ID: 926323884

View in Genome Browser
Species Human (GRCh38)
Location 2:11767698-11767720
Sequence CCCCATGAGGTCTCCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926323884 Original CRISPR CCCCATGAGGTCTCCTGTCC TGG Intronic
901428073 1:9196131-9196153 ATCCATGAGGGCTCCTGTCTGGG + Intergenic
902724472 1:18325684-18325706 CCCCCTGGGGTCTCCTGTAAGGG + Intronic
903646049 1:24897093-24897115 CCCCATGAGGGCTCCAGAGCTGG - Intergenic
904486670 1:30829311-30829333 TCCCATGAGGTCTGCAGTCAGGG + Intergenic
905773862 1:40655355-40655377 CCCCAGGAGGTCTCAAGTCCTGG + Intronic
907520302 1:55019510-55019532 CCCCACGAGGTCCCCAGGCCTGG - Intergenic
914876077 1:151513378-151513400 CCCCAAGTGGACTCCTGCCCAGG - Intronic
919841005 1:201609440-201609462 CCCCACGATCTCTCCTGTCCCGG + Intergenic
922808346 1:228401992-228402014 CCCCCTGGGGTCTCCTATACAGG + Intronic
922849850 1:228723300-228723322 CCACTTGGGGTCTCCTCTCCTGG - Intergenic
1065561595 10:26969491-26969513 ACCAATGAAGACTCCTGTCCTGG + Intergenic
1066068347 10:31778736-31778758 GGCCACCAGGTCTCCTGTCCTGG + Intergenic
1066957661 10:42188367-42188389 CCCCATGAGGTCATCAGTGCTGG - Intergenic
1067181361 10:43988383-43988405 CCCCATGACCTCTCCTGTAGGGG + Intergenic
1067314919 10:45152079-45152101 GCCCAGGAGGCCTCCTGGCCCGG + Intergenic
1067809911 10:49418262-49418284 CCTCAGGAGGCCTCCTTTCCAGG - Intergenic
1067923237 10:50481015-50481037 CCCCATGGGGGCTCCTTCCCAGG - Intronic
1068127388 10:52857346-52857368 CCCCAAGAGTTATCCTGTTCTGG - Intergenic
1070559529 10:77555356-77555378 CCCCATGAGGTCTTCAGTCCTGG - Intronic
1075793059 10:125099344-125099366 CCACATGAGGCTTCCTTTCCGGG + Intronic
1075947830 10:126453564-126453586 CCCTCTGAGGACGCCTGTCCGGG - Intronic
1076200648 10:128555011-128555033 CCCCAAGTGGTCTTCTCTCCTGG - Intergenic
1077324275 11:1957014-1957036 CCCCCTGAGGGCTGCTGCCCTGG - Intronic
1077352494 11:2099402-2099424 TCCCCTGCTGTCTCCTGTCCTGG + Intergenic
1078397171 11:10991537-10991559 CCCCAGGAGGTCCTCTGTCTAGG + Intergenic
1079154163 11:17928739-17928761 CCCCTTGGGGTCTTCTGTTCTGG - Intronic
1082284621 11:50305145-50305167 CAACATGAATTCTCCTGTCCTGG - Intergenic
1083889750 11:65589868-65589890 CCCCAGGAAGTCCCCAGTCCAGG - Intronic
1084700857 11:70785385-70785407 CCCCCAAAGCTCTCCTGTCCAGG + Intronic
1085321731 11:75578523-75578545 CCACCTGAGGTCTGATGTCCTGG - Intergenic
1085347973 11:75780404-75780426 CCTCCTGAGGACTCCTGTCAGGG - Intronic
1085685998 11:78622478-78622500 CCCCATGAGGCCATCTGTGCAGG - Intergenic
1089139705 11:116275873-116275895 CCCCAAGAGGACTCCAGGCCTGG + Intergenic
1090835483 11:130450344-130450366 CCTCCTGAGGTCTCCTTTCAAGG + Intronic
1202807261 11_KI270721v1_random:12209-12231 CCCCCTGAGGGCTGCTGCCCTGG - Intergenic
1091704663 12:2685714-2685736 CCCCATGAGCTCTCTGTTCCAGG + Exonic
1091711235 12:2742052-2742074 CCCCATGAGCTCTCTGTTCCAGG + Intergenic
1092195339 12:6546397-6546419 CCCCGTGAGCTCTCCTGGCCTGG - Intronic
1093341666 12:17982681-17982703 CCCCACGAGGTGTCCTGTCCAGG - Intergenic
1095708131 12:45259716-45259738 CCCCATCATGTTTCCTGCCCTGG - Intronic
1098749884 12:74279878-74279900 CCCCATGAGGCCTTCAGTGCAGG - Intergenic
1099632897 12:85173496-85173518 CCTGATGAGGGCTCCTGTCTTGG + Intronic
1100576536 12:95896718-95896740 CCCCAGGAGGCCTCCTCTACGGG - Intronic
1100642579 12:96496454-96496476 TCTCATGAGGACTCCTCTCCTGG + Intronic
1101114572 12:101519492-101519514 CCCAATGAGGGCTCCCTTCCTGG + Intergenic
1102183733 12:110932090-110932112 CCTCCTGAGGTCTCCTGGCTGGG + Intergenic
1102438973 12:112946998-112947020 CACCATCTGCTCTCCTGTCCCGG + Intronic
1102487317 12:113267014-113267036 CCCCATGCCGTCACCTGTGCTGG + Intronic
1103086108 12:118062217-118062239 CTCCATGATGACTCCTGCCCTGG - Intronic
1104769980 12:131355503-131355525 CCCCATGATGTGCTCTGTCCAGG - Intergenic
1108904320 13:55450259-55450281 CCCCATGAGGCCACCGGTGCAGG - Intergenic
1112651650 13:101405598-101405620 CTCCATGAGGTCACCTCTCACGG + Intronic
1118122402 14:62859881-62859903 CCCCATGAGGCCACCGGTGCAGG + Intronic
1119206318 14:72796708-72796730 CCCCAAGAGGTCTACTTTCTAGG - Intronic
1122355876 14:101122580-101122602 CCACCTGAGTTCTCCAGTCCTGG - Intergenic
1202935441 14_KI270725v1_random:83409-83431 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1124749928 15:32365134-32365156 CACCACTAGGTCTCCTGGCCGGG + Intergenic
1128612995 15:69088664-69088686 CCCCAGGAGGTCTCTTCTTCAGG - Intergenic
1128732785 15:70032625-70032647 CCCGATGGTGTCTCCTGGCCAGG + Intergenic
1129633320 15:77287260-77287282 CACCATGAAGTCTCCTATTCTGG - Intronic
1129951134 15:79592560-79592582 CCCCACAAGGTTTCCAGTCCTGG + Intergenic
1132386569 15:101404789-101404811 GCCAGTGAGGTCTCCTGCCCTGG - Intronic
1132688685 16:1172786-1172808 GCCCCCGAGGGCTCCTGTCCAGG + Intronic
1135510638 16:23080096-23080118 CCACGTGAGGTGTCATGTCCAGG + Exonic
1139449256 16:67016883-67016905 CCCCAAGAGGTGTCCAGTCCAGG + Intergenic
1141399605 16:83735754-83735776 ACTCATGAGGTCTGCTGACCAGG + Intronic
1143740843 17:8952951-8952973 TCCCATCAAGGCTCCTGTCCAGG - Intronic
1144732451 17:17536586-17536608 TCCCATGAGGTCACCTTTGCTGG - Intronic
1147056260 17:37837606-37837628 CTCCATGGGTTCTCCTGTTCTGG + Intergenic
1147375023 17:40018118-40018140 CCCCATGCCCTCTCCTTTCCGGG - Intergenic
1148019914 17:44546921-44546943 CCCCATCAGAGCTCCTGCCCAGG - Intergenic
1148850390 17:50551753-50551775 CTCCATGTGGACTCCAGTCCTGG + Intronic
1149851427 17:60037850-60037872 CCCTCTGGGGTCTCCTGGCCTGG - Intergenic
1150304823 17:64075683-64075705 CCCCTCAAGGTCTCCTGTCCAGG + Intronic
1150794901 17:68229251-68229273 CCCCATGATGTTTCCTCTCTGGG + Intergenic
1152553520 17:81041389-81041411 CACCATGAGATCTGATGTCCTGG + Intronic
1156492840 18:37506466-37506488 GCCCATGAGGTCACTTGTCCTGG - Intronic
1164095998 19:22010550-22010572 CCCCAAGAGGGCTCCAGGCCAGG + Intronic
1164115498 19:22215405-22215427 CCCCAAGAGGGCTCCAGGCCAGG + Intergenic
1164199174 19:23002782-23002804 CCCCAAGAGGGCTCCAGGCCAGG + Intronic
1165059907 19:33200010-33200032 ACCTGTGAGGTCCCCTGTCCTGG - Intronic
1166116921 19:40662153-40662175 CCTCATGAGGTTTTCTGTGCAGG + Intergenic
1167284504 19:48591531-48591553 GCCCCTGAGGCCTCCTGCCCTGG - Intronic
1167516231 19:49924616-49924638 CCCCTTCAGGACTCATGTCCTGG - Intronic
1167660811 19:50794916-50794938 GCCCATGGGGTCTCCTGCCATGG + Exonic
1167788018 19:51651668-51651690 CCCCATGATGTCTCCAGCCTGGG + Intergenic
1168345546 19:55648689-55648711 CCCCAAGGGGTCGCCTGACCAGG - Exonic
925166833 2:1720876-1720898 CAGCATGAGGACTGCTGTCCTGG - Intronic
926323884 2:11767698-11767720 CCCCATGAGGTCTCCTGTCCTGG + Intronic
930536571 2:52651977-52651999 CCCCATGAGGCCACCAGTGCAGG + Intergenic
930736701 2:54787068-54787090 CCCACTGAGGTCTCCAGGCCAGG + Intronic
931455796 2:62408998-62409020 CCCCCAGAGGTCTCCAGTCAGGG + Intergenic
931668720 2:64627920-64627942 CCCCGTCAGTTCTCTTGTCCTGG - Intergenic
933927568 2:87110813-87110835 CTCCCTGAGGTCTCCTTTACAGG - Intergenic
934305781 2:91820881-91820903 CCCCATGAGGTCATCAGTGCAGG - Intergenic
934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG + Intergenic
934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG + Intergenic
936058022 2:109275993-109276015 CCCCATTTGGTCTCCAATCCTGG + Intronic
938377608 2:130819091-130819113 CCCTATGATGTCTCCTGAGCTGG + Intergenic
940770921 2:157838820-157838842 CCTCATAAGGTCTCCAATCCTGG + Intronic
945303318 2:208234956-208234978 CCACATGAGCTCTCCTGGCAAGG - Intergenic
947502102 2:230678504-230678526 CCCCACTAGTTCTCCTCTCCTGG - Intergenic
947931479 2:233968512-233968534 ACCCATGAGGACTAGTGTCCTGG - Intronic
1170426648 20:16241810-16241832 CGCCATAAGGTCACCTGCCCAGG + Intergenic
1175667100 20:60870020-60870042 CCCCATCAGCTCTCCCGTCGTGG - Intergenic
1175743284 20:61435730-61435752 CTGCAGGACGTCTCCTGTCCAGG - Intronic
1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1176842700 21:13853225-13853247 GCCCATGAGGTCACCTGTGGGGG - Intergenic
1178680823 21:34670567-34670589 CCCCATGTGGGCTGCTGTCGGGG - Exonic
1178713030 21:34936692-34936714 ACCCATGGGGTCTCCCGGCCAGG - Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1179437860 21:41374483-41374505 CCTCATGGGGTCTGCTGTCGGGG - Intronic
1179593487 21:42427122-42427144 CCCCAAGACGTCACCTGCCCCGG + Intronic
1179728038 21:43351092-43351114 CCAGCTGAGGCCTCCTGTCCAGG + Intergenic
1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1181001420 22:19989485-19989507 CCCCATGGGCTCTCCTCACCTGG - Intronic
1184451611 22:44585975-44585997 CCCCATGGGGTCTGCTCTCAGGG + Intergenic
1184520206 22:44989188-44989210 TTCCCTGAGGTCTCCTGACCAGG - Intronic
1185222601 22:49636493-49636515 CCCCATGAGGCCTCCTTCCTCGG + Intronic
1185225141 22:49647885-49647907 GCCCATGAGGACACCTTTCCAGG + Intronic
949125625 3:442860-442882 CCCCATGAGGCCACCAGTGCAGG + Intergenic
950430552 3:12948441-12948463 CCCCATGAGCTCCCCAGTCCAGG - Intronic
950458227 3:13105285-13105307 ACCCATCTGGTCTCCTGACCAGG + Intergenic
951554534 3:23907481-23907503 TCTCATGAGGTCTCCTTTCAGGG + Intronic
953775326 3:45811851-45811873 CCCCTAGAGGCCTCCTGTGCTGG - Intergenic
954675142 3:52311513-52311535 CCCCCTGCAGTCTCCTCTCCTGG - Intergenic
954807755 3:53230237-53230259 CCCCATGTGCACACCTGTCCAGG + Intronic
955060591 3:55488838-55488860 CCCCATGAGGTTCCATGTCAAGG - Intronic
961312943 3:126015408-126015430 CCCTCTGAGGTCTGCTGTTCCGG + Intronic
961352685 3:126314171-126314193 CCCCATGAGGAATCCTGGGCAGG - Intergenic
968455796 4:699037-699059 TCCCATGAGGCCTCCTCTGCAGG + Intergenic
968811550 4:2801670-2801692 CCTCAGGAGGTTTCCTGTCTAGG - Intronic
969505135 4:7581623-7581645 CTGCGTGAGGGCTCCTGTCCTGG - Intronic
974262330 4:59541994-59542016 CCCCATGAGGCCACCTGGGCAGG + Intergenic
974289608 4:59913027-59913049 CCCCATGAGGTCATCAGTGCAGG - Intergenic
977626233 4:99192368-99192390 CCCCATGAGGCCTTCAGTGCAGG + Intergenic
987544689 5:19298127-19298149 TCCCATGAGGTCACCTTTTCTGG - Intergenic
988562169 5:32291126-32291148 CCCCATGAGGTCATCGGTGCAGG - Intronic
996027340 5:118661630-118661652 CCCCAACAGGTGACCTGTCCTGG + Intergenic
997610002 5:135209224-135209246 CCCCATGGCTTCTCCTGCCCAGG - Intronic
1001236323 5:170032519-170032541 CCCCGAGATGTCTCCTGCCCTGG + Intronic
1002323127 5:178387487-178387509 GCCCATGAGCTCTCCTGGCAGGG + Intronic
1002671656 5:180872572-180872594 CCCCATGATGTGCCCTGTCTGGG - Intergenic
1006756686 6:36422369-36422391 CCCCTTCAGGTCTCATGTCAGGG + Intronic
1007337898 6:41167854-41167876 CCCCAGGAGGTGTCCTGGCTTGG - Intergenic
1007468305 6:42070894-42070916 CCACATGTTGTCTCCTATCCTGG - Intronic
1007916383 6:45565438-45565460 CCCCTTGAGGTCACATGTTCTGG + Intronic
1010818667 6:80388695-80388717 CCCCATGAGGTCACTGGTGCAGG - Intergenic
1012430706 6:99161008-99161030 CCCCATGGCTTCTCCTGTGCTGG + Intergenic
1018828491 6:167424310-167424332 CCCCTAGAGGCCTCCTGCCCTGG + Intergenic
1019748129 7:2712152-2712174 CCCTTTGAGGACTCATGTCCAGG - Intronic
1020098793 7:5382834-5382856 CTCCATGAGGTCTCCTGTGAGGG - Intronic
1024203202 7:47126846-47126868 CCCCGGGAGGTCTTCTGTCCTGG + Intergenic
1024874027 7:54000368-54000390 CCCCAAGAGCTCTCCTCCCCAGG - Intergenic
1024980321 7:55152726-55152748 CCACAGGAAGTCTTCTGTCCTGG - Intronic
1025186887 7:56867823-56867845 CAACATGAATTCTCCTGTCCTGG + Intergenic
1025685033 7:63709089-63709111 CAACATGAATTCTCCTGTCCTGG - Intergenic
1025835627 7:65090844-65090866 CAACATGAATTCTCCTGTCCTGG - Intergenic
1025905405 7:65780320-65780342 CAACATGAATTCTCCTGTCCTGG - Intergenic
1026039317 7:66853964-66853986 CAACATGAATTCTCCTGTCCTGG - Intergenic
1026482174 7:70789023-70789045 CCCCATGAGGTTTCGTGTTTAGG + Intronic
1027606883 7:80311789-80311811 TCTGATGAGGTGTCCTGTCCAGG - Intergenic
1031886069 7:127247211-127247233 CCAAATGAGGTCTCCTGGCCAGG + Intronic
1032853936 7:135818497-135818519 TCCCAAGTGGCCTCCTGTCCAGG - Intergenic
1033548717 7:142425890-142425912 CCCCATGTGGTCTCTGCTCCTGG + Intergenic
1033559936 7:142521600-142521622 ACCCATGTGGTCTCCACTCCTGG - Intergenic
1034931959 7:155169746-155169768 CCCCATGTGATCTGGTGTCCTGG - Intergenic
1040715699 8:50249246-50249268 TGCCATGAGGACTCCTGCCCTGG - Intronic
1042086181 8:65111869-65111891 TCCCATGACATTTCCTGTCCAGG + Intergenic
1043435936 8:80236508-80236530 CCTCATCAAGTCCCCTGTCCCGG + Intergenic
1048174549 8:132140153-132140175 CGCCATGGGGTCACCTGTCCCGG + Exonic
1049184956 8:141245456-141245478 CTCCATCACGTCTTCTGTCCAGG + Intronic
1049690639 8:143957461-143957483 TGCCATCAGGTCTCCTGGCCAGG + Intronic
1052442227 9:28511996-28512018 CCCCATGAGGTCATCAGTGCAGG + Intronic
1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054490882 9:65774025-65774047 CCCCATGAGGTCATCAGTGCAGG - Intergenic
1055630597 9:78219775-78219797 TCCCTTGAGGTCTCTAGTCCTGG + Intergenic
1055672016 9:78617201-78617223 ACCTATGAGGTCTCCTGACTTGG - Intergenic
1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG + Intergenic
1057187152 9:93063254-93063276 CCCCAGTAGGGCTCATGTCCTGG + Intronic
1057889001 9:98853759-98853781 CCCCGTGAGGCCTCCTTCCCCGG - Intergenic
1059341697 9:113601063-113601085 CCCCTGCAGGTCTCCTGCCCAGG + Intergenic
1060589500 9:124808010-124808032 CCCCATGAGGACCCCTCCCCAGG - Intronic
1061919084 9:133772310-133772332 CCTGCTGAGGCCTCCTGTCCTGG + Intronic
1062100457 9:134725251-134725273 ACCTGTGAGGTCACCTGTCCAGG - Intronic
1062406836 9:136400676-136400698 CCCTCTGGGGTCTCCTGGCCTGG + Intergenic
1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1189182088 X:39014094-39014116 CCCCTTGAGGACTCCTGGCTTGG + Intergenic
1192224208 X:69217292-69217314 GCACCTGAGGTCTCCTGTCAAGG + Intergenic
1192822035 X:74656278-74656300 CCCCCTGAGGACTCCGTTCCAGG + Intergenic
1193925626 X:87479993-87480015 ACCCATGAGTTCTCCAGTGCGGG - Intergenic
1194870751 X:99128159-99128181 CCCCTTGAGGTCATATGTCCAGG - Intergenic
1195554887 X:106210600-106210622 CCCCATGAGGTGTGCAGTGCTGG - Intergenic
1195653430 X:107311474-107311496 CCCCATAAAGTCTACTGTCTTGG - Intergenic
1200056182 X:153462540-153462562 CACCATGAGGTTCCCTGCCCAGG + Intronic
1200175939 X:154116356-154116378 CCCCATGGGGCCTCGTGTGCCGG + Intergenic
1200257603 X:154592735-154592757 GCCCATGAGCTCTCCAGTCTGGG - Intergenic
1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG + Intergenic