ID: 926320042

View in Genome Browser
Species Human (GRCh38)
Location 2:11743345-11743367
Sequence AGGGAGAGGACAGTGATCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 427}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926320042 Original CRISPR AGGGAGAGGACAGTGATCCT CGG (reversed) Intronic
900108988 1:997820-997842 AGGGCCAGGCCAGTGACCCTGGG - Intergenic
900410183 1:2509069-2509091 AGGAAGAGGACGGTGAGACTGGG + Intronic
900507992 1:3039207-3039229 AGGGAGAGGAGAGAGCTGCTGGG - Intergenic
900812872 1:4821287-4821309 ATGAAGAGGACAGGGATCCTAGG - Intergenic
901496310 1:9624397-9624419 AGGCAGAGGACAGGGAACCTGGG - Intergenic
902435053 1:16393133-16393155 AGGGAGAGGAAAGTGATGAGAGG + Intronic
903123885 1:21234833-21234855 AGGGACAGGACATGGATCCTGGG + Intronic
903182084 1:21609889-21609911 AGGTGGAGGACAGTGATACCAGG + Intronic
903575549 1:24337602-24337624 AGGGAGAGGACAGTGAGGCTGGG - Intronic
903891978 1:26575758-26575780 AGGCAGAGGCCAGTTATGCTAGG + Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
905652183 1:39663887-39663909 CTGGAGAGGACAGAGGTCCTGGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906702822 1:47872244-47872266 AGGGAGTGGAATGTTATCCTGGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
910322594 1:85965599-85965621 AGGGAGAGAAGAGAGATCCCAGG + Intronic
910392247 1:86757175-86757197 AGGGAGAAGACAGAGCTGCTTGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911154172 1:94622966-94622988 AGGGTGAGGCCAGTGGACCTGGG + Intergenic
912191331 1:107344372-107344394 TAGGAGAGGACAGGGCTCCTAGG + Intronic
912386364 1:109273062-109273084 AGTGGGAGGACAGTGGGCCTGGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913576339 1:120179125-120179147 AGGAAAAGGATAGTGATCTTAGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916606945 1:166352403-166352425 AGTGAGATGACAGTGAGACTAGG - Intergenic
917041101 1:170807296-170807318 AGAGAGAGAACAGTGATCCAAGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917488217 1:175474604-175474626 AGGGAGAAGAAAGTGATCCAAGG + Intronic
918354830 1:183697825-183697847 AGGGAGAGAACTGAGATACTTGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919471654 1:197986800-197986822 AGGGAGAGAAAAGTGAACATAGG + Intergenic
919822308 1:201481101-201481123 AGGGTGAGGATAGAGATCTTGGG - Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
920433735 1:205935278-205935300 AGGGAAAGGACAAAGAACCTGGG + Intronic
920872231 1:209804704-209804726 TGGGAGAGGACAGTTATGCTCGG - Intronic
922344715 1:224686921-224686943 AGGTAGAGTACAGTGTTCCTTGG - Intronic
922603457 1:226874045-226874067 AGGGAGAGCAGAGTGAGCCCTGG + Intronic
922806195 1:228391319-228391341 AGGGAAAGCACAGGGATCCGGGG + Intergenic
923260502 1:232263680-232263702 GGAGAGAGGACAATGACCCTTGG - Intergenic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923732005 1:236560622-236560644 AGGGGCAGGACAGTGGCCCTGGG + Intronic
923885420 1:238149907-238149929 AGGAAGAGGATAGAGATCATGGG + Intergenic
924107886 1:240667597-240667619 AGAGAGAGGAGAGTGATCAAAGG - Intergenic
924605605 1:245532137-245532159 AGGGGAAGGACAATGATCCACGG + Intronic
924860563 1:247916215-247916237 ACGGAAAGGACAGCGATGCTGGG - Intergenic
1062921564 10:1284293-1284315 TTGGTGAGGACAGTGATCCAGGG + Intronic
1063957796 10:11282317-11282339 AGGGAGAGGACAGGCACCCAGGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1068017540 10:51536225-51536247 TGGGAAAGGACACTCATCCTAGG + Intronic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069558514 10:69413544-69413566 AGGGAGGGGGCAGAGACCCTGGG + Intronic
1069563140 10:69445392-69445414 AGTGAGGGGACAGGGATGCTTGG - Intergenic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071182324 10:83001562-83001584 ACGGAGAGGACAGAGAACCGGGG + Intergenic
1072664116 10:97381526-97381548 TGGGAGGGGAGAGTGGTCCTGGG - Intronic
1072733294 10:97862800-97862822 GGGGAGAGGTGAATGATCCTGGG + Intronic
1073027300 10:100497351-100497373 AGGGAGAGGACCATGAGCCTGGG + Intronic
1073215626 10:101834497-101834519 GGGGAGAGGAAGGAGATCCTGGG - Intronic
1073527839 10:104201795-104201817 AGGCAGAGGAAAATGATCCCAGG - Intronic
1074548370 10:114419812-114419834 TCGGAGAAGACAGAGATCCTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075643196 10:124080044-124080066 AGTGAGAGGACAGGGATGTTGGG + Intronic
1075736148 10:124665748-124665770 ATGGAGAGGACAGTTAGCCCTGG - Intronic
1076023727 10:127094958-127094980 ATGGAGAGGGCAGAGAGCCTTGG - Intronic
1076522624 10:131090538-131090560 GGGGAGAAGACAATGGTCCTGGG - Intergenic
1077214856 11:1390978-1391000 AGGGAGAGGCCATTGGTGCTGGG + Intronic
1078340030 11:10492074-10492096 AAGGAGAGGACAGAGATGCAAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079441346 11:20517886-20517908 AGGGACAGGAAAGAGATCCCAGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080251156 11:30235376-30235398 AGGACTAGGACAGTGATCTTGGG - Intergenic
1080687079 11:34524727-34524749 AGGGAGAGGAAAGGGCACCTGGG - Intergenic
1080868840 11:36218735-36218757 GGGGAGGGGCCAGTGATCTTTGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081591504 11:44426372-44426394 AGGGAGAGGGCAGCCACCCTCGG + Intergenic
1083459030 11:62798842-62798864 AGGGAGGGGAAAGAGGTCCTGGG - Intronic
1083628571 11:64084478-64084500 GGTGGGAGGACAGTGAGCCTTGG + Intronic
1084386648 11:68847051-68847073 AAAGAGAGGACATTGACCCTGGG + Intergenic
1084501926 11:69540162-69540184 AGGGAAAGGACAAAGACCCTGGG + Intergenic
1084617793 11:70247895-70247917 AGCCAGAGGACAGGGCTCCTTGG + Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085862893 11:80255437-80255459 AGGAAGAGGACAGGCATTCTGGG - Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087102734 11:94380843-94380865 AAGGAGAGGCCAGTGCTTCTTGG - Intronic
1087126938 11:94637673-94637695 AGACAGAGGGCAGCGATCCTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089316194 11:117592957-117592979 TGGGAGAGGATACTGAGCCTGGG - Intronic
1089618659 11:119709673-119709695 TGGGAGAGGAGAGTGATGCTCGG + Intronic
1089777996 11:120852488-120852510 AGAGAAAGGACAGAGTTCCTGGG + Intronic
1091132635 11:133159284-133159306 AGGGAGAGGTCAGAGGTCCCTGG + Intronic
1095856844 12:46869632-46869654 AGGGAGAGAAAAATGATGCTTGG - Intergenic
1096544681 12:52329462-52329484 GGGGAGAGGACAGAGAGCCCAGG - Intergenic
1096861974 12:54535832-54535854 AGGCAGTGGACAGGCATCCTAGG + Intronic
1097384492 12:58933525-58933547 AAGGAGAGGACTGTGCTCCATGG - Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1097487041 12:60215698-60215720 ATGGAGAGGACACAGTTCCTGGG - Intergenic
1097983060 12:65754034-65754056 AGGGTGAGGACAGAATTCCTGGG - Intergenic
1099026400 12:77469545-77469567 AGGAAGAGGACAGAGATCTAGGG - Intergenic
1100048385 12:90411988-90412010 AAGGAGAGGACTGTGAGCCTTGG + Intergenic
1101024910 12:100592164-100592186 AGAGAGAGGAAAATGACCCTGGG - Intronic
1101673019 12:106894277-106894299 AGGCGGAAGACAGTGATACTGGG + Intergenic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1102420993 12:112802819-112802841 GGGGAGAGGACAGAGGCCCTGGG - Intronic
1102421000 12:112802839-112802861 GGGGAGAGGACAGAGGCCCTGGG - Intronic
1102480765 12:113221660-113221682 AGGGAGAGGGCAGGGATCAGGGG + Intronic
1102790332 12:115639290-115639312 GTGGAGAGAACAGGGATCCTCGG - Intergenic
1103361775 12:120358881-120358903 TGGGAGAGGACGCAGATCCTGGG + Intronic
1104298758 12:127543211-127543233 AGGGAGAGGGAAGGGAGCCTGGG + Intergenic
1107438237 13:40401114-40401136 ATGGAGAGGCCAGGGATACTGGG + Intergenic
1107683840 13:42877353-42877375 AGAGAGAGGTAAGTTATCCTGGG - Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107758964 13:43655742-43655764 AGAGAGGGTACAGTGAGCCTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109758728 13:66798081-66798103 AGAGAGAAGAAAGTCATCCTTGG + Intronic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111351567 13:87037395-87037417 AGGGAGAGGAGAGTGAAACAGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1113645806 13:111994732-111994754 AGGGAGAGGCCGGTGGGCCTGGG - Intergenic
1113967867 13:114164708-114164730 TGGGAAAGGACGGTGCTCCTGGG - Intergenic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1116015439 14:39401755-39401777 AGAGAGATGACAGTGATGTTGGG + Exonic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117670852 14:58103863-58103885 GGTCAGAGAACAGTGATCCTAGG - Intronic
1117746946 14:58879142-58879164 AGGGAGAGTTCAGTGGTCCCTGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119094120 14:71812975-71812997 AGGCAGAGGACATGGCTCCTAGG + Intergenic
1119753000 14:77093779-77093801 AGGCAGAGGCCAGTGATAGTGGG - Intergenic
1120143120 14:80950693-80950715 AGGGAGAGGAAAGTGATAAGGGG + Intronic
1120874984 14:89367537-89367559 AGGGAGAGGACAGGGGTGCCAGG + Intronic
1121165054 14:91787100-91787122 AGGGAGAGAAAAGTGTTTCTAGG + Intronic
1122779852 14:104139004-104139026 CGGAAGCGGACAGTGAGCCTGGG - Intronic
1124439802 15:29677733-29677755 AGGGAGAGGAGACTGCTTCTGGG + Intergenic
1124502018 15:30236735-30236757 AGGGAGAGGACAAGCAGCCTCGG + Intergenic
1124741546 15:32301917-32301939 AGGGAGAGGACAAGCAGCCTCGG - Intergenic
1125584509 15:40810537-40810559 AGGGAAAGGAGAGGGATCCAGGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1128160591 15:65421180-65421202 AGGGAGAGGCCAGGGAAGCTGGG + Intronic
1128565952 15:68700485-68700507 AGGGAGGGGAAACGGATCCTGGG - Intronic
1128615973 15:69110018-69110040 GGGCAGGGGCCAGTGATCCTGGG - Intergenic
1131471683 15:92703253-92703275 TGGGAGGGGACTGGGATCCTGGG - Intronic
1132752431 16:1464971-1464993 AGGGCAAGGACAGGGATCTTGGG - Intronic
1134915208 16:18063579-18063601 ATGGAGAAGACATTGATCTTTGG - Intergenic
1136355277 16:29741112-29741134 AGAGAGAGAACAGTGGGCCTAGG - Intergenic
1136394593 16:29986195-29986217 AGTGAGAGGCCAGGGCTCCTTGG - Intronic
1136456347 16:30381894-30381916 GGGGAGAGGTCAGGGATCCGGGG + Intronic
1137287776 16:47030652-47030674 AGTGAGAAGCCAGTGAGCCTTGG - Intergenic
1139606712 16:68023848-68023870 AGGGAGTAGAGAGTGAACCTTGG - Intronic
1142189748 16:88712446-88712468 AGGGAGAGGCCAGTGAGGCTGGG - Intronic
1142867316 17:2798712-2798734 ATGGAGAGGACTGTGAGGCTGGG - Intronic
1143309434 17:5976294-5976316 AGGGGGAGGACTGAGAACCTGGG + Intronic
1143319119 17:6056552-6056574 GAGGAGAGGACAGTGAGCCTGGG + Intronic
1143350518 17:6284777-6284799 TGAGAGAGGACAGAGGTCCTTGG - Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144485550 17:15661375-15661397 AGAGAGAGGAGGGTGATCCTTGG - Intronic
1144517612 17:15929506-15929528 GAGGAGAGCACAGTGCTCCTTGG - Intergenic
1144846387 17:18221842-18221864 TGGGAGAGGACAGTGCACATGGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146157492 17:30536140-30536162 AGAGAGAGGAAAATGAACCTGGG - Intergenic
1146936184 17:36814004-36814026 AGGGAGAGGTGAGAGAGCCTGGG - Intergenic
1147646810 17:42039297-42039319 AGGGAACGGACACTGGTCCTTGG - Intronic
1148442290 17:47717584-47717606 AGGGAGAGGACAGTGCCCCCTGG + Intergenic
1148792643 17:50182210-50182232 GGGGAGGGGACAGTGAGCCTGGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149427681 17:56570514-56570536 AGGGAGAGGCCAGTGTTCGGAGG + Intergenic
1150506084 17:65700475-65700497 GAGGAGAGGAGAGTGGTCCTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151914843 17:77110301-77110323 AGGCTGAGGACAGTGACCCTAGG - Intronic
1152904237 17:82961611-82961633 GGGCAGAGGACAGTGGTGCTGGG + Intronic
1153234349 18:2971416-2971438 AGGGAGAGGGCAGGGGGCCTTGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1154123526 18:11670556-11670578 AGGGAGAGGGCAGCCATCCAGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155713326 18:28908847-28908869 AGTGAGAGGAAGGTAATCCTGGG + Intergenic
1157492064 18:48130387-48130409 AGGGAGAAGAAAGTGATGCTAGG + Intronic
1158592169 18:58787034-58787056 TGGGAGAGGACAATTATCATAGG - Intergenic
1158592892 18:58792256-58792278 AGGGAGAGGACAATGATTCCGGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160970822 19:1767018-1767040 GGGGAGAGGCCATTGCTCCTGGG + Intronic
1161261891 19:3342370-3342392 AGGCAGAGGACAGAGAGCCCAGG + Intergenic
1162334145 19:10049919-10049941 GGGGAGGGGACTGTGACCCTAGG + Intergenic
1163017196 19:14463768-14463790 GGGGAGAGGCCAGGGGTCCTGGG + Intronic
1163185550 19:15636616-15636638 GGAGAGAGCACAGTGATCATGGG - Intronic
1163800657 19:19363091-19363113 AGGCAGAAGACAGTGACCCCAGG + Intergenic
1164130655 19:22358387-22358409 AGGGAGGAAACAGTGTTCCTTGG - Intergenic
1164539962 19:29115045-29115067 AGGGAGAGGACTGTGAGCTCAGG - Intergenic
1167299653 19:48671435-48671457 AGAGAGAGGACAGTCAGCCTAGG + Intronic
925092891 2:1169308-1169330 AGGCAGAGGACACTCACCCTGGG + Intronic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926630260 2:15129350-15129372 AGGAGGAGCACAGTGAGCCTTGG - Intergenic
926682435 2:15674150-15674172 CGGGAGAGCACAGTGAACCCTGG + Intergenic
927955811 2:27206635-27206657 AGGAAGAGGGAAGTGAGCCTAGG - Intronic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929778570 2:44943329-44943351 AGAGAGAGGAAAGTGAACCTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
931058527 2:58500685-58500707 AGGCAGAGGCCAGGGATGCTAGG - Intergenic
932449164 2:71798697-71798719 AGGGAGAGGACAGTGGGCCTTGG - Intergenic
935035649 2:99369917-99369939 AGGGAGATTTCAGTGAGCCTAGG + Intronic
936396505 2:112135892-112135914 AGAGAAAGGACAGTGCTGCTGGG + Intergenic
939152223 2:138486602-138486624 AGGAAGAGGGAAGTGATCCAGGG - Intergenic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941254399 2:163210304-163210326 AGGGAGAGGATAACCATCCTAGG - Intergenic
941633343 2:167908394-167908416 AGGAAGGGGACTGTGATCCGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941873634 2:170411150-170411172 AAGAACAGGAAAGTGATCCTGGG - Intronic
942499829 2:176577904-176577926 AGGAAGATGACAGTGATTCCTGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945347211 2:208732279-208732301 AGAGGAAGGACACTGATCCTGGG - Intronic
945492116 2:210468472-210468494 AGGAAGAGGAGAGTGAACTTTGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948053431 2:234994853-234994875 GGGAAGAGGACAGTGAGGCTGGG + Intronic
948711910 2:239830439-239830461 AGGGAGCGGACGGTGCTGCTGGG - Intergenic
948828427 2:240585744-240585766 GAGGTGAGGATAGTGATCCTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169277317 20:4242755-4242777 AGGTGGAGGTCAGTGATGCTCGG + Intronic
1169340940 20:4795771-4795793 AGGGAGATGACTGGGATGCTTGG - Intronic
1169906224 20:10607509-10607531 AGGGACAGGGCAGTCAGCCTTGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170653085 20:18260718-18260740 AGGGTGAGGAAACTGAGCCTCGG - Intergenic
1172205603 20:33160847-33160869 AGGGAGAGGCCAGCGGTCCATGG + Intergenic
1173512643 20:43642354-43642376 AGGAAGAGGTGAGTGATCTTAGG + Intronic
1174136335 20:48382636-48382658 AGGGAGGTGACAGGGAACCTGGG + Intergenic
1174425308 20:50427982-50428004 GGGGAGATGCCAGTGCTCCTTGG + Intergenic
1174845689 20:53941004-53941026 AGGGAAAGGACACAGATTCTTGG + Intronic
1175993497 20:62801633-62801655 AGGTTTAGGACAGTGAGCCTGGG - Exonic
1176086167 20:63296535-63296557 AGGGAGGGGAGCGTGGTCCTGGG + Intronic
1176102773 20:63372180-63372202 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102785 20:63372217-63372239 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102797 20:63372254-63372276 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102809 20:63372291-63372313 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102821 20:63372328-63372350 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102833 20:63372365-63372387 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102845 20:63372402-63372424 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102857 20:63372439-63372461 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102869 20:63372476-63372498 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102881 20:63372513-63372535 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102893 20:63372550-63372572 GGGGACAGGACAGTGGCCCTGGG - Intronic
1176102918 20:63372624-63372646 GGGGACAGGACAGTGGCCCTGGG - Intronic
1178319591 21:31595206-31595228 CGGGAGGGGACAGGGATGCTGGG + Intergenic
1180902794 22:19386748-19386770 AGGGAGTGCATAGTGATCCCAGG + Intronic
1180945116 22:19688480-19688502 AGGGAGAGGGCAGTGGGCCTGGG - Intergenic
1181313977 22:21960267-21960289 AGGGAGAAGCCAGGGAGCCTCGG + Intronic
1181751685 22:24993259-24993281 AGGGTGAGGAAGGTGATTCTGGG + Intronic
1184048650 22:41988369-41988391 AGGCAGAGGATGGAGATCCTAGG + Intronic
1184849300 22:47110853-47110875 TGGGAGCTGACAGTGGTCCTGGG + Intronic
1184990825 22:48168749-48168771 ATGGAGAGGACAGTGTTCCTTGG + Intergenic
1185219925 22:49624108-49624130 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219934 22:49624146-49624168 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219941 22:49624184-49624206 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219960 22:49624261-49624283 AGGGAGGGCACAGTGATGCTCGG + Intronic
1185219969 22:49624299-49624321 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219978 22:49624337-49624359 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219988 22:49624376-49624398 GGGGAGGGCACAGTGATGCTCGG + Exonic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
950707639 3:14792889-14792911 AGGGAGAGCACAGGCATCCAGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952249967 3:31643644-31643666 AGGGAGAGGACAGAGAAATTAGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952967914 3:38632442-38632464 ATGGAGAGGGCAGTGATCACTGG - Intronic
954137231 3:48587608-48587630 AGGGAGAGATCTGAGATCCTGGG + Intronic
955112088 3:55959419-55959441 ATGGAGAGCAGAGAGATCCTGGG + Intronic
956636459 3:71370065-71370087 AGGGTGAGGGAAATGATCCTAGG + Intronic
957163880 3:76645609-76645631 AGGGAGAGGACTGTTATCTGAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958537247 3:95419010-95419032 AGAGAGAGGACAGGGACCCTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960812254 3:121636326-121636348 AGGGAGGGGACGGTGGTGCTGGG - Intronic
961349431 3:126290289-126290311 AGGGAAAGCACAGGGATGCTTGG + Intergenic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962736190 3:138327646-138327668 AGAGAGAGGACAAGGTTCCTGGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963251176 3:143104837-143104859 AAGGAGGGTACAGTGATCCAAGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963977922 3:151503810-151503832 AGGGAGAGGGGAGTGCTGCTTGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964400107 3:156289910-156289932 AGGAAGAAGGCAGTGATCCCAGG - Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965412417 3:168348559-168348581 AGGGAGACCACAGTGTTCATAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
969508811 4:7605453-7605475 AGGGAGAGGACACTGGCCCAGGG + Intronic
969556716 4:7916586-7916608 AGGGGGAGGGGAGTCATCCTGGG - Intronic
970336049 4:15044005-15044027 AGGGAGTGTACAGTTACCCTGGG - Intronic
970363688 4:15336788-15336810 GAGGAGAGGACATTGATTCTTGG - Intergenic
970369771 4:15395100-15395122 AGGGAGAGAAGAGAGAGCCTGGG + Intronic
970570104 4:17371763-17371785 AGTGACAAGACAGTGATTCTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972621467 4:40751263-40751285 AGGGAGAGGGAAATGATCATTGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974007912 4:56577774-56577796 AGTGAAAGGACAGTTATCCTGGG + Intronic
974069597 4:57111306-57111328 TTGGAGAGGCCAGTGTTCCTGGG - Intergenic
974621362 4:64360649-64360671 AGAGGGAGGACACAGATCCTGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975909108 4:79247665-79247687 AGAGGGAGGACAGAGATACTGGG + Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985520482 5:371922-371944 ATGGAGAAGAAAGGGATCCTGGG + Intronic
986066714 5:4241113-4241135 AGTAAGAGGACAGTGATTCCAGG + Intergenic
986069144 5:4265288-4265310 AGGGAGCGGCCAGTGATGCTGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
986587605 5:9335115-9335137 ATGGAGACGACAGGGATGCTGGG + Intronic
986640128 5:9863860-9863882 ACTCAGAGGACAGTGCTCCTTGG + Intergenic
990561832 5:56991213-56991235 AGTGAGAGGACAGTGAGCAGTGG - Intergenic
991962681 5:72061646-72061668 CGGGTGAGGACAGTTGTCCTGGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996672317 5:126133132-126133154 AAGGAGAGGACTGTGAGCCTTGG + Intergenic
998138979 5:139689541-139689563 GGGGAGGGGGCGGTGATCCTAGG - Intergenic
998351439 5:141504608-141504630 AGGGATAGGAAAGTGCACCTTGG + Intronic
998412887 5:141924518-141924540 AGGCAGATGACAGTGATTCCTGG + Intronic
999720872 5:154398453-154398475 GGTGAGAGGACAGTGCTCTTGGG + Intronic
999953292 5:156672979-156673001 AGGGGAAGTACAGTGAGCCTAGG - Intronic
1000022992 5:157335104-157335126 AGGGAGAGGACTGGGACCCTAGG - Intronic
1000419409 5:161021238-161021260 AGGGAGAGGATAGTGATGAGTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001325621 5:170721725-170721747 AAAGAGAGGAGAGTGATGCTAGG - Intronic
1001397333 5:171426694-171426716 AGAGAGAGGTCAGTGAGCCCAGG - Intronic
1003119012 6:3304884-3304906 AGGGAGAGGAGAGGGATGCAGGG + Intronic
1003566194 6:7224578-7224600 ACAGAGAGGACAGTGACCCTTGG - Intronic
1004228776 6:13813113-13813135 AGGTAGAGGCTAGTGCTCCTAGG - Intronic
1005571897 6:27153347-27153369 AAGAAGAGGACAGTGAATCTAGG + Intergenic
1005690081 6:28296608-28296630 AGGGTGAGGCCAGAGATGCTAGG - Intronic
1005871195 6:29975345-29975367 AGGGAGAGGACAGGGCTTCAGGG + Intergenic
1007364507 6:41381879-41381901 AGGGAGAGGGCAGAGACCCCAGG + Intergenic
1007554630 6:42755610-42755632 AGGAAGAGGACAGAGAACCCTGG - Intronic
1007783965 6:44270108-44270130 GGGGAGAGGAAATTGATTCTTGG - Intergenic
1009404662 6:63297328-63297350 AGTGAGAGAAGAGTGAGCCTCGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012506370 6:99951127-99951149 AGGGAGAGGAAAGTGGTGTTGGG + Intronic
1013293886 6:108741748-108741770 GAGGAGAGAACGGTGATCCTGGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1020555229 7:9662835-9662857 AGTGAGAGACCAGTGACCCTAGG - Intergenic
1021179599 7:17490201-17490223 AGGGAAAGGACAGTCAGTCTAGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021859660 7:24893835-24893857 TGGGAGAAGCCAGTGATTCTAGG - Intronic
1021940485 7:25674092-25674114 AGGGAGAGGACTGTCAATCTCGG - Intergenic
1022482453 7:30752860-30752882 ATGGGGAGGGCAGTGATCATCGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023817363 7:43961382-43961404 AGGGGGAGGACAGAGGACCTTGG + Intergenic
1024026326 7:45413008-45413030 AGGAAGTGAACAGTGAACCTGGG - Intergenic
1025728179 7:64087240-64087262 AGGGACAGGACAGAGCACCTAGG - Intronic
1025757297 7:64357131-64357153 AGGGACAGGACAGAGCACCTTGG - Intergenic
1026340285 7:69428831-69428853 AGGGTGAGGGCAGAGCTCCTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028284715 7:88981787-88981809 GAGGAGAGCACAGTGATCTTGGG - Intronic
1028457248 7:91051800-91051822 TGGTAGAAGAAAGTGATCCTGGG - Intronic
1029126913 7:98300944-98300966 GGGGAGAGGCCAGGGTTCCTGGG - Intronic
1029484900 7:100834276-100834298 AGGGCAAGGACAGTGACCATGGG + Intronic
1029741988 7:102496256-102496278 AGGGGGAGGACAGAGGACCTTGG + Intronic
1029759977 7:102595421-102595443 AGGGGGAGGACAGAGGACCTTGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031657735 7:124379452-124379474 AGTGAGACCACAGTGATCATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1032188638 7:129749652-129749674 AGGGAGAGGACTGTCCTCTTTGG - Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034533264 7:151710563-151710585 AGGGAGAGGGCAGGGCTCCCGGG - Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034960786 7:155363044-155363066 ATGGAGATGACAGTGAGCCCAGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035784564 8:2250566-2250588 GGGGAGACGGCAGTGATACTGGG - Intergenic
1035808243 8:2471147-2471169 GGGGAGACGGCAGTGATACTGGG + Intergenic
1035961401 8:4142381-4142403 AGGGAGAGGACAGTTTTCTTTGG + Intronic
1036274700 8:7340159-7340181 AATGAGAGGACTGTGATCTTTGG - Intergenic
1036346653 8:7970187-7970209 AATGAGAGGACTGTGATCTTTGG + Intergenic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1036644159 8:10601634-10601656 AGGGAGCTGAGAGAGATCCTGGG + Intergenic
1037507017 8:19540770-19540792 AGGGAGAGGAAAGGCTTCCTGGG - Intronic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038492902 8:27982791-27982813 AGGGAGGGGACAGAGAACCAAGG + Intronic
1038533624 8:28338333-28338355 AGGCAGAGCAGAGTGTTCCTAGG + Intronic
1038754546 8:30328392-30328414 AGGGAAAGTGCAGAGATCCTAGG - Intergenic
1039588661 8:38728620-38728642 AGGGAGAGGGGAGCGACCCTGGG + Intronic
1040300830 8:46187186-46187208 TGGGATGGGACAGTCATCCTTGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042760456 8:72266748-72266770 ATGGAAAGAACAGTGATCCAAGG + Intergenic
1042871846 8:73406787-73406809 AGGGGGAGGAGAGTCATGCTAGG + Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044479851 8:92672440-92672462 AGGGAGAGGACTGTGAGTTTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048266569 8:132992499-132992521 AGGAAGAAGACAGTGCTCCTGGG + Intronic
1048330810 8:133469669-133469691 AGGGAGAGGAGAGTTTGCCTGGG - Intronic
1050857218 9:10374610-10374632 AGGGAGAGGACACTAAACGTAGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051871925 9:21747861-21747883 AGAGACATGACAGTGATCTTTGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052860397 9:33434714-33434736 GGGGAGGGGAGAGTGATCCCTGG - Intergenic
1053569477 9:39288759-39288781 AGGGAGAGGCCGGTGAGCCTGGG + Intergenic
1053835438 9:42129780-42129802 AGGGAGAGGCCGGTGAGCCTGGG + Intergenic
1054091108 9:60847743-60847765 AGGGAGAGGCCGGTGAGCCTGGG + Intergenic
1054112519 9:61123299-61123321 AGGGAGAGGCCGGTGAGCCTGGG + Intergenic
1054127669 9:61330251-61330273 AGGGAGAGGCCGGTGAGCCTGGG - Intergenic
1054595187 9:67058830-67058852 AGGGAGAGGCCGGTGAGCCTGGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056227101 9:84506354-84506376 GAGGAGAGGCCAGTGCTCCTAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056258567 9:84825096-84825118 AGGGAGAGGAAAGCTGTCCTGGG - Intronic
1056483306 9:87028837-87028859 AGGGAGACAAGAGTAATCCTAGG - Intergenic
1057403283 9:94743666-94743688 AGGGAGATGGCAGTGTTCCATGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059598149 9:115745417-115745439 AGGAAGTTGAGAGTGATCCTTGG + Intergenic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060192561 9:121602335-121602357 AAGCAGAGGCCAGTGATCTTGGG - Intronic
1060688009 9:125630022-125630044 AGGCAGGGGACACTGAGCCTAGG + Intronic
1061631650 9:131875838-131875860 AGGCAGAGGATCATGATCCTAGG - Intronic
1062259772 9:135655735-135655757 AGGCAGAGGCCAGTGAGCCAGGG - Intergenic
1062538776 9:137032345-137032367 AGGCAGAGGACAGAGAGGCTCGG + Exonic
1062613920 9:137387584-137387606 AGTGAGAGGACAGGGTGCCTGGG + Intronic
1062625144 9:137439066-137439088 AGGGTGAGGCCAGCCATCCTAGG + Intronic
1062637392 9:137498714-137498736 GGGGAGAGAACAGTGTTCCCCGG - Intronic
1185480998 X:446195-446217 GGGGAGAGGGCAGAGCTCCTGGG + Intergenic
1186106004 X:6206636-6206658 AGGGAGTTGCCAGTAATCCTTGG + Intronic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1187115773 X:16348927-16348949 AGGGAAAGCACAGAGAACCTGGG - Intergenic
1187824162 X:23318178-23318200 AGGGAGAGGATATGGATCCACGG + Intergenic
1188124070 X:26345926-26345948 AGGTCCAGGACATTGATCCTTGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188928152 X:36070894-36070916 AGGGAAAGGGTAGTAATCCTTGG - Intronic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190337653 X:49271989-49272011 AGGGAGAATCTAGTGATCCTGGG - Intronic
1190483437 X:50900285-50900307 AGGGGAAGGACAGTCTTCCTAGG + Intergenic
1190649529 X:52555574-52555596 AGGGGAAGGACACTGATCCAAGG + Intergenic
1192223216 X:69211425-69211447 AGAGAGAGGAAAGGGACCCTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195669053 X:107453731-107453753 AAGGCAAGGACAGTGATCTTGGG + Intergenic
1196186632 X:112751164-112751186 GGGGAGAGGACAGTGGTGATGGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200281599 X:154781528-154781550 ATGGCGAAGACAGTGCTCCTTGG - Intronic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic