ID: 926315246

View in Genome Browser
Species Human (GRCh38)
Location 2:11704883-11704905
Sequence GGGGACTAGCTAGTCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926315238_926315246 29 Left 926315238 2:11704831-11704853 CCAGAGGCCACACACACTTATGT 0: 1
1: 0
2: 0
3: 16
4: 148
Right 926315246 2:11704883-11704905 GGGGACTAGCTAGTCATCACTGG 0: 1
1: 0
2: 0
3: 3
4: 42
926315239_926315246 22 Left 926315239 2:11704838-11704860 CCACACACACTTATGTGTCAGAT 0: 1
1: 0
2: 1
3: 10
4: 193
Right 926315246 2:11704883-11704905 GGGGACTAGCTAGTCATCACTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926315246 Original CRISPR GGGGACTAGCTAGTCATCAC TGG Intronic
904130695 1:28273322-28273344 GAGGAGTAGCTGGTCACCACGGG + Intronic
907273301 1:53303293-53303315 GGGGAGCAGCCAGTCCTCACAGG + Intronic
923628532 1:235634072-235634094 GGGGACTAGTTAGTGACCAGTGG - Intronic
1063498467 10:6531455-6531477 GGGGACTAGCCTGTCATCGTAGG - Intronic
1063949246 10:11207288-11207310 GGGAGCTTGCTAGTCTTCACGGG + Intronic
1076682353 10:132179657-132179679 GGGGACTCGCTAGGATTCACAGG + Intronic
1084049720 11:66591893-66591915 GGGGACTCGCTACCCACCACTGG - Exonic
1099847705 12:88049934-88049956 GAGAATTAGCTAGTGATCACTGG - Exonic
1105359077 13:19690153-19690175 GGGGACTACCTAATCCTCTCAGG - Intronic
1119400058 14:74357210-74357232 GGGGGCAAGCTGGTCATCTCAGG - Exonic
1119754266 14:77103698-77103720 GTGGACTAGCTGTTTATCACTGG + Intronic
1126292685 15:47099732-47099754 GGGGGCTGGCATGTCATCACTGG + Intergenic
1146064513 17:29623757-29623779 CGGGACTGGCTGGTCTTCACTGG - Intergenic
1165322850 19:35096916-35096938 GGGGAGCACCTTGTCATCACTGG - Intergenic
926043153 2:9690867-9690889 GGGGACCAGCTAGTGATGGCGGG + Intergenic
926315246 2:11704883-11704905 GGGGACTAGCTAGTCATCACTGG + Intronic
930094382 2:47555941-47555963 GAGGACAGGCAAGTCATCACTGG + Intronic
940247178 2:151632342-151632364 GGGCAATAACTAGTCAGCACAGG - Intronic
945722706 2:213438400-213438422 GGGCCCTAGCTTGCCATCACAGG - Intronic
1171364328 20:24613510-24613532 GGGGTCTAGCTAGGCACAACGGG - Intronic
1175574848 20:60053081-60053103 GAGGACTAGCTGGTGATCACAGG + Intergenic
1181436394 22:22913737-22913759 GGGGACCAGCCAGGCCTCACTGG + Intergenic
1184346667 22:43917845-43917867 TGGGACCAGCAAGTCTTCACAGG - Intergenic
950484417 3:13264584-13264606 GGGGACTGGCTTGGCATCTCCGG + Intergenic
955232401 3:57110685-57110707 GGGGATTCCCTAGTCAACACTGG - Intronic
955305100 3:57822650-57822672 GGGGACCAGCAAGTCATACCAGG - Intronic
960248154 3:115422395-115422417 GGGGCCTACCTAGTCCTCTCTGG + Intergenic
968008051 3:195256229-195256251 GGAGACTAGCTACCCCTCACAGG + Intronic
968244541 3:197129801-197129823 GGGGAATGACTAGTCATCAGAGG + Intronic
977352647 4:95907674-95907696 GTGGAATAGCCAGTCCTCACCGG - Intergenic
982264211 4:153523385-153523407 GGGGACTAGCTATTCATTTTAGG + Intronic
985424192 4:189812549-189812571 GGGGAATAGCAAGTGATCACTGG - Intergenic
988424557 5:31048636-31048658 GCGGAATAGCTCTTCATCACTGG - Intergenic
990901207 5:60751365-60751387 TGGGACTAGCTAATGATCACTGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
1006058254 6:31401391-31401413 GGGGAATAGTTAGTAATGACAGG + Intronic
1006070635 6:31495602-31495624 GGGGAATAGTTAGTAATGACAGG + Intronic
1011755256 6:90492324-90492346 GTAGACAAGCTACTCATCACTGG - Intergenic
1013463891 6:110400349-110400371 GGGGACTGGCGCCTCATCACGGG + Intronic
1026134089 7:67644108-67644130 GGGGACCACCTGGCCATCACCGG + Intergenic
1027700145 7:81459611-81459633 GGGGAGTGGCTAGTGATAACAGG - Intergenic
1030500069 7:110349034-110349056 GGGAAAAAGCTAATCATCACTGG - Intergenic
1038926341 8:32144071-32144093 GGGAACAAGACAGTCATCACAGG + Intronic
1044384824 8:91575405-91575427 GTGGAATAGCTAGCCTTCACAGG - Intergenic
1058465135 9:105219680-105219702 AGGGCCTAGCTACTCATCTCTGG - Intergenic
1062587011 9:137254013-137254035 GGGGCCTCCCTTGTCATCACTGG + Intergenic