ID: 926321791

View in Genome Browser
Species Human (GRCh38)
Location 2:11753486-11753508
Sequence CAGTTTAACCACAGGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926321787_926321791 -1 Left 926321787 2:11753464-11753486 CCTCAAGGCACTCTGGCCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 214
Right 926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926321791 Original CRISPR CAGTTTAACCACAGGGACGC TGG Intronic
910646306 1:89519108-89519130 CAGCTGAACCACTGGGACTCTGG + Intergenic
914882352 1:151557053-151557075 CAGTTAATCCACAGGAAGGCAGG - Intronic
916146316 1:161743361-161743383 CAGTTTGACCTCCGGGAGGCTGG - Intergenic
918226146 1:182484896-182484918 CAGTTTACCCTCAGGGATGAAGG + Intronic
921393041 1:214636435-214636457 CAGTTTAGCAGCAGGGAAGCAGG + Intronic
921457384 1:215388829-215388851 CATCTTAACCACAGTGACTCAGG + Intergenic
1062884313 10:1004815-1004837 CAGTTTAGCCTCAGGGATGAAGG + Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1065429042 10:25634870-25634892 CAGTTTAAGGCCAGGGACTCAGG - Intergenic
1070885222 10:79889407-79889429 CAGTTTAACCTCAGGGAAAACGG - Intergenic
1079064243 11:17276215-17276237 CAGTTAAACCACAGTGACCGAGG + Intronic
1081775661 11:45674523-45674545 CAGTTTCACCCCAGGGAATCTGG - Intergenic
1082044989 11:47718183-47718205 CAGTCTACCAACAGGGACCCTGG + Intronic
1083768177 11:64852287-64852309 CGGTTTAAGTACAGGGAAGCCGG - Exonic
1083979415 11:66153919-66153941 CACTTTAAACACAGAGACACAGG + Intronic
1084647604 11:70467716-70467738 AAGTTTAACCACAGGAGCCCTGG - Intergenic
1084751631 11:71208106-71208128 GGGTTTAAGTACAGGGACGCTGG - Intronic
1086279779 11:85171987-85172009 CAGCTGAACCACAGGGACAGTGG - Intronic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG + Intronic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1107120099 13:36786933-36786955 CTGTTTAACCACAGGAAGCCTGG + Intergenic
1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG + Intronic
1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG + Intronic
1111773484 13:92628606-92628628 CAGTTTAGTCACAGTGATGCTGG - Intronic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG + Intergenic
1128462818 15:67884224-67884246 CACTTTAAAGATAGGGACGCAGG - Intergenic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG + Intergenic
1146839057 17:36136879-36136901 TAGGATAACCACAGGGAAGCAGG + Intergenic
1152350187 17:79779796-79779818 CAGGTTTGCCACAGTGACGCAGG + Intronic
1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG + Intronic
1157496365 18:48160391-48160413 CAGTATAACAGCAGGCACGCTGG + Intronic
1160422589 18:78757288-78757310 CAGTTTAGCAACAGTGAGGCTGG - Intergenic
1160565599 18:79784999-79785021 CTGTTTGTCCACAGGGACACAGG - Intergenic
1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG + Intronic
1164460755 19:28445621-28445643 CAGTTTCACCAGAGTGGCGCTGG - Intergenic
1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG + Intergenic
926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
934306822 2:91832092-91832114 AGGTTAAACCACAGGGACCCAGG + Intergenic
934326434 2:92020650-92020672 AGGTTAAACCACAGGGACCCAGG - Intergenic
934464798 2:94251267-94251289 AGGTTAAACCACAGGGACCCAGG - Intergenic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
946748200 2:222866569-222866591 CAGGTTAAGAACAGGGACTCTGG - Intronic
947621239 2:231592622-231592644 AAGTACAACCACAGGGACACAGG - Intergenic
1173284117 20:41655050-41655072 CTGTTCAACCACAGGGCCACTGG + Intergenic
1176595835 21:8694438-8694460 AGGTTAAACCACAGGGACCCAGG - Intergenic
1177874367 21:26612829-26612851 CATTTTAACCACAAGGATGGGGG - Intergenic
1178518027 21:33265038-33265060 CAGTTTAAGGACTGGGACTCAGG + Intronic
1178751257 21:35305641-35305663 AGCTTTAGCCACAGGGACGCTGG + Intronic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1180278695 22:10671551-10671573 GGGTTAAACCACAGGGACCCAGG - Intergenic
1180585950 22:16890414-16890436 AGGTTAAACCACAGGGACCCAGG - Intergenic
1180757617 22:18173602-18173624 AAGTTTAAACACAGGGACAAGGG + Intronic
1181074157 22:20363843-20363865 AAGTTTAAACACAGGGACAAGGG - Intronic
1185295618 22:50052294-50052316 CAGTTTGACCACAGCTAAGCAGG - Intronic
949559713 3:5189682-5189704 CACTTTAACCACAGAGGCGGAGG - Intronic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
955054422 3:55443270-55443292 CAGTTTAAGAAAAGGGACTCTGG - Intergenic
955335757 3:58084397-58084419 CACATTAACAACAGGGAAGCCGG - Intronic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
961064395 3:123862244-123862266 CAGATGAACTACAGGGACACAGG - Intronic
964701158 3:159569098-159569120 CATTTAAAACACAGGGACTCAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
985327724 4:188791040-188791062 CAGGTTATCCATAGGGACACGGG + Intergenic
995301267 5:110586027-110586049 CAGCTTAATCACAGGGAAGGGGG + Intronic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1022722458 7:32953499-32953521 CACTTGAACCCCAGGGACGGAGG - Intergenic
1023813677 7:43931780-43931802 CAGTTGAACCAGAGAGACGGAGG - Intronic
1024599998 7:50972045-50972067 CAGTTTAAACACATGGACGTTGG - Intergenic
1032446801 7:131991186-131991208 TAGGTTCACCACAGGGAGGCAGG + Intergenic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1042323662 8:67505034-67505056 CAGTGTACCCACAGGTACTCAGG - Intronic
1044844629 8:96368050-96368072 CAGTTTATCCACATTGACACTGG + Intergenic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1048753065 8:137701559-137701581 TAGTTTAACCACAGTGAATCTGG - Intergenic
1052085755 9:24263673-24263695 CAGTTTTACCACAGAAACTCAGG - Intergenic
1053694882 9:40628026-40628048 AGGTTAAACCACAGGGACCCAGG - Intergenic
1053941867 9:43258406-43258428 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054269959 9:63012093-63012115 AGGTTAAACCACAGGGACCCAGG + Intergenic
1054306126 9:63427250-63427272 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054404868 9:64751229-64751251 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054438492 9:65236721-65236743 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054491912 9:65785227-65785249 AGGTTAAACCACAGGGACCCAGG + Intergenic
1056899393 9:90584012-90584034 CAGGGTATCCACAGGGTCGCTGG - Intergenic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1062638785 9:137506165-137506187 CAGTCTAACCACACAGACCCCGG + Intronic
1202777327 9_KI270717v1_random:1632-1654 AGGTTAAACCACAGGGACCCAGG - Intergenic
1203774463 EBV:65043-65065 CTGTTTGACCCCAAGGACGCCGG + Intergenic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1195324266 X:103745370-103745392 CAGTTTATCCAAAGGGGCTCAGG - Intergenic
1202275843 Y:23118879-23118901 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202290185 Y:23301812-23301834 CAGTTTAGCCTCAGGGATGAAGG + Intergenic
1202428837 Y:24752598-24752620 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202441954 Y:24917491-24917513 CAGTTTAGCCTCAGGGATGAAGG + Intergenic