ID: 926315166

View in Genome Browser
Species Human (GRCh38)
Location 2:11704391-11704413
Sequence TACCCCGCTCTGCCTCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926315166_926315172 13 Left 926315166 2:11704391-11704413 CCCGGGGGAGGCAGAGCGGGGTA 0: 1
1: 0
2: 4
3: 23
4: 296
Right 926315172 2:11704427-11704449 CTGGATTGTGATGTGTCCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 225
926315166_926315176 28 Left 926315166 2:11704391-11704413 CCCGGGGGAGGCAGAGCGGGGTA 0: 1
1: 0
2: 4
3: 23
4: 296
Right 926315176 2:11704442-11704464 TCCAGTGGGATATGAGGCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 147
926315166_926315173 14 Left 926315166 2:11704391-11704413 CCCGGGGGAGGCAGAGCGGGGTA 0: 1
1: 0
2: 4
3: 23
4: 296
Right 926315173 2:11704428-11704450 TGGATTGTGATGTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 147
926315166_926315168 -6 Left 926315166 2:11704391-11704413 CCCGGGGGAGGCAGAGCGGGGTA 0: 1
1: 0
2: 4
3: 23
4: 296
Right 926315168 2:11704408-11704430 GGGGTAGCACATCACCACCCTGG 0: 1
1: 0
2: 0
3: 8
4: 78
926315166_926315175 27 Left 926315166 2:11704391-11704413 CCCGGGGGAGGCAGAGCGGGGTA 0: 1
1: 0
2: 4
3: 23
4: 296
Right 926315175 2:11704441-11704463 GTCCAGTGGGATATGAGGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 144
926315166_926315174 22 Left 926315166 2:11704391-11704413 CCCGGGGGAGGCAGAGCGGGGTA 0: 1
1: 0
2: 4
3: 23
4: 296
Right 926315174 2:11704436-11704458 GATGTGTCCAGTGGGATATGAGG 0: 1
1: 0
2: 0
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926315166 Original CRISPR TACCCCGCTCTGCCTCCCCC GGG (reversed) Intronic
900199908 1:1399772-1399794 GGCTCCGCTCGGCCTCCCCCTGG + Intronic
900226513 1:1535797-1535819 CAGCCCGCCCTGCCGCCCCCAGG - Exonic
900345203 1:2207210-2207232 TGCCCAGCTCTGCCCCCACCAGG - Intronic
900494190 1:2969091-2969113 CACCCCTCTCTGCCCCTCCCAGG + Intergenic
901417583 1:9128429-9128451 AGCCCCGCTGTGCCTGCCCCAGG - Intronic
901745103 1:11367253-11367275 TCCCCCCCACTGCCTCCCACAGG - Intergenic
902745824 1:18473697-18473719 TCTCCGCCTCTGCCTCCCCCAGG - Intergenic
902865267 1:19273774-19273796 TGCCCCGCTCTCCCTGGCCCCGG - Intergenic
903293042 1:22326663-22326685 TAGTCCCCTCTGCCTCCCTCGGG + Intergenic
903603060 1:24556136-24556158 AGCCCCGCTCGGCCTCCCGCCGG - Exonic
904042433 1:27592564-27592586 TCCCCCGCCCTCCCCCCCCCAGG + Intronic
904256358 1:29257454-29257476 CACCCAGCGCTGCCTCCTCCCGG - Intronic
904354610 1:29930903-29930925 TGCCCTGCTCTGCCTGCCCAGGG - Intergenic
906037103 1:42757715-42757737 TACCCCACTCTTCCGCCCTCAGG + Intronic
906274793 1:44507661-44507683 TACCCCCCTCTGCGTCCAGCTGG - Intronic
906815650 1:48875475-48875497 TACCCCACTCTGCTTCCCACTGG - Intronic
906943540 1:50276264-50276286 TCCCCTGCTGTGCCTCCCACAGG - Intergenic
907564796 1:55424825-55424847 TTGACCGCTCTGCTTCCCCCAGG - Intergenic
907938773 1:59066898-59066920 AGCCCTGCTCTGCCTTCCCCAGG + Intergenic
908131918 1:61082797-61082819 TTCTCCGCTCTGTCTCACCCAGG + Exonic
908312349 1:62897287-62897309 TAACCCCCTCCCCCTCCCCCTGG - Intergenic
911093019 1:94032828-94032850 TACCCAACTCTGCCTCCCCAGGG - Intronic
913969855 1:143406505-143406527 TACCCCGCTGTGGCTCTACCAGG + Intergenic
914064229 1:144232099-144232121 TACCCCGCTGTGGCTCTACCAGG + Intergenic
914114921 1:144734255-144734277 TACCCCGCTGTGGCTCTACCAGG - Intergenic
914825004 1:151133549-151133571 TACCCCGCACCGCCTCCCCTTGG - Intronic
915722281 1:157993881-157993903 TACTCCGCGCCCCCTCCCCCAGG - Intronic
918246542 1:182665209-182665231 AACCCTGCTCTGCCTTGCCCAGG + Intronic
920588284 1:207190379-207190401 TTCCCAGCACTGCCTCCCCAGGG + Intergenic
920669365 1:207991456-207991478 GACCCCTCCCTGCCTGCCCCTGG - Intergenic
921274554 1:213506036-213506058 TACCCCACTCTGGCTCCAGCTGG - Intergenic
921715447 1:218412879-218412901 TACATCACTCTGCTTCCCCCAGG - Intronic
922116494 1:222618437-222618459 TCTCCCGCTCTGCCTGCGCCCGG + Intronic
922169366 1:223142405-223142427 AACACCGCTCTCCCTCCTCCGGG + Intronic
923276972 1:232405011-232405033 TACCCCACTCTGCCTCCCTCTGG + Intronic
924143287 1:241048243-241048265 AACCAGGCTCAGCCTCCCCCTGG + Intronic
1062915285 10:1238912-1238934 TACTCCCCTCTCCCTCCCTCTGG + Intronic
1065601229 10:27371003-27371025 TTCTCCTCTCTGCCTCCCGCTGG + Intergenic
1067228077 10:44388182-44388204 TACCCCCCTCTGCCTGGCCTGGG + Intergenic
1071485450 10:86099192-86099214 AACCCAGCTCTGCCATCCCCAGG + Intronic
1072800349 10:98388452-98388474 GACCCCACCCTGGCTCCCCCTGG - Exonic
1072973113 10:100034483-100034505 CACCCCCCTCGGCCTCCCTCTGG - Intergenic
1073208839 10:101782582-101782604 TTCCCAGCTCTGCCTCACCGAGG - Exonic
1073476516 10:103757168-103757190 TACCCTCCACTCCCTCCCCCTGG - Intronic
1074680688 10:115904049-115904071 TTCCCCACACTGCCTCCCACAGG - Intronic
1075868121 10:125745124-125745146 CATCCTGCTCTGCCTCACCCAGG - Intronic
1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG + Intronic
1077090738 11:777242-777264 GACCCCGCTCCGCCCTCCCCCGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077435124 11:2535252-2535274 TACCCTGCTCCACCTGCCCCTGG - Intronic
1080873991 11:36260274-36260296 TCCCCAGCTCAGCCTCCCCGGGG + Intergenic
1083747163 11:64742942-64742964 ACTCCCGCTCTGCCTCTCCCGGG - Intronic
1083796699 11:65021002-65021024 TGCGCAGCTCTGCCTTCCCCAGG - Intronic
1083988184 11:66230642-66230664 TCCAGGGCTCTGCCTCCCCCAGG + Exonic
1089770269 11:120797363-120797385 TAGCCTGCACTGCGTCCCCCAGG - Intronic
1091124163 11:133081698-133081720 TACCCCACAAAGCCTCCCCCTGG - Intronic
1091636135 12:2198294-2198316 TCCCCGCCTCTGCCTCCCCCCGG + Intronic
1092279624 12:7089569-7089591 TACACCACTCTGGCTCACCCTGG + Exonic
1092844839 12:12574641-12574663 TACCCGGCTCAGCCTCCCAAAGG + Intergenic
1093080324 12:14803239-14803261 TGCCCCGCTCCTCCTCTCCCTGG - Intronic
1096771741 12:53939682-53939704 CTCCCCGCCCTGCCTGCCCCGGG + Intronic
1098394834 12:70006377-70006399 TATCCTGCCCTGCCTCCCACAGG + Intergenic
1098596041 12:72273574-72273596 TGCCCCGCGCTGCCCCACCCCGG + Intronic
1100390034 12:94140031-94140053 TACCCCGCTCAGCTGCCCCAGGG - Intergenic
1101404534 12:104416331-104416353 TACCATGCTGTGCCTCACCCAGG - Intergenic
1102079560 12:110086865-110086887 CACCACGCCCTGCCTCCACCTGG - Intergenic
1104860095 12:131919109-131919131 TACCCTGCCCTGCCTCCCCAAGG + Intronic
1105792940 13:23820670-23820692 CACCTGGCTCTGCCTCTCCCAGG + Intronic
1105948163 13:25207330-25207352 TAACCCGGTCTACCTACCCCTGG + Intergenic
1106735692 13:32586380-32586402 TGCCGCGCTCTGCCTGCCCCCGG + Intergenic
1106766246 13:32916722-32916744 AACCACTCTCTTCCTCCCCCAGG + Intergenic
1107534147 13:41311594-41311616 TAGGCCGCGCTGCCGCCCCCCGG + Intronic
1107537443 13:41349718-41349740 TACCCACCTCGGCCTCCCCAAGG - Intronic
1111811432 13:93096974-93096996 AACCCCCCTCTCCCTACCCCCGG + Intergenic
1112037027 13:95506503-95506525 GACTCCCCTCTGCCTCCCTCTGG + Intronic
1112067193 13:95805758-95805780 TCCCCCTCTCTCCCTGCCCCTGG - Intronic
1112372379 13:98805033-98805055 CACCCCGCCCTGCCTCTTCCCGG + Exonic
1113931654 13:113971969-113971991 CACCCTGCACAGCCTCCCCCAGG - Intergenic
1114347061 14:21807608-21807630 TACCCGCCTCTGCCTCCCAAAGG + Intergenic
1115411424 14:33079854-33079876 TGCCCCCCTCAGCCTCCCCAAGG + Intronic
1117326120 14:54670482-54670504 AACCCAGTTCTGCCTCCCCCAGG - Intronic
1119386317 14:74259930-74259952 CACCCTGCTCTGAGTCCCCCAGG - Intronic
1121037278 14:90716892-90716914 TTCCTCCTTCTGCCTCCCCCTGG - Intronic
1121255051 14:92525062-92525084 TACCCAGCTTTGCCTCAGCCAGG - Intronic
1121380662 14:93463126-93463148 TCCCCTGCTCTTCCTCCCCCTGG - Intronic
1121660205 14:95629419-95629441 TACCCAGCTATGCTTCTCCCTGG + Intergenic
1122126141 14:99579686-99579708 TGCCTCCCGCTGCCTCCCCCAGG - Intronic
1122480508 14:102044252-102044274 AACCCTGCTTTTCCTCCCCCAGG + Exonic
1122691497 14:103533957-103533979 TACCCGGCCCTGGCTTCCCCAGG + Intronic
1122902644 14:104788140-104788162 TGCCAAGCTCTGCCTCCCCTGGG - Intronic
1123049626 14:105534732-105534754 TGCCCCCGTCTGCCTCCCTCTGG - Intergenic
1125312047 15:38390350-38390372 TACCCCGCTCTGCCATCCATGGG + Intergenic
1126837890 15:52685973-52685995 TTCCCACCTCAGCCTCCCCCTGG + Intronic
1128481632 15:68045372-68045394 AGCCCAGCTCTGCCTCCTCCTGG - Intergenic
1128570047 15:68727076-68727098 GACCCTGGTCTGCCTTCCCCAGG - Exonic
1129237810 15:74234301-74234323 TTCCCTGCTCTCCCTCACCCTGG + Intergenic
1130124792 15:81084372-81084394 TTCCCTCCTCTCCCTCCCCCGGG + Intronic
1131077302 15:89503370-89503392 TACCACACCCTGCCTCTCCCTGG - Intergenic
1136228072 16:28872203-28872225 CACCGCCCTCTGGCTCCCCCTGG - Exonic
1136276470 16:29181992-29182014 CACCCCGCTCTGCAGCCTCCAGG + Intergenic
1136381235 16:29896910-29896932 CACCCAGCCCTGCCTCCCCAGGG - Exonic
1137675244 16:50300869-50300891 TACCCAGCCCAGCCTCACCCGGG - Exonic
1137675965 16:50304040-50304062 TACCCTGCTCTGCCTCCCCAGGG - Intronic
1138545851 16:57719040-57719062 CACCCCGCTCTGCAACCCCCTGG + Intronic
1139521725 16:67486652-67486674 TAGGAGGCTCTGCCTCCCCCAGG - Intergenic
1139710176 16:68770177-68770199 TAGCCCTCTCTGCCACCACCAGG + Intronic
1139848187 16:69935111-69935133 TCCCGCGCTGTGCCTCCCACGGG - Intronic
1141668730 16:85480407-85480429 CACCCCCCTCTGCCTGCTCCAGG + Intergenic
1142214659 16:88824672-88824694 CACCCTCCTGTGCCTCCCCCAGG + Intronic
1142933453 17:3308185-3308207 TACCTGGTTCTGGCTCCCCCTGG + Intergenic
1143148210 17:4789996-4790018 GTCCCAGCTCTGCCTCCACCGGG + Exonic
1143515690 17:7418226-7418248 TCCTCCCCTCTCCCTCCCCCTGG + Exonic
1143679635 17:8466946-8466968 GACCCCGCTCCTCCTCCTCCTGG + Exonic
1144631422 17:16874408-16874430 AACCCAGCTCAGCCTCCCCGAGG - Intergenic
1144649179 17:16996866-16996888 AACCCCGCTCAGCCTCCCCGAGG + Intergenic
1144954086 17:19010438-19010460 CCCCCAGCTCTGCCTCCCCGGGG + Intronic
1147163765 17:38582518-38582540 TACCCCTCACTGCCTCCTCCAGG + Intronic
1147165757 17:38592355-38592377 TTCCCTGCCCTGCCTCCCCAAGG + Intronic
1148847893 17:50539934-50539956 ATCCCAGCTCTGCCTCTCCCTGG + Intronic
1150953091 17:69824176-69824198 TGCCCAGCTCTTCCTACCCCAGG + Intergenic
1151421209 17:73999135-73999157 TCCCCCGTGCTGCCTCCGCCTGG + Intergenic
1151558631 17:74859677-74859699 GACCCCGCCCGGACTCCCCCTGG + Intronic
1152182767 17:78834685-78834707 TGCCCACCTCTGCCTCCCACAGG + Intronic
1152510059 17:80780758-80780780 TTCCCCCCTCACCCTCCCCCCGG + Intronic
1152550586 17:81028066-81028088 ACCCCCGCACTGCCTCCCACAGG + Intergenic
1152747899 17:82049615-82049637 TGCCCCGCCCTGACTCCCCCAGG - Intronic
1152940809 17:83172220-83172242 CACCCTGCTCTGCCTGCCCTTGG - Intergenic
1157244209 18:46039316-46039338 TACCATGCCCTGCCACCCCCAGG + Intronic
1160563961 18:79775522-79775544 CATCCCGCTCTGCCCCACCCAGG - Intergenic
1160611945 18:80095693-80095715 TCCCCTGCTCTGCCTCTCCGAGG - Exonic
1160710084 19:547442-547464 TACCCTGCCCTGCCCACCCCAGG + Intronic
1160976346 19:1794552-1794574 CACCCCAGGCTGCCTCCCCCTGG - Intronic
1161003146 19:1921248-1921270 AGCCCCGCTCTCCCTGCCCCGGG + Intronic
1161266396 19:3366645-3366667 GTCCCCGCTCTGCCTCACCCAGG + Exonic
1161288460 19:3480394-3480416 TACCCTGCTGGGCCTCCACCGGG + Exonic
1161340470 19:3739093-3739115 TGCCCCGCTCTTGCTCCCGCAGG - Exonic
1161477439 19:4494325-4494347 TGCCCCGCTCAGCCTCCCCGCGG - Exonic
1162235954 19:9309724-9309746 CGCCCCGCCCTGCCTGCCCCGGG - Intronic
1162805993 19:13138404-13138426 TAACCCGCCCAGCCTCCCGCGGG + Exonic
1162964527 19:14149613-14149635 TACCTCTCACTGCCTGCCCCAGG - Exonic
1163241178 19:16064777-16064799 CACCCCGCTCTGCCACAACCAGG - Intergenic
1166656520 19:44615903-44615925 TACCCCACCCTCCCGCCCCCAGG - Intronic
1166851135 19:45761917-45761939 CACCACCCTCTCCCTCCCCCAGG + Exonic
1166852200 19:45766326-45766348 TACCCCCATCTCCCTCCCTCAGG - Intronic
1167657417 19:50774175-50774197 CTCCCCGCTCAGCCTCCCACAGG - Intergenic
1168296513 19:55379598-55379620 TCCCCCTTTCTGCCTCTCCCTGG - Intronic
1168328257 19:55549819-55549841 ATCCCAGCTCTGCCTCTCCCTGG - Intergenic
926002579 2:9345738-9345760 TGCCCAGCTCTGCCTTCACCAGG - Intronic
926315166 2:11704391-11704413 TACCCCGCTCTGCCTCCCCCGGG - Intronic
928498221 2:31857827-31857849 TGCCCCGCTCCGCCTCCCAAAGG - Intergenic
929461221 2:42102968-42102990 TACCTCTCCCTCCCTCCCCCTGG + Intergenic
932462811 2:71894291-71894313 TTTCCCGCTCTGTCTCCCCAGGG + Intergenic
933759780 2:85665506-85665528 TTCCCGGCTCTGCCTCTCCCAGG + Intronic
934174547 2:89567418-89567440 TACCCCGCTGTGGCTCTACCAGG + Intergenic
934284863 2:91641768-91641790 TACCCCGCTGTGGCTCTACCAGG + Intergenic
934695645 2:96398057-96398079 TGCCCCGGGCTGCCTCCCCAGGG - Intergenic
935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG + Intronic
937226870 2:120375290-120375312 TGCCCCTCACTGCCTCCCCAAGG + Intergenic
937920013 2:127122291-127122313 TGCCCCTCACTGCCTCCCCAAGG + Intergenic
938381319 2:130837822-130837844 CACACAGGTCTGCCTCCCCCTGG - Intronic
938729408 2:134134610-134134632 TACCACGCCCTGCCCACCCCTGG - Intronic
938916923 2:135951060-135951082 TCCACCAATCTGCCTCCCCCAGG - Intronic
939334209 2:140803927-140803949 TACCCCACTCTGTCTGCCCTAGG - Intronic
941161607 2:162041980-162042002 TAATCCTCTCTGCCTCCCCAAGG - Intronic
942276403 2:174326830-174326852 TTCCCTCCTCCGCCTCCCCCAGG + Intergenic
946309196 2:218873362-218873384 TCCGCCCCTCTGCCTCCCGCAGG + Exonic
948254854 2:236559428-236559450 TCCCTCTCTCTGCCTGCCCCAGG + Intergenic
948588638 2:239036086-239036108 GACCCCTGGCTGCCTCCCCCTGG - Intergenic
948643711 2:239390918-239390940 TGCCCCGCTTTCCCTCCCCTTGG - Intronic
948690115 2:239696746-239696768 AACCCCGCTCTGCCTCCCCAGGG + Intergenic
1169623823 20:7540192-7540214 CACCTTGCTCTCCCTCCCCCAGG - Intergenic
1170567332 20:17614591-17614613 CGCCCAGCTCTGCCTCCCCTGGG + Intronic
1170791887 20:19515570-19515592 TACCCCTCTGTGCCTCTGCCTGG + Intronic
1171251864 20:23654910-23654932 TTCCCCTATCTGCCTCCTCCTGG - Intergenic
1172117688 20:32582347-32582369 TGACCCGCTCTGCCTGCCCCTGG - Intronic
1173498520 20:43535846-43535868 AGCCCAGCTCTGCCTCCCCTGGG + Exonic
1174066590 20:47870249-47870271 TGCCCGCCTCTGCTTCCCCCAGG + Intergenic
1174394175 20:50235944-50235966 ATCCCAGCTCTGCCTCCCCTTGG + Intergenic
1174606707 20:51767256-51767278 CACCGCGCTCAGCCTCCCGCGGG + Intronic
1175824674 20:61930496-61930518 TTCCCCGCCCTGCCTCCCACTGG - Intronic
1175902013 20:62363702-62363724 TACCCCGCCCAGCCTCCCTTGGG + Intronic
1175937365 20:62519949-62519971 CACTGCCCTCTGCCTCCCCCAGG + Intergenic
1176206446 20:63891233-63891255 TGCCCGGCTCTGCCACTCCCGGG + Exonic
1176250152 20:64116769-64116791 GGCCCCTCTCCGCCTCCCCCCGG + Intergenic
1176380668 21:6110948-6110970 TCTCCCGCTCTCCCTCCGCCCGG + Intergenic
1176876198 21:14131326-14131348 TACCCCACTCTGCCACCACTGGG + Intronic
1177665680 21:24155609-24155631 TCCTCCTCTCTGCCTCCACCAGG + Intergenic
1179476368 21:41648744-41648766 TGCTTCCCTCTGCCTCCCCCGGG - Intergenic
1179550029 21:42137959-42137981 TTCCCCTCTCTGCCTGCTCCTGG - Intronic
1179742804 21:43427292-43427314 TCTCCCGCTCTCCCTCCGCCCGG - Intergenic
1179978509 21:44884480-44884502 GAGCCCCCTCTGCCTCCCACTGG - Intergenic
1181265485 22:21628626-21628648 TACCCCAGTGTGCCTCCCACCGG - Exonic
1181331810 22:22098616-22098638 TTCCCCTCTCTTCCTGCCCCAGG - Intergenic
1181359354 22:22323005-22323027 AACCCCCTTCTTCCTCCCCCAGG + Intergenic
1182353301 22:29710839-29710861 TACCCCCCACTGCCTCCCAATGG + Intergenic
1182668130 22:31973626-31973648 TTCCCCTCCCTCCCTCCCCCAGG - Intergenic
1183160607 22:36110554-36110576 GACCCCAATCTGCCTCCCGCTGG - Intergenic
1183206957 22:36426317-36426339 TTCCCTGCCCTGTCTCCCCCTGG + Intergenic
1183340890 22:37280704-37280726 TCCCCTGCCCTGCCTCCACCTGG - Intergenic
1183398115 22:37584950-37584972 TACCCGCCTCGGCCTCCCACAGG + Intergenic
1183427513 22:37747370-37747392 CACCCTGCTCATCCTCCCCCAGG - Intronic
1183587680 22:38762488-38762510 TGCCCCCCTCTCCCTCCCACAGG + Intronic
1183941797 22:41300037-41300059 TACCGCGCCCGGCCTCCTCCTGG + Intergenic
1184092361 22:42299379-42299401 TACCTTGCTCTCCCTCCCCATGG + Intronic
1184543692 22:45150334-45150356 GAGCCCTCTCTCCCTCCCCCTGG + Intergenic
1185035577 22:48475041-48475063 TCGCCCCCTCTGCCTCCCACAGG + Intergenic
1185035593 22:48475079-48475101 TCGCCCCCTCTGCCTCCCGCAGG + Intergenic
1185350312 22:50332864-50332886 CACCCGCCTCTGCCTCCCCATGG + Intergenic
949908928 3:8884095-8884117 AACCCCGCTCTGCCTTCTCTGGG + Intronic
950661147 3:14467775-14467797 TAACCCTCGCTGCCTCCTCCAGG + Intronic
954438315 3:50507820-50507842 TACCCAGCTCTGCCTCCACCTGG + Intergenic
954781270 3:53063095-53063117 TTCCCCGCCCCGCCTCCACCAGG - Intronic
956782679 3:72616724-72616746 TGCCCCGCACTGCCTCCCAAAGG - Intergenic
960967620 3:123116153-123116175 CACCCTGCCCTGCCTCCCCATGG - Intronic
961343228 3:126244360-126244382 TACCCCAATCTGTCTCACCCTGG + Intergenic
961819999 3:129571144-129571166 TGCCCCGCTGTGCCTCCTCGGGG + Exonic
967453804 3:189657368-189657390 TACCCCATTCTGCCTTCCACTGG - Intronic
967819946 3:193831285-193831307 TACACCTTTCTGCCTCCCTCTGG + Intergenic
968213505 3:196868437-196868459 TAGACCGCTCTGCCTCCTTCCGG + Intronic
968553428 4:1235884-1235906 GACCCCGCACTGCCGGCCCCAGG - Intronic
968764023 4:2458893-2458915 TACCCCGCTCTTCCCCACTCGGG + Intronic
969993334 4:11287091-11287113 TATCCCATTCTGCCTCCTCCGGG + Intergenic
970611209 4:17726790-17726812 TTCCCAGCTCAGCCTGCCCCAGG + Intronic
975696961 4:77023041-77023063 TACCCAGCTCCACCTCCTCCTGG - Intronic
975841365 4:78477749-78477771 TCCCCTGCTCTGCTTCCCCAGGG - Intronic
978159307 4:105527023-105527045 TGCCCCTCTCTTCCTCCTCCTGG + Intergenic
982159990 4:152558693-152558715 TGCCTCACTTTGCCTCCCCCTGG - Intergenic
985806581 5:2048757-2048779 TTCCCAGCTCTGCCTTCCTCCGG + Intergenic
990984129 5:61626189-61626211 TGCCCAGCTCTGCCTCCTCGGGG - Intergenic
991683446 5:69160820-69160842 TACCCCACCGTGCCTCCGCCTGG + Intergenic
993151970 5:84173475-84173497 TGCCCCCCTCTCCCGCCCCCTGG + Intronic
996776125 5:127134566-127134588 AACCCCTCTCTCCCTACCCCTGG + Intergenic
997475313 5:134139216-134139238 TACCCCGGCCTGCATTCCCCAGG + Intronic
997613278 5:135229955-135229977 TGCCCTGCTCTGCCTTGCCCAGG + Intronic
999251825 5:150187100-150187122 TCCCCAGCTCTGCATCCCTCTGG - Intergenic
1000368321 5:160511303-160511325 GTCCCCTCTCTGCATCCCCCAGG + Intergenic
1001295111 5:170493783-170493805 TGCCCCACTCTTCCTTCCCCAGG + Intronic
1001523403 5:172411961-172411983 CTCCCCCCTCTCCCTCCCCCTGG + Intronic
1001845500 5:174917799-174917821 CTGCCCTCTCTGCCTCCCCCAGG + Intergenic
1002099355 5:176849751-176849773 GCCCCCACTCTGCCTCCACCTGG - Intronic
1002301500 5:178259747-178259769 AACCCCCCATTGCCTCCCCCAGG - Exonic
1003903857 6:10680645-10680667 CTCCCAGCTCTGCCTCCCCAAGG - Intronic
1006770255 6:36547196-36547218 TCCCCAGCCCTGCCTCTCCCTGG - Exonic
1007357552 6:41332493-41332515 CACCCCGTTCAGCCGCCCCCAGG - Intergenic
1007363019 6:41372122-41372144 TCCCTCGCTCTGCCTCTCTCGGG + Intergenic
1007733776 6:43967869-43967891 TGCCCCAGCCTGCCTCCCCCGGG + Intergenic
1008344081 6:50404852-50404874 TACTCCACCCTCCCTCCCCCTGG + Intergenic
1010191237 6:73199201-73199223 TACCCAGCTCTGCCTCACCAGGG + Intergenic
1010841319 6:80651268-80651290 CACCCAGGCCTGCCTCCCCCAGG - Intergenic
1011684710 6:89815027-89815049 TACCCCTTTCTTCCTCCTCCTGG - Intronic
1016385015 6:143522468-143522490 TACCCAGCCCTGCCTGCCTCTGG + Intergenic
1017955050 6:159170134-159170156 AGCCCTGCTCTGCCTCCCTCCGG - Intronic
1018708179 6:166478058-166478080 TCCCCTGCTTGGCCTCCCCCTGG - Intronic
1019312977 7:371744-371766 TACCCCTCTCTCCCTCTTCCTGG + Intergenic
1019452713 7:1108038-1108060 AGCCCCCCTCTGCTTCCCCCCGG - Intronic
1019452731 7:1108086-1108108 AGCCCCCCTCTGCTTCCCCCCGG - Intronic
1019452749 7:1108134-1108156 AGCCCCCCTCTGCTTCCCCCCGG - Intronic
1019452767 7:1108182-1108204 AGCCCCCCTCTGCTTCCCCCCGG - Intronic
1019452833 7:1108362-1108384 AGCCCCCCTCTGCTTCCCCCCGG - Intronic
1019596121 7:1859180-1859202 TTCCCCAGCCTGCCTCCCCCTGG + Intronic
1020014011 7:4820678-4820700 TGGCCGGCTCTGCCTCCCCCAGG + Intronic
1022522501 7:31017182-31017204 TGCCCCGCTCTGCCTGGCCCAGG - Intergenic
1023991270 7:45130204-45130226 AACCCCTCCCTGCTTCCCCCAGG + Intergenic
1024055630 7:45658437-45658459 TGCACCCCTCTGCCACCCCCAGG + Intronic
1024258765 7:47558724-47558746 GTCCCAGCTCTGCCTCCCCAGGG + Intronic
1025205843 7:56992972-56992994 TGCTCAGATCTGCCTCCCCCAGG - Intergenic
1025666097 7:63583966-63583988 TGCTCAGATCTGCCTCCCCCAGG + Intergenic
1026403220 7:70037732-70037754 TACCCTGCTCTGCCACTTCCTGG + Intronic
1026736930 7:72954753-72954775 CACCCGGCTCTGCCCCCGCCCGG + Intergenic
1027106802 7:75410310-75410332 CACCCGGCTCTGCCCCCGCCCGG - Intronic
1027193290 7:76010560-76010582 GACCCAGCTCAGCCTCACCCTGG - Intronic
1027229176 7:76262164-76262186 TGCACCACTCTGCCTCCACCTGG - Intronic
1029550116 7:101232945-101232967 TCCCCCACTATCCCTCCCCCTGG - Intronic
1029582742 7:101448117-101448139 TATCCAACTCTGCCTGCCCCAGG - Intronic
1032094549 7:128931408-128931430 TCCCTGGCTCTGCCTGCCCCAGG + Intergenic
1032194038 7:129779734-129779756 AGCCCCGCTCTGGCTCCGCCCGG + Intergenic
1034343097 7:150370282-150370304 TCACCGGCTCTGCCTCCCTCGGG - Intronic
1034969375 7:155409531-155409553 TGCTGCGCTCTGCATCCCCCAGG - Intergenic
1035085198 7:156252283-156252305 TTCCCAGCTCCGCCTCCACCTGG + Intergenic
1035580797 8:738127-738149 TTCTCCGCTCTGCCTGCCCGGGG + Intergenic
1039890877 8:41684427-41684449 AAGCCCGCTCTGCCTCCCATTGG - Intronic
1041249642 8:55921722-55921744 TGCCCCTCCCTGCCTCTCCCAGG - Intronic
1045056516 8:98372738-98372760 TATCCTGCTCTGCCTCCTCCTGG - Intergenic
1045724766 8:105159538-105159560 TGCCTGGCTCTGCCTCCCTCAGG + Intronic
1048233997 8:132673160-132673182 TACACCGCACTGCCGCCCACAGG - Intronic
1048450132 8:134525737-134525759 TGCCCTCCTCTGCCTCCACCAGG - Intronic
1049205299 8:141360881-141360903 TCCACAGCTCTGCCTCGCCCTGG + Intronic
1049376216 8:142290323-142290345 TTCCCCGCTCTCCCGCCCTCTGG - Intronic
1049802870 8:144526379-144526401 TGGCCCACTCAGCCTCCCCCAGG + Exonic
1049991845 9:998577-998599 TTCCCGGCTCTGCTGCCCCCTGG + Intergenic
1049991866 9:998675-998697 TTCCCGGCTCTGCTGCCCCCTGG + Intergenic
1049991887 9:998773-998795 TTCCCGGCTCTGCTGCCCCCTGG + Intergenic
1049991908 9:998871-998893 TTCCCGGCTCTGCTGCCCCCTGG + Intergenic
1049991929 9:998969-998991 TTCCCGGCTCTGCTGCCCCCTGG + Intergenic
1050090986 9:2016402-2016424 TACCCTGCCCTCCCTCTCCCCGG + Intronic
1052352400 9:27470871-27470893 CCCCCAGCACTGCCTCCCCCTGG + Intronic
1052916095 9:33925273-33925295 TTCCCAGCTCTGCCTCTTCCGGG - Intronic
1053019480 9:34685003-34685025 AACCCTGCCCTGCCTGCCCCTGG + Intergenic
1053070875 9:35101261-35101283 TCCGCCGCTCTGCCTCCACCTGG + Exonic
1053157896 9:35792731-35792753 TGGCCCGCTTTGCCTCCCACTGG + Exonic
1057236624 9:93366393-93366415 TACCGGGCTCTGCCCCCTCCAGG - Intergenic
1057603170 9:96477435-96477457 TACCAACTTCTGCCTCCCCCAGG + Intronic
1058031870 9:100209070-100209092 TACACCGTACTGCCTCCCCATGG + Intronic
1059459002 9:114417990-114418012 TACTCCACTCTGTCTCTCCCAGG - Intronic
1060361071 9:122958230-122958252 TTCCCATGTCTGCCTCCCCCAGG + Intronic
1060480630 9:124015054-124015076 TACCCCCCTTTTCCTCCTCCAGG - Intronic
1060530644 9:124345399-124345421 GACCCCTCTCGGCCTTCCCCAGG - Intronic
1060667478 9:125440586-125440608 CATCTCGCGCTGCCTCCCCCGGG - Intronic
1061150626 9:128826151-128826173 TTCCCGGCTCTGCCTCCACAGGG - Exonic
1062274059 9:135722293-135722315 TGCCCCGCTGTGCCGGCCCCAGG - Intronic
1062477009 9:136733194-136733216 TCCCCCGATCTGCCCCCACCAGG - Intergenic
1185796813 X:2972527-2972549 TACCCCAAGCTGCCTCACCCTGG + Intergenic
1187397453 X:18930931-18930953 TTCCCCTCCCTGCCTCCCCGGGG + Intronic
1188261962 X:28033463-28033485 TCCCACCCTCTGCCTCCCCAGGG - Intergenic
1188262447 X:28036641-28036663 TCCCACCCTCTGCCTCCCCAGGG + Intergenic
1188451132 X:30309005-30309027 AGCCCCGCTCTGCCCACCCCGGG + Exonic
1189312940 X:40032790-40032812 TGCCCTCCTCTTCCTCCCCCAGG - Intergenic
1190927529 X:54922575-54922597 TAGGGCCCTCTGCCTCCCCCGGG + Exonic
1193120048 X:77813777-77813799 TGCTCAGCTCCGCCTCCCCCAGG + Intergenic
1194973823 X:100373249-100373271 TGCCCCCCTCAGCCTCCCTCGGG + Intronic
1196583584 X:117403924-117403946 TTCCCCTCTCTACCTCCACCAGG + Intergenic
1196979656 X:121197314-121197336 TGCCCAGCTCAGCCTCCCACAGG - Intergenic
1197761461 X:130031039-130031061 TCCCCCTCTCTCCTTCCCCCTGG - Intronic
1198778369 X:140206044-140206066 TGCCCTGCTTTGCCTCCTCCAGG + Intergenic