ID: 926323559

View in Genome Browser
Species Human (GRCh38)
Location 2:11765545-11765567
Sequence AATTACGTGGGGCAGTTAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926323554_926323559 -7 Left 926323554 2:11765529-11765551 CCAGGTGCAGACCATGAATTACG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 926323559 2:11765545-11765567 AATTACGTGGGGCAGTTAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926323559 Original CRISPR AATTACGTGGGGCAGTTAGC CGG Exonic
914336115 1:146716349-146716371 TATTATGTGGGGCAGCGAGCCGG + Intergenic
917393483 1:174565446-174565468 AAACAAGTGGGGCAATTAGCTGG - Intronic
920239476 1:204534934-204534956 AATTACTTGGGGCAATTTTCTGG - Intronic
1068989469 10:63135400-63135422 ACATTCGTGGGGCAGTTGGCGGG - Intronic
1069520019 10:69111575-69111597 AACTACGTGGGGTGTTTAGCTGG + Intergenic
1086045437 11:82526486-82526508 AATAACATAGGCCAGTTAGCTGG + Intergenic
1087867650 11:103251702-103251724 ATTTACCAGGGGCAGGTAGCAGG - Intronic
1091707970 12:2712666-2712688 CACTAGGTGGGGCAGTTGGCAGG + Intergenic
1093166951 12:15815217-15815239 AAAGACCTGGGGAAGTTAGCTGG - Intronic
1099462335 12:82938664-82938686 AATGAAGTGGGGCAGCTTGCAGG + Intronic
1102461759 12:113104218-113104240 CATCACGTGGGGCAGTTGGAAGG + Exonic
1105214207 13:18274822-18274844 AGTAACTTGGGGCAGTTACCAGG - Intergenic
1109061075 13:57621198-57621220 AATTACGTGGGCGTGGTAGCGGG - Intergenic
1110172367 13:72516995-72517017 AATTACGGGAGGCAGTTTGGTGG + Intergenic
1114421779 14:22589754-22589776 AATTACTTGGGGGAGTGAGTGGG + Intergenic
1118148353 14:63164456-63164478 ATTTGGGTGGGGCAGCTAGCTGG - Intergenic
1122595687 14:102888917-102888939 AATTAGGTGGGGCTGGGAGCAGG - Intronic
1129817489 15:78567530-78567552 AACTAAGTGGGGCAGAAAGCAGG - Intronic
1135579754 16:23615415-23615437 AACTACTTGGGGCAGTGAGGTGG - Intronic
1139997506 16:70994870-70994892 TATTATGTGGGGCAGCGAGCCGG - Intronic
1146970669 17:37069080-37069102 AATTACCTGGGGCTGGGAGCAGG - Intergenic
1150751635 17:67869102-67869124 AATTAAGGGGGGAAGTAAGCTGG - Intronic
1153233227 18:2960815-2960837 AATTATGTGGGACAGCTGGCTGG - Exonic
1153978664 18:10291079-10291101 GATCACGTGGGCCAGTCAGCTGG - Intergenic
1155301745 18:24435721-24435743 TATTATGTGGGGCAGTTAATCGG + Intronic
1155579863 18:27291502-27291524 AATTAAGTGGGACAGTTAATGGG - Intergenic
1159310784 18:66706175-66706197 TATTTGATGGGGCAGTTAGCTGG - Intergenic
1161516562 19:4699822-4699844 AACTCCGTGGGGCAGATGGCTGG - Intronic
1167371644 19:49086017-49086039 AATTACGAGATGCAGTTTGCAGG - Intronic
925575543 2:5356327-5356349 AATTACTTGCTGAAGTTAGCTGG - Intergenic
926323559 2:11765545-11765567 AATTACGTGGGGCAGTTAGCCGG + Exonic
933100041 2:78243926-78243948 AAGGAGGTGGGGCATTTAGCAGG + Intergenic
934300112 2:91771928-91771950 AGTAACTTGGGGCAGTTACCAGG + Intergenic
938972332 2:136443856-136443878 AATTAGGTGGTGCAGGAAGCAGG + Intergenic
943216199 2:185039417-185039439 AATTACCTGGTGCAATTACCTGG - Intergenic
1169251079 20:4061754-4061776 AATTAGGTGGGCAAGGTAGCGGG - Intergenic
1181698465 22:24607058-24607080 AGTAACTTGGGGCAGTTACCAGG + Intronic
959095232 3:101948673-101948695 AATTACTTGGGGAAGTTATTGGG - Intergenic
962211206 3:133480141-133480163 GATTACGTGGGCCAATTAGGAGG - Intergenic
962211221 3:133480240-133480262 GATTACGTGGGCCAATTAGGAGG - Intergenic
962932402 3:140050500-140050522 AATTACCAGGAGCAGTTAGTGGG + Intronic
965704533 3:171492955-171492977 CTCTAGGTGGGGCAGTTAGCAGG + Intergenic
975731798 4:77344689-77344711 AATTACCTGGAGCAGTTTTCTGG + Intronic
976403855 4:84639217-84639239 AATTACCTGGGGGTGTTAACTGG - Intronic
984044004 4:174774558-174774580 AATTAGGTAGTGCATTTAGCAGG - Intronic
990441862 5:55854594-55854616 AATTACCTGGGCCTGTTGGCAGG + Intronic
1001475719 5:172049195-172049217 AACAGCGTGGGGCACTTAGCAGG + Intronic
1002873674 6:1190845-1190867 AAATACCTGGGGCTGTTAGGAGG + Intergenic
1030224622 7:107136013-107136035 ATTTAAGTGGGGCTGTTACCGGG - Intronic
1032783301 7:135181825-135181847 AATTACGTGAAGCAGGAAGCAGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037290973 8:17349128-17349150 AATTTCTGGGGGCAGTTCGCAGG - Intronic
1047344109 8:124010561-124010583 AATTAGGTCTGGAAGTTAGCTGG - Intronic
1047501141 8:125442536-125442558 ATTTATGTGAGGCACTTAGCAGG - Intergenic
1056712373 9:89001267-89001289 CAGTACGTGGGGAAGTTGGCGGG + Exonic
1203655575 Un_KI270752v1:20945-20967 AATTACGTGGGGCAGGGGCCTGG + Intergenic
1194901704 X:99520165-99520187 ACTTACTAGGAGCAGTTAGCTGG - Intergenic
1198071867 X:133156767-133156789 AATTACTTGGGACAGTAAGGTGG - Intergenic
1202036870 Y:20645083-20645105 AATCACTTGGGGCAATTAGTTGG + Intergenic