043919525 8:85965323-85965345 GGGGCCCAGTAAGCCTAGGCTGG + Intergenic
1049178289 8:141207062-141207084 TGGGCCCAGCTCCCCTCCGCAGG + Intergenic
1049624948 8:143615727-143615749 CTGGCCCAGCTCCCCTTAGCCGG - Intronic
1051102404 9:13535956-13535978 GGTGCTCAGCAACCCTATGCAGG + Intergenic
1059346593 9:113633084-113633106 TGGGCCCAGGTACCCTGAACTGG - Intergenic
1061002499 9:127910291-127910313 CGGGCCCAGCTACGCTTTGCAGG + Intronic
1061009569 9:127946956-127946978 GGGCCCCCTCAACCCTAAGCAGG - Intronic
1061212437 9:129201686-129201708 GTGGCCCTTCTACCCTGAGCAGG - Intergenic
1061666963 9:132166105-132166127 GGGGCCCAGCTGACCTTGGCTGG - Intronic
1062464307 9:136674393-136674415 GGGTTCCATCTACCCTATGCGGG + Intronic
1062624117 9:137435314-137435336 GGAGGCCAGCTACCCTGGGCAGG - Exonic
1189305071 X:39980821-39980843 GAGGCCCAGCCAGCCTCAGCTGG + Intergenic
1195404983 X:104502910-104502932 TAGGCCCAGCTACCCTGTGCAGG - Intergenic
1195710014 X:107766245-107766267 GGGGCTCAGTTCCACTAAGCCGG + Intronic
1200060985 X:153483654-153483676 GGGCCCAGGCTAACCTAAGCAGG - Intronic
1201453513 Y:14142678-14142700 GGGACCCAGCTCATCTAAGCAGG + Intergenic