ID: 926321787

View in Genome Browser
Species Human (GRCh38)
Location 2:11753464-11753486
Sequence GTCCTGGCCAGAGTGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 214}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926321787_926321789 -8 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321789 2:11753479-11753501 GCCAGGACAGTTTAACCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
926321787_926321796 30 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321796 2:11753517-11753539 GTCAATCCAGACCTGGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 119
926321787_926321791 -1 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 97
926321787_926321795 29 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321795 2:11753516-11753538 AGTCAATCCAGACCTGGCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
926321787_926321788 -9 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321788 2:11753478-11753500 GGCCAGGACAGTTTAACCACAGG 0: 1
1: 0
2: 0
3: 5
4: 91
926321787_926321794 23 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321794 2:11753510-11753532 GGACTCAGTCAATCCAGACCTGG 0: 1
1: 0
2: 1
3: 6
4: 158
926321787_926321792 2 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321792 2:11753489-11753511 TTTAACCACAGGGACGCTGGTGG 0: 1
1: 0
2: 2
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926321787 Original CRISPR GTCCTGGCCAGAGTGCCTTG AGG (reversed) Intronic
900174312 1:1285094-1285116 CTCCTGGCCAGGCTGCCTGGAGG + Intronic
900355475 1:2260158-2260180 GTCCTGGCCAGCGTGTGTGGTGG + Intronic
901509608 1:9710243-9710265 GTCCTGCCCAGGGTGGCTTGTGG - Intronic
903447415 1:23431239-23431261 GACCTGGCCTGGGGGCCTTGTGG - Intronic
903449351 1:23442390-23442412 GTCCTGGCCACATGGCCCTGTGG - Intronic
904750867 1:32741090-32741112 GTCCAGGCAGGAGTGCCCTGGGG + Intergenic
905312470 1:37059411-37059433 GCCCTGGCCAGAGACCATTGTGG + Intergenic
911087244 1:93989369-93989391 GCCCTGAGTAGAGTGCCTTGGGG + Intergenic
912373641 1:109192830-109192852 GTCCAGGCCTGTGTGCCCTGTGG + Exonic
912473863 1:109923736-109923758 GTCCTGGCCAGTGGGCCTCACGG - Exonic
916492862 1:165316843-165316865 GCCCGGGCCCGAGTGCCCTGTGG - Intronic
917850881 1:179062916-179062938 ATCTTGGCCAGAGTGCCCAGGGG - Intronic
919891501 1:201978678-201978700 ACCCTGGCCACAGTGCCCTGGGG - Intergenic
920657863 1:207889572-207889594 GGCCTGGCCCGAGTGCTGTGTGG - Exonic
921698935 1:218245306-218245328 GTCCAGTCCAGATTGTCTTGTGG + Intergenic
923649692 1:235862752-235862774 GCCCAGGCCAGAGTGCAGTGGGG - Intronic
923654235 1:235901490-235901512 GTCTGGGCCAGACTGCCTTTTGG - Intergenic
924145645 1:241072240-241072262 GCCCTGGCCAAAGTGGCCTGTGG + Intronic
924813959 1:247426665-247426687 GTCCTGGTCACAGGGACTTGAGG + Intronic
1065838915 10:29683896-29683918 TTCCTGACCAGTGTGCCATGAGG - Intronic
1067346840 10:45443615-45443637 GTCCTGCCCAGGGTGCCCTCCGG + Intronic
1067681626 10:48445444-48445466 GGCCTGGCCTGGGTGCCCTGTGG + Intergenic
1068769234 10:60802295-60802317 TTACTGGCCAAAGTGCCATGTGG - Intergenic
1069204538 10:65665028-65665050 GTCCAGGCCAGAATGCAGTGCGG - Intergenic
1069478023 10:68752827-68752849 GCCCAGGCCAGAGTGCAGTGTGG - Intronic
1071333436 10:84583288-84583310 GTGCTTGCCAGTGTGCTTTGAGG - Intergenic
1071425675 10:85546805-85546827 GTACTGGTCAGAGGGACTTGAGG + Intergenic
1071968467 10:90877411-90877433 TCCCTGGCCAAAGTGCATTGTGG + Intronic
1072387657 10:94948048-94948070 GTCTTGCCCAGACAGCCTTGGGG + Intronic
1073026873 10:100494181-100494203 GTTCTGGCCAAAGTGCCCGGGGG - Intronic
1075312536 10:121426715-121426737 CTCCTGCCCAGGGTGCCTTCTGG + Intergenic
1075811355 10:125227168-125227190 GTCCTGGGCACAGTCCTTTGTGG + Intergenic
1076319066 10:129564830-129564852 GAACTGGCCTGAGGGCCTTGAGG - Intronic
1077454057 11:2667379-2667401 AGCCTGGCCAGAGTGCACTGGGG - Intronic
1077491259 11:2862122-2862144 GTCCTGGCTAGAATCCCTCGGGG - Intergenic
1078103420 11:8343583-8343605 GCCATGGTGAGAGTGCCTTGCGG - Intergenic
1078509858 11:11977128-11977150 TTCCTGGGCAGTGTGACTTGGGG - Intronic
1078536947 11:12182862-12182884 GTGCTTGCAAGAGGGCCTTGGGG + Intronic
1079262853 11:18900414-18900436 TTCCTGGGCAGAGGTCCTTGCGG - Intergenic
1081913842 11:46718581-46718603 TTCCTGTCCAGGGTGCCTGGAGG - Intergenic
1082937984 11:58674445-58674467 GTTCTGGCCACAGTGTCCTGAGG + Intronic
1083735300 11:64676694-64676716 TTCCTGGCCAGAGAGACCTGGGG - Intronic
1084399489 11:68935430-68935452 GCCCTCGCCAGAGTCCTTTGGGG + Intronic
1089182683 11:116593923-116593945 GTTCTCCCCAGAATGCCTTGAGG + Intergenic
1089240823 11:117077114-117077136 GACCAGGCCAGAGTGCAGTGTGG - Intronic
1089248235 11:117137896-117137918 GTCTTGGCCCTAGTACCTTGAGG - Intergenic
1089258476 11:117206665-117206687 GTCTTGGCCCTAGTACCTTGAGG + Exonic
1089759373 11:120711792-120711814 GTCCTGGCCTGAGGGCACTGGGG - Intronic
1093982638 12:25491592-25491614 GTCCAGCCCACATTGCCTTGGGG - Intronic
1096300434 12:50422857-50422879 GCCCTGGCTGGAGTGCCATGGGG + Intronic
1096661612 12:53128823-53128845 GTCCTGCCTGGAGTGCCTTCGGG - Intergenic
1098257031 12:68627129-68627151 ACCCTGGCCACAGTGCCCTGGGG + Intronic
1100591871 12:96036979-96037001 GTCCTCGCCACAGTGTCTTGTGG - Intronic
1101551591 12:105767531-105767553 GGCCTGGCCAGAGGGGCTCGGGG + Intergenic
1102467877 12:113141066-113141088 GCCCAGGCCAGAGTGCAGTGGGG + Intergenic
1102993367 12:117330512-117330534 GTCCTGGCCTGGGGGCCTGGGGG + Exonic
1103149950 12:118628481-118628503 GCCCAGGCCAGAGTGCAGTGGGG - Intergenic
1104981961 12:132577204-132577226 GTCCTGCCCAGTGTGTCCTGGGG + Intronic
1109227669 13:59716215-59716237 GCCCAGGCCAGAGTGCACTGGGG + Intronic
1113593727 13:111517781-111517803 GTCCTGGACAGAGAACCATGAGG - Intergenic
1114773383 14:25454318-25454340 GTGCTGGCCTGAATGCCTGGAGG - Intergenic
1115815686 14:37161919-37161941 GCCCAGGCCGGAGTGCATTGAGG - Intronic
1118904965 14:70017259-70017281 GTCCTGGCCAGGGTACCCTCGGG - Intronic
1119449414 14:74695737-74695759 GACCTGGTCAGTGTTCCTTGGGG - Intronic
1121930695 14:97969373-97969395 GTCCTGGTCATTGTGCCTTCCGG + Exonic
1122392185 14:101397399-101397421 TGCGTGGCCAGAGTGTCTTGCGG - Intergenic
1127969251 15:63945923-63945945 GTCCAAGCCAGAGTGCCCTCTGG + Intronic
1128139041 15:65286197-65286219 GTCCTGGACCAAGTGCCCTGTGG - Intronic
1128344185 15:66842986-66843008 CTCCGGGCCAGAGCGCCGTGGGG + Intergenic
1128442792 15:67728676-67728698 GTACAGGCCAAAGTGCCTAGAGG + Intronic
1128944603 15:71812025-71812047 GTCCCGGCCGGAGTCCCTGGTGG + Exonic
1128979490 15:72176021-72176043 ACCCTGGGCTGAGTGCCTTGAGG - Intronic
1129883826 15:79025235-79025257 GTCCTGGCCAGAGGGTCTATGGG - Intronic
1132468591 16:89346-89368 GTCATGGCCAGTGTGGCTTGAGG - Intronic
1135596279 16:23745802-23745824 GTACTGTCCAGAGTGCCTCAAGG - Intergenic
1137821555 16:51450333-51450355 GTCCTGCTCAGAATGCTTTGGGG - Intergenic
1141170835 16:81690543-81690565 GTCCAGGCTAGAGTGCAGTGGGG + Intronic
1142610733 17:1108268-1108290 GTGGTGGCCAGAATCCCTTGAGG - Intronic
1143188438 17:5024159-5024181 ATCCTGGGCAGAGGGCCTGGTGG + Exonic
1144493724 17:15734526-15734548 CTCCTGGTCAAAGAGCCTTGGGG + Intronic
1145095570 17:20022643-20022665 GTCCTGGCTAGAGTGACTGAGGG + Intronic
1145294378 17:21576195-21576217 GGCCTGGCCACAGTGCCCAGTGG + Intergenic
1145369454 17:22296985-22297007 GGCCTGGCCACAGTGCCCAGTGG - Intergenic
1145844050 17:28022233-28022255 ACCCTGGCCACAGTGCCCTGGGG + Intergenic
1147384657 17:40074186-40074208 GTCCTGTCCAGAGATCCCTGTGG - Exonic
1147548650 17:41422558-41422580 GTCTTGTCCAGAGTGCATTTGGG + Intronic
1149385668 17:56141245-56141267 GTACTGGCAAGATTGGCTTGTGG - Intronic
1151206693 17:72513152-72513174 GCCCTGCCCAGAGTCTCTTGGGG - Intergenic
1151617206 17:75221238-75221260 GCCCAGGCCAGAGTGCAGTGGGG + Intronic
1152035427 17:77869359-77869381 GGCTTGGCCAGAGTGCCTGGAGG - Intergenic
1152115743 17:78386001-78386023 GTCCTCAGCAGGGTGCCTTGGGG - Intronic
1152740785 17:82017475-82017497 GTCCAGGCCTGAGAGCCTGGTGG + Intergenic
1153240300 18:3025325-3025347 ACCCTGGCCACAGTGCCCTGGGG + Intergenic
1153305595 18:3627917-3627939 GTCCAGGCCGGAGTGCAATGGGG + Intronic
1154171568 18:12056640-12056662 ATCCTGGGCAGAGGGCCTGGTGG - Intergenic
1155541699 18:26875123-26875145 GTGCTGCCCCAAGTGCCTTGTGG + Intergenic
1156249584 18:35339821-35339843 GTCCTCACCACAGTGCCTTAGGG + Exonic
1156450625 18:37264413-37264435 GGCCTGGACAGAATGCCCTGAGG - Intronic
1157248375 18:46072557-46072579 GTGCTGTCCAGGGGGCCTTGTGG - Intergenic
1158245844 18:55431319-55431341 GTCCAGGCTAGAGTGCAATGGGG + Intronic
1159018032 18:63118259-63118281 GTCCTGTCCCAAGTGCTTTGGGG - Intergenic
1160444337 18:78915393-78915415 CTCTTGGCCCGTGTGCCTTGTGG + Intergenic
1160762537 19:792714-792736 GTCCTGGCCATCAGGCCTTGGGG + Intergenic
1161405757 19:4090401-4090423 GTCCTGGCCGGGGTGCCTCTGGG - Exonic
1162297008 19:9820177-9820199 ACCCTGGCCACAGTGCCCTGGGG - Intronic
1162717565 19:12643534-12643556 ACCCTGGCCACAGTGCCCTGGGG + Intergenic
1163372438 19:16908907-16908929 GTCCTGGCCCGCGTGACCTGGGG - Intronic
1165092000 19:33392521-33392543 TGCCTGGCCAGAGTGTCCTGGGG - Intronic
1165631472 19:37305310-37305332 CTCCTGGGGAAAGTGCCTTGAGG - Intergenic
1166001102 19:39877903-39877925 GTCCTGCCCAACGTGCCCTGAGG - Exonic
1166003887 19:39894162-39894184 GTCCTGCCCAACGTGCCCTGAGG - Exonic
926321787 2:11753464-11753486 GTCCTGGCCAGAGTGCCTTGAGG - Intronic
931280578 2:60787998-60788020 GGCCAGGCCAGAGTGCAGTGGGG - Intronic
931342708 2:61417139-61417161 ACCCTGGCCACAGTGCCCTGGGG + Intronic
931384577 2:61786523-61786545 GTCCAGGCTAGAGTGCAGTGGGG - Intergenic
933644986 2:84804855-84804877 GCCCTGGCTAGAGTGCAGTGGGG + Intronic
933727278 2:85434074-85434096 GTCCTGGGCAGAGGGCCTGAGGG - Intronic
939193840 2:138948115-138948137 GACGTGGCCACAGTGCCTTGTGG - Intergenic
942503992 2:176622275-176622297 GTCCTGTACAGAGGGCTTTGTGG + Intergenic
943486944 2:188496833-188496855 GTCCTGGCGAGAGTGAGTTATGG + Intronic
944559497 2:200921676-200921698 GTCCAGGCTAGAGTGCAGTGGGG + Intronic
944589340 2:201202564-201202586 GGCCTGGCCAGACTGCCTTCTGG - Intronic
944999127 2:205329950-205329972 GTCCAGGCTAGAGTGCAATGGGG - Intronic
945283471 2:208059572-208059594 GTCCTGGGCACAGTGTCTTGTGG + Intergenic
945837167 2:214847164-214847186 ACCCTGGCCACAGTGCCCTGGGG - Intergenic
946605370 2:221398813-221398835 GGTCTCACCAGAGTGCCTTGAGG - Intergenic
1169265519 20:4165094-4165116 GTCCAGGCTAGAGTGCAGTGGGG + Intronic
1171127401 20:22614579-22614601 GTCCTGGCCAAAGTGACTTAAGG - Intergenic
1172056414 20:32157629-32157651 CTCCTGGCCAGAATCTCTTGAGG - Intronic
1172690384 20:36785739-36785761 TTCCTTGCCAAAGTGACTTGGGG - Exonic
1173458925 20:43226065-43226087 GGCCTGGCCAGAGCCCCTGGGGG - Intergenic
1174209030 20:48862165-48862187 GCCCAGGCCAGAGTGCAGTGGGG - Intergenic
1175209458 20:57341714-57341736 GTCATGGTCAGAATCCCTTGGGG + Intronic
1175401867 20:58705276-58705298 GTCGTGGCCAGAGTGGCTCATGG + Intronic
1178250646 21:31000288-31000310 AACCTGGCAAAAGTGCCTTGAGG - Intergenic
1179826020 21:43966945-43966967 GTCCTGTTCAGAGGGCCATGTGG - Intronic
1179908962 21:44438077-44438099 TTCCTGCCCAGAGGCCCTTGTGG - Intronic
1179965694 21:44803550-44803572 GCACTGGACAGACTGCCTTGGGG - Intergenic
1180096659 21:45558461-45558483 GTGCTGGCCGGCGAGCCTTGGGG + Intergenic
1180145483 21:45916333-45916355 GTCCTGTACAAAGTGTCTTGAGG - Intronic
1180974601 22:19841011-19841033 GTCCTGGCCAGAGGAGCCTGGGG + Intronic
1181236327 22:21449786-21449808 GGTCCGGCCAGAGGGCCTTGGGG - Exonic
1181862912 22:25833323-25833345 TTCCAGGCCAGAGTGGCTGGTGG - Intronic
1182352486 22:29706668-29706690 CTCCTGGCCAGAGAGGCGTGGGG - Intergenic
1182657979 22:31904913-31904935 TTCCTGGACTGAGTTCCTTGGGG - Intronic
1182992826 22:34784241-34784263 TTCCTGGCCAGGCTGCCTGGAGG + Intergenic
1183731819 22:39622578-39622600 CCCCTGGCCAGAGTGCGGTGTGG + Intronic
1185119063 22:48954942-48954964 GCCCTGGCCAGAGCAGCTTGAGG + Intergenic
950305078 3:11910926-11910948 TTCCTGGCCAGATTTCATTGGGG - Intergenic
953882871 3:46700684-46700706 GTCAGGGCCAGAGTGCAGTGTGG + Intergenic
958984431 3:100763792-100763814 GTCTTGGCAAGAGTGCCATTTGG - Intronic
960620889 3:119635775-119635797 ACCCTGGCCACAGTGCCCTGGGG + Intergenic
962114835 3:132493203-132493225 GGCCTGTCCAGAGTGCCCTTGGG + Intronic
962713003 3:138103302-138103324 CTCATGGCCAGAGAGCCTGGGGG - Intronic
963045711 3:141101253-141101275 GACCTGGCCAGAGTGATCTGAGG + Intronic
965473203 3:169120987-169121009 CTCCTGGTCACAGTGCCTTTTGG + Intronic
965529184 3:169754175-169754197 GCCCAGGCCAGAGTGCAGTGTGG + Intergenic
966931826 3:184680226-184680248 GTCCTGGCCACAATGGCTTTGGG - Intronic
967175081 3:186855416-186855438 CTCCTGGCCAGGTGGCCTTGAGG - Exonic
968606462 4:1537964-1537986 CTCCAGCCCAGCGTGCCTTGGGG + Intergenic
968704080 4:2069979-2070001 GTCCTGGCTGGAGGGCCTGGCGG - Intergenic
969496724 4:7530447-7530469 GTCGTGGGCAGCATGCCTTGTGG - Intronic
977573476 4:98654125-98654147 ATCCTGCCCAGAGGGCCTTCCGG + Intronic
979200244 4:117969120-117969142 GTCCAGGCTAGAGTGCAGTGGGG + Intergenic
981006581 4:139881265-139881287 GGCCTAGCCAGAGTGGGTTGAGG + Intronic
982551479 4:156805935-156805957 GTACTGGCCAGCATGCCCTGTGG - Intronic
986809944 5:11346405-11346427 GACCTGGCCAAGGTGCCTTCAGG + Exonic
994934859 5:106241714-106241736 GTCCAGGTCACAGTGCCCTGTGG + Intergenic
996520826 5:124423741-124423763 GTCCTGGTCTGACAGCCTTGAGG + Intergenic
996979146 5:129468816-129468838 GGCCAGGCCAGAGTGCAGTGGGG + Intronic
997872804 5:137520140-137520162 GTCCTTGCCAGCCTGCTTTGGGG - Intronic
998128821 5:139640929-139640951 GTGGTGGCCACACTGCCTTGCGG - Intergenic
1001074661 5:168616715-168616737 ACCCTGGCCAAAGTGCCCTGGGG - Intergenic
1001389348 5:171366335-171366357 ACCCTGGCCACAGTGCCCTGGGG - Intergenic
1002698075 5:181103527-181103549 ATCCAGGCCAGAGTGCAGTGGGG + Intergenic
1003534306 6:6962856-6962878 GTACTGGCCAGTGTGGCCTGAGG - Intergenic
1005578470 6:27211604-27211626 ATCCTGGCCACAGTGCCCTGCGG - Intergenic
1005805456 6:29470547-29470569 GGACTGACCAGAGTGTCTTGTGG - Intergenic
1007768659 6:44176650-44176672 GTTCTGGTCAGTGTGGCTTGGGG + Exonic
1008740593 6:54602795-54602817 ACCCTGGCCACAGTGCCCTGAGG + Intergenic
1009061329 6:58400755-58400777 GTCCTGGGCTGTGTGACTTGGGG - Intergenic
1009248999 6:61275307-61275329 GTCCTGGGCTGTGTGACTTGGGG - Intergenic
1009415556 6:63412323-63412345 GCCCAGGCCAGAGTGCAGTGGGG - Intergenic
1012815252 6:104016041-104016063 GAGCTAGGCAGAGTGCCTTGAGG - Intergenic
1012858327 6:104528843-104528865 ATCCTGGCCAGGGGGCTTTGGGG - Intergenic
1013412222 6:109892511-109892533 GTCCTTGCAAGAGTGCCTCTCGG + Intergenic
1014103343 6:117536115-117536137 CTCTTGGCCAGAGTACTTTGGGG + Intronic
1014282357 6:119455834-119455856 ACCCTGGCCACAGTCCCTTGAGG - Intergenic
1016431534 6:143990734-143990756 ATCCTGAAAAGAGTGCCTTGGGG - Intronic
1017770398 6:157639763-157639785 GTTCTGCCAAGAGTGCCTGGGGG + Intronic
1018753787 6:166830925-166830947 GGTCTGGCCAGAGTGCCTAATGG - Intronic
1019412133 7:911342-911364 TTCCTGCCCAGAGTGACGTGTGG + Intronic
1020150673 7:5679520-5679542 GTGCTGACCAGAGTCCCTTGAGG + Intronic
1021265022 7:18509398-18509420 CTCCTGGCCAACGTGCTTTGTGG + Intronic
1022053313 7:26701681-26701703 GCCCAGGCCAGAGTGCAGTGGGG - Intronic
1024228570 7:47346747-47346769 GTCAGGACCAGAGTGCCCTGAGG + Intronic
1024899058 7:54296153-54296175 ATTCTGGCAAGAGTGGCTTGAGG - Intergenic
1025195277 7:56927673-56927695 GTTCTGGCCAGGGTGACTTAGGG - Intergenic
1025676675 7:63649270-63649292 GTTCTGGCCAGGGTGACTTAGGG + Intergenic
1026207243 7:68268610-68268632 GTGCTGACCAGAGTGTCTAGGGG - Intergenic
1028298098 7:89161055-89161077 TTCCTGGAGAGATTGCCTTGTGG + Intronic
1034115116 7:148577472-148577494 GTCCAGGCCTGAGTGCAGTGAGG - Intergenic
1034431700 7:151044312-151044334 GGCCTGGCCCCAGGGCCTTGGGG + Intronic
1034532141 7:151702474-151702496 GACCTGGCAAGACTGCCGTGGGG - Intronic
1034556613 7:151854443-151854465 GTCCTGGCCAGAGGCTCTTGGGG - Intronic
1035134130 7:156684280-156684302 GTGCTGGCCAGATCCCCTTGAGG + Intronic
1037931559 8:22883438-22883460 GATCTGGCCAGAGCCCCTTGGGG - Intronic
1038486631 8:27939983-27940005 CTCCTGGCCACAGTCCCATGAGG + Intronic
1039056349 8:33540221-33540243 ACCCTGGCCACAGTGCCCTGGGG - Intergenic
1039071934 8:33656759-33656781 GTCTTCACCAGAGTGCCTTCTGG + Intergenic
1041355418 8:56994063-56994085 GTGCTGTGCTGAGTGCCTTGTGG + Intergenic
1045504796 8:102770800-102770822 GCCCAGGCCAGAGTGCAGTGGGG + Intergenic
1049362703 8:142219828-142219850 GTCCTGGGCAGCGGGCCTTCGGG - Intronic
1050456314 9:5838013-5838035 GTCCTGGCCCATGTGCCTTTTGG - Intergenic
1057293166 9:93819944-93819966 GTCTTGCCCTGAGTGCCTTAGGG - Intergenic
1058949569 9:109891050-109891072 CCCCTGGCCAGGGTGCCTGGAGG + Intronic
1059750442 9:117242560-117242582 GTGCTGGCCAGGGTGCCATAAGG - Intronic
1060932058 9:127495438-127495460 GTCCCGGCCAGGGAGCCCTGGGG + Intronic
1060964810 9:127706598-127706620 GTCCTGGCATGGGTGCATTGGGG - Intronic
1061780147 9:132991069-132991091 CTCCTGGCCAGCCTGCCCTGCGG + Exonic
1061801277 9:133114596-133114618 AGCCCGGCCAGAGTGCCCTGGGG - Intronic
1062592813 9:137281653-137281675 GTCCTGCCCAGAGGGTCCTGAGG + Exonic
1186423361 X:9444137-9444159 GCCCAGGCTAGAGTGCATTGGGG + Intergenic
1200045041 X:153396767-153396789 GTGGTGGCCAGAGCCCCTTGGGG + Intergenic
1200083604 X:153591911-153591933 TCCCTGGCCCGTGTGCCTTGTGG - Intronic
1200222889 X:154400498-154400520 ACCCTGGCCACAGTGCCCTGGGG - Exonic