ID: 926315127

View in Genome Browser
Species Human (GRCh38)
Location 2:11704095-11704117
Sequence TGGCATCCCCCAGAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926315118_926315127 25 Left 926315118 2:11704047-11704069 CCTCTCAGGCTTGGCATCTCATG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG 0: 1
1: 0
2: 3
3: 17
4: 141
926315122_926315127 -7 Left 926315122 2:11704079-11704101 CCTCTTACCTGGTAGCTGGCATC 0: 1
1: 0
2: 0
3: 15
4: 181
Right 926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG 0: 1
1: 0
2: 3
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926315127 Original CRISPR TGGCATCCCCCAGAATGGGG AGG Intronic
901684487 1:10936040-10936062 TGGGGTCCCCCAGAATGCAGGGG + Intergenic
901853957 1:12032222-12032244 TGGCCTCCACCAGATGGGGGAGG + Intergenic
902237546 1:15067229-15067251 TGGAACCAACCAGAATGGGGAGG - Intronic
905665512 1:39760999-39761021 TGGCCTCCCAGAGACTGGGGAGG - Intronic
906807301 1:48791496-48791518 GGGCAACCCCCAAAATGGGTTGG - Intronic
912656033 1:111486999-111487021 TGGCATCCCCTCCTATGGGGAGG - Intronic
918433042 1:184482124-184482146 AGCCATCCCCCAGAATCGTGAGG - Intronic
921179531 1:212620845-212620867 AGGCACCCCCCATAATGGGGAGG - Intergenic
923237072 1:232044858-232044880 TGCAATTCCCCAGATTGGGGAGG - Intergenic
923469787 1:234280222-234280244 TGGCTTCCCCCAAAACGAGGGGG + Intronic
923609672 1:235479180-235479202 TGGCACACCACAGAATGGGTAGG + Intronic
924029392 1:239870967-239870989 TGGCGTCACCCAGACTGGCGGGG + Intronic
1062893799 10:1087259-1087281 TGGCATCCCACAGACTGGCTGGG + Intronic
1063968019 10:11362068-11362090 AGCCATCCACCAGAATGGGGTGG - Intergenic
1065252695 10:23832576-23832598 TGGGAGCCCCTAGGATGGGGAGG - Intronic
1067758302 10:49023766-49023788 CTGCATCCCCCAGAGTAGGGTGG - Intronic
1070283316 10:75066066-75066088 TGGCATGGCCCAGAAAGAGGTGG + Intergenic
1074299978 10:112225104-112225126 GGGTCTCCGCCAGAATGGGGTGG + Intergenic
1075090352 10:119441028-119441050 TGGCAGCCCCCAGTAGAGGGAGG + Intronic
1076117120 10:127908015-127908037 GGGCAACCCACAGGATGGGGAGG + Intronic
1076694211 10:132239338-132239360 TGGGCTCCCCCAGCTTGGGGAGG - Intronic
1077415074 11:2421034-2421056 GGGCCTCCTCCAGAATGCGGCGG + Exonic
1077510700 11:2960307-2960329 TGGCTTCCCCCAGCAGGGTGGGG - Intronic
1078338239 11:10480821-10480843 TGGCATAGCCCAGAGTGGGGAGG - Intronic
1079073132 11:17365640-17365662 TTCCATCCCCCAGAAAGAGGAGG + Intronic
1083762915 11:64828382-64828404 TGGGGTCCCACAGAATGGGCCGG - Intronic
1085736425 11:79043070-79043092 TGGAATATCCCAGAGTGGGGTGG - Intronic
1086872874 11:92060526-92060548 TGGCATCCAGGAGAATGGGGAGG - Intergenic
1089574189 11:119430001-119430023 GGGCAGCTCCCAGATTGGGGCGG - Intergenic
1091709839 12:2732017-2732039 GGGCAGCCTCCAGAATGGGCTGG + Intergenic
1092026472 12:5244996-5245018 TGGCAGCCCACAGCTTGGGGTGG + Intergenic
1092192296 12:6529683-6529705 TGGCATCCCTGGGACTGGGGAGG + Intronic
1094499936 12:31012250-31012272 AGGGAACCCCCAGGATGGGGAGG + Intergenic
1096109144 12:49018840-49018862 TGGCAGTCGCCAGACTGGGGCGG + Intronic
1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG + Intergenic
1097178810 12:57159219-57159241 TGGCATCCACCAGATTGATGGGG - Intronic
1100847970 12:98679500-98679522 TGGGATCCCACTGAATGGTGAGG + Intronic
1101888425 12:108689649-108689671 TTGCCTTCCCCAGGATGGGGTGG - Intronic
1102416510 12:112767377-112767399 TGGCATCACCCAGGATGAGAAGG + Intronic
1102575388 12:113853131-113853153 TGGCATCCCCCAGGCTGGGGAGG + Intronic
1106943004 13:34797482-34797504 TGGCATGCCCCAGAAAGGGGTGG + Intergenic
1114072029 14:19119322-19119344 TGGCTACCCCCAGGATGGAGGGG - Intergenic
1114090230 14:19280642-19280664 TGGCTACCCCCAGGATGGAGGGG + Intergenic
1118230431 14:63943121-63943143 AGGAGTCCCCCAAAATGGGGAGG - Intronic
1122159043 14:99769455-99769477 TGGCCTCCCCCACAGTGGGCAGG + Intronic
1122929273 14:104925988-104926010 TGGCCTGCCTCAGCATGGGGCGG - Intronic
1124223786 15:27871470-27871492 TGCCAGCCCCCTGGATGGGGAGG + Intronic
1124372250 15:29110496-29110518 TGGCTTTCCCCACCATGGGGTGG + Intronic
1129390009 15:75215692-75215714 TGGCAACACCCAGAAGGGGCTGG - Intergenic
1129678189 15:77643576-77643598 TGGCATGCCCGAGAATGGCAGGG - Intronic
1135492416 16:22921056-22921078 TGGAATCCCAGTGAATGGGGAGG - Intergenic
1137754390 16:50889837-50889859 CGGCAGCCTCCAGAATGAGGTGG - Intergenic
1139373921 16:66485077-66485099 AGGCATCGCCCAGAAGAGGGCGG + Intronic
1139532617 16:67550090-67550112 TGGAAGCCAGCAGAATGGGGAGG - Intergenic
1140508721 16:75492038-75492060 TGGCATCCCCCAGAGGCAGGGGG + Intronic
1142006553 16:87692118-87692140 TGGCATCCTCCAGGGTGGGTGGG - Intronic
1144917362 17:18735106-18735128 AGGCATCGACCAGAAAGGGGAGG + Exonic
1145720284 17:27065068-27065090 TGGCAGCCTTCAGAATGGAGGGG + Intergenic
1146103268 17:30006769-30006791 TGGCATCCCCCCTACTTGGGAGG - Intronic
1146930499 17:36774106-36774128 TGGGATTCCCCAAAGTGGGGAGG - Intergenic
1147640586 17:41996379-41996401 TGGCATTCCCCAGAGAGAGGTGG + Exonic
1150460532 17:65346456-65346478 TGGCTTTCCCCAAAATGGAGAGG + Intergenic
1157395836 18:47340084-47340106 TGGAATCCCACAGGAGGGGGAGG + Intergenic
1158534618 18:58296529-58296551 TGGCAGCCCCCAGAAGCTGGAGG - Intronic
1159880152 18:73851556-73851578 TGCCATGGCCCAGAACGGGGAGG - Intergenic
1161474344 19:4475772-4475794 TGTCATCACCATGAATGGGGTGG - Intronic
1162387141 19:10366430-10366452 TGGCATCCCCCTGGAGGAGGTGG - Exonic
1162417211 19:10545022-10545044 AGGCAGCCCCCAGGAAGGGGCGG - Exonic
1163765512 19:19161207-19161229 TGGGTTCCCCCAGGATGGAGAGG - Intronic
1163846005 19:19638320-19638342 CATCATCCCCCAGAATGAGGCGG - Exonic
1163847626 19:19646459-19646481 TGGAATCCCCCAGGATTTGGTGG - Intronic
1164751039 19:30654841-30654863 TGGCTTTGCCCAGCATGGGGGGG - Intronic
1165080515 19:33303512-33303534 TGGCGCCCACCTGAATGGGGAGG - Intergenic
1166067654 19:40369596-40369618 AGGCATCTCCCAGTATGGTGGGG - Intronic
925389843 2:3487239-3487261 CGGCAGCCTCCAGAATGGGGAGG - Intergenic
926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG + Intronic
926460049 2:13117934-13117956 TGGCCTTCCCCAGCATGGAGTGG + Intergenic
928028313 2:27757465-27757487 TGGCATTCCCCAGAATAGAATGG - Intergenic
928341420 2:30446664-30446686 TTGCATGCCCCTGAATGGTGGGG - Intergenic
929122750 2:38496904-38496926 TGGCATGCCCCAGGGTGGGGAGG + Intergenic
929652877 2:43699777-43699799 TGGCATCTCCCAGAATTCTGGGG + Exonic
929904940 2:46037219-46037241 TGGAATCCCACAGACTGGGGTGG + Intronic
929940601 2:46330940-46330962 TGACATAACCCAAAATGGGGAGG - Intronic
930001401 2:46864168-46864190 TGGCATCCCTCAGAATGTGGAGG - Intergenic
937924614 2:127158073-127158095 TGCCTTCCCACAGAATGGAGTGG - Intergenic
938578686 2:132627013-132627035 TGACATCCCCAACACTGGGGCGG - Intronic
939356454 2:141109246-141109268 TGGCCTCCCCCAAAATTTGGAGG - Intronic
946728755 2:222688433-222688455 TGGCATACCCCAGAGCGAGGAGG + Exonic
947735042 2:232449939-232449961 TGGAATCACACAGACTGGGGTGG + Intergenic
1172525815 20:35600212-35600234 TGGCCTCCCCCAGAATGTCCTGG - Intergenic
1174139762 20:48404465-48404487 TGGCATCCCTCATCCTGGGGTGG - Intergenic
1175441310 20:58994160-58994182 TGTCATTCTCCAGGATGGGGAGG - Exonic
1175719717 20:61278765-61278787 TGGGCTCCCACAGACTGGGGAGG - Intronic
1178470473 21:32887848-32887870 TGGGAACCCCAAGAATGTGGAGG - Intergenic
1178895059 21:36551073-36551095 CGGCAGCCACCAGAGTGGGGAGG + Intronic
1179334613 21:40438844-40438866 TGGCATCCCCTAGAGTGTGTAGG - Intronic
1179880607 21:44291939-44291961 TGGCACCCAGCAGAATGGGGAGG - Intronic
1180088220 21:45517660-45517682 TGACACCCCCCAGCATGGAGGGG - Intronic
1180490470 22:15841677-15841699 TGGCTACCCCCAGGATGGAGGGG - Intergenic
1180898817 22:19356522-19356544 TGGCTTCCCCCAAAGTGGTGTGG - Intronic
1181156681 22:20926652-20926674 TGGGATCACCCAGAATGAGGAGG + Intronic
1182941204 22:34279439-34279461 TGGCCCTCCCCAGAATGGGTGGG - Intergenic
1183719248 22:39552807-39552829 GGGGATCCCCCAGAAGCGGGGGG - Intergenic
1185136225 22:49074581-49074603 TGGCAGTCCCCAGTGTGGGGAGG + Intergenic
950422540 3:12907363-12907385 AGGCAACCCCAGGAATGGGGGGG + Intronic
954218547 3:49138127-49138149 AGGCATCCCCTAGCATAGGGTGG + Intergenic
956171497 3:66437131-66437153 TGGCATCTCCCAGCATGGGCTGG + Intronic
961033498 3:123626456-123626478 TGTCAACCCTGAGAATGGGGTGG - Intronic
966232179 3:177664583-177664605 AGGCACCCCCCAGTAGGGGGCGG - Intergenic
968288354 3:197521144-197521166 TGCTTTCCCTCAGAATGGGGTGG - Intronic
969568163 4:7992448-7992470 GGGCATCCCCGAGAAGGAGGTGG + Intronic
971871526 4:32246059-32246081 TGGCATCTCCCCGAATGAGCTGG + Intergenic
973119659 4:46505541-46505563 TGGTATCCCTCAGAATGTAGTGG - Intergenic
973349513 4:49093144-49093166 TGGAATCAACCAGAATGGGATGG - Intergenic
973349790 4:49094758-49094780 TGGAATCAACCAGAATGGGATGG - Intergenic
976160144 4:82190424-82190446 TCGCATCTCCCAGAGTGGAGTGG + Intergenic
978439870 4:108722167-108722189 TGGTATCCCACAGATTTGGGAGG - Intergenic
982130752 4:152226894-152226916 TGGGATGGCCCAGAATCGGGAGG + Intergenic
988128628 5:27074846-27074868 TGGCATCCCTGAAAATGAGGAGG + Intronic
990944794 5:61238584-61238606 TGGCTTCCCCCAGAATAAGTGGG - Intergenic
991130090 5:63112142-63112164 TAGCATCCATGAGAATGGGGTGG + Intergenic
993477898 5:88387832-88387854 TTGGATCCCACAGAATGGGTAGG + Intergenic
998856735 5:146401214-146401236 TGACAGCCTCCAGAATGGGAGGG + Intergenic
1000667415 5:164015718-164015740 TTGCATCCTCCAGAATGGTGAGG - Intergenic
1001246117 5:170106626-170106648 TAGCATCCCCCAGTCTTGGGGGG - Intronic
1002028903 5:176414026-176414048 TGGCCTCTCCCAGGATGGTGGGG - Intronic
1003821459 6:9902170-9902192 TGGGATCCCTCAGAATGAGGTGG + Intronic
1004329940 6:14712001-14712023 TTGCATCCCCAAGCCTGGGGAGG + Intergenic
1005452350 6:25985781-25985803 TGGTCTTCCCCAGAAAGGGGAGG + Exonic
1005471201 6:26164272-26164294 TGGCATCTTCCAGGATGGGCTGG - Intronic
1006521892 6:34575576-34575598 TGGTATCCCCCAGAGGGGGGCGG - Intergenic
1011985169 6:93434649-93434671 TGGAATGCACCAGAATTGGGAGG - Intergenic
1015318655 6:131846488-131846510 TGGCATGGCTCTGAATGGGGGGG - Intronic
1019278566 7:188692-188714 TGGGATCCCCAGGAATGAGGGGG - Intergenic
1028903279 7:96124906-96124928 TTGCATCCTCCAGCAAGGGGAGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1030717658 7:112829088-112829110 TGGAATCCCCCAAAAGGTGGGGG - Intronic
1032592901 7:133208693-133208715 TGGCATCCCCCAAAGTGGGATGG + Intergenic
1033755757 7:144397448-144397470 GGGCATCCCCCAGGAGGGGATGG - Exonic
1034100320 7:148445300-148445322 TGGCAGCCCACAGGGTGGGGTGG + Intergenic
1034717001 7:153252788-153252810 TGGCACTCCCCAGCATGGGCGGG + Intergenic
1035351122 7:158247189-158247211 TGGCACCCCCCAGCATGGCCAGG + Intronic
1035628427 8:1090586-1090608 TGGCAGCCCCCTGAGTGGGGAGG + Intergenic
1037946100 8:22990594-22990616 TGGCACCTCCCAGAAGGAGGAGG + Intronic
1040507319 8:48060669-48060691 GGGCATCCACCTGAAAGGGGAGG - Exonic
1042246514 8:66713181-66713203 GGGCAGCCGCCAGAGTGGGGTGG + Intronic
1047337455 8:123950356-123950378 TGGCATGCCCCAGGGTGGGCAGG + Intronic
1048409623 8:134158925-134158947 TGGCATCACAAAGAATGGAGAGG - Intergenic
1050509298 9:6376996-6377018 AGGCACCCCCCAGAAGGGGGTGG + Intergenic
1053476513 9:38385797-38385819 TGGCAACTCACAGACTGGGGAGG - Intergenic
1053506782 9:38650009-38650031 TTGATTCCCCCAGAATGGGAAGG + Intergenic
1058709505 9:107667140-107667162 TGGCAACCCCAAGAAAGGAGGGG + Intergenic
1060061690 9:120466363-120466385 CATCATCCCCCAGAATGGGATGG - Intronic
1060924425 9:127446141-127446163 AGGAAGCCCCGAGAATGGGGAGG + Intergenic
1061910338 9:133719066-133719088 TGGCATCATCCAGAACTGGGTGG + Intronic
1190978067 X:55427264-55427286 AGGCACCCCCCAGTAGGGGGCGG + Intergenic
1192038131 X:67588037-67588059 TGGAAGCCCCCAGAATTGGGAGG - Intronic
1192152903 X:68723072-68723094 TGTCATGCCCCAGGATGGAGGGG + Intronic
1193249688 X:79275415-79275437 TGGCATACCTCAGAAAGAGGAGG + Intergenic
1194830971 X:98621498-98621520 TGGCTTTCCCTGGAATGGGGCGG + Intergenic
1196374590 X:115019128-115019150 TGGGACCCAGCAGAATGGGGTGG - Intronic
1201969902 Y:19780388-19780410 AGGCATCCACCAGAAGGGGCAGG + Intergenic