ID: 926326486

View in Genome Browser
Species Human (GRCh38)
Location 2:11788623-11788645
Sequence AAGAGGGGCAACCACGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926326486_926326493 15 Left 926326486 2:11788623-11788645 CCTTGCACGTGGTTGCCCCTCTT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 926326493 2:11788661-11788683 ACCTCCCAATCATGGTCGAGCGG 0: 1
1: 0
2: 0
3: 14
4: 169
926326486_926326492 7 Left 926326486 2:11788623-11788645 CCTTGCACGTGGTTGCCCCTCTT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 926326492 2:11788653-11788675 AAGGCAAAACCTCCCAATCATGG 0: 1
1: 0
2: 0
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926326486 Original CRISPR AAGAGGGGCAACCACGTGCA AGG (reversed) Intronic
901498355 1:9635837-9635859 AACAGGGGCAGCCCCGTACAGGG - Intergenic
902793436 1:18784657-18784679 AAGAGGGGCGCCCAGGGGCAAGG + Intergenic
904923680 1:34029057-34029079 AAGAGGAGCTACCAAGAGCAGGG + Intronic
905247393 1:36624638-36624660 AGGAGGGGGAACCATGTGGAAGG - Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
910677330 1:89827790-89827812 TAGAGGGCCTGCCACGTGCAAGG - Intronic
913172261 1:116243625-116243647 TTGAGGGCCAACCCCGTGCAGGG - Intergenic
917902034 1:179552196-179552218 TAGAGGGACAACCACGATCAGGG - Intronic
924908315 1:248480845-248480867 AAGAGGGGCCACCACCTTTATGG - Intergenic
924915791 1:248567238-248567260 AAGAGGGGCCACCACCTTTATGG + Intergenic
1063103292 10:2970249-2970271 TGGAGGGGCAACCCCGTGCCTGG - Intergenic
1063553485 10:7055624-7055646 AAGGGGGACAATCAAGTGCACGG + Intergenic
1069795599 10:71049840-71049862 AAGAGAGGCAGCCAAGGGCAGGG + Intergenic
1070824725 10:79384492-79384514 AAGACGGGGAACAACGTGCTCGG + Exonic
1071752986 10:88502472-88502494 AAGAGGAGCAGCCCTGTGCAAGG - Intronic
1073271345 10:102266834-102266856 AAGAGGGAGAAGCACGTGCCAGG + Intronic
1074291450 10:112140603-112140625 AACAGGGGCATCCATGTGCAGGG - Intergenic
1074360599 10:112821841-112821863 AAGAGGTGCAAACACGGGGAGGG - Intergenic
1074781765 10:116807354-116807376 AAGAGGGGAAAGCAGGTCCAGGG - Intergenic
1075023537 10:118967890-118967912 AAGTGGGGCAACCATTAGCAGGG + Intergenic
1083331160 11:61899027-61899049 AGGAGGGGCCACCACCTCCAGGG + Intronic
1091779208 12:3203266-3203288 ATGAGGGCCTACAACGTGCAGGG - Intronic
1096571874 12:52528058-52528080 AAGTGGGGCAGCCTCATGCAAGG - Intergenic
1100409760 12:94304209-94304231 AAGGGGGGCAGCCATGTACAGGG - Intronic
1102558163 12:113742519-113742541 CAGAGGGGCAACTAGGGGCAGGG + Intergenic
1104146619 12:126040186-126040208 AAGAAGGGAGACCAGGTGCAGGG - Intergenic
1105023435 12:132833277-132833299 GAGAGGGGCTACCATCTGCATGG + Intronic
1105442961 13:20430482-20430504 AAGAGGGACAACCAAAAGCAGGG + Intronic
1106629373 13:31454372-31454394 AAGAGGAGTAACCAAGTGTAAGG + Intergenic
1115047403 14:29013096-29013118 GAGAAGGCCAACCACATGCAAGG - Intergenic
1118503987 14:66390578-66390600 AGGATTGGCAACCACTTGCAGGG + Intergenic
1118916126 14:70107948-70107970 ATGAAGGGCAAACACATGCACGG - Intronic
1126382036 15:48058727-48058749 AAGGAGGGCAACTAAGTGCAAGG + Intergenic
1127575130 15:60284581-60284603 AAGAGGGCCAAACAAGTGCATGG + Intergenic
1131016261 15:89059912-89059934 AAGAGGGGCCCCCAAGTTCATGG - Intergenic
1134563468 16:15230905-15230927 AAGATGGGCAAACACCTGCAGGG - Intergenic
1134743577 16:16569967-16569989 AAGATGGGCAAATACCTGCAGGG + Intergenic
1134923990 16:18142531-18142553 AAGATGGGCAAACACCTGCAGGG - Intergenic
1135015804 16:18924308-18924330 AAGAGTCGCAGCCACGTGCTAGG - Intronic
1135321420 16:21500121-21500143 AAGAGTCGCAGCCACGTGCTAGG - Intergenic
1135374253 16:21931616-21931638 AAGAGTCGCAGCCACGTGCTAGG - Intergenic
1135437533 16:22439098-22439120 AAGAGTCGCAGCCACGTGCTAGG + Intergenic
1136332899 16:29593237-29593259 AAGAGTCGCAGCCACGTGCTAGG - Intergenic
1136447594 16:30333326-30333348 AAGAGTCGCAGCCACGTGCTAGG - Intergenic
1141660264 16:85437567-85437589 AGGAGGGGCAGCCACATGCTCGG + Intergenic
1145183599 17:20774941-20774963 AAGAGGGGAAAACAACTGCAAGG - Intergenic
1145861277 17:28212319-28212341 CAGAGGGGCACCCACCTGTATGG - Intergenic
1148212598 17:45817476-45817498 ATGAGGGGCAACAATGTGCTGGG - Intronic
1148251764 17:46087467-46087489 TTGAGTGGCTACCACGTGCAAGG + Intronic
1151849600 17:76682644-76682666 GCGAGGGGCAACCACATGCAGGG + Intronic
1166118490 19:40670332-40670354 AATATGCCCAACCACGTGCATGG + Intronic
925733835 2:6943290-6943312 AAGCGGGGGAACCAGGAGCATGG + Intronic
926326486 2:11788623-11788645 AAGAGGGGCAACCACGTGCAAGG - Intronic
927735359 2:25515899-25515921 AACAGGGGAAACTAAGTGCAGGG + Intronic
928312652 2:30223350-30223372 GAGAGGGGGAACCACCTGGAAGG - Intergenic
928888432 2:36177009-36177031 AATAGGGGCTTCCAGGTGCAGGG - Intergenic
931356278 2:61539449-61539471 ACGAGAGGCAACCACGTGAAAGG - Intergenic
932322646 2:70833514-70833536 AAGAGGGGCAGCCATGGGCTAGG - Intronic
934069861 2:88373950-88373972 AGGCGGGGCCACCATGTGCATGG + Intergenic
937159747 2:119748847-119748869 AACAGGGGAAACCAGGTGAAAGG - Intergenic
937265533 2:120612610-120612632 AAGAGAGGCGACCCCATGCAGGG - Intergenic
937326546 2:120992959-120992981 ATGGGGAGCAACCACGAGCAGGG + Intergenic
937819900 2:126298290-126298312 AAAAGGGGAAACCAGTTGCAAGG + Intergenic
946688341 2:222293232-222293254 AAGAGGGGCAACCACCCCCAAGG + Intronic
1170864549 20:20141932-20141954 AGGAGGGGCAGCCATGAGCAGGG + Intronic
1174394573 20:50238915-50238937 AAGAGAGGCAACCCCCAGCAGGG - Intergenic
1177114953 21:17074043-17074065 AAGGGGAGCTAGCACGTGCAGGG - Intergenic
1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG + Intronic
1183693394 22:39404223-39404245 AAGAGGGGCACCCTGGGGCAGGG + Intronic
1184325000 22:43776186-43776208 AAGTGTGGGAACCACCTGCATGG + Intronic
1185134695 22:49063026-49063048 AATGGGATCAACCACGTGCATGG + Intergenic
1185154490 22:49184965-49184987 ACTAGGGGCAAACACGTCCACGG - Intergenic
1185227297 22:49660380-49660402 GAGAGGAGCAGCCACGTGCATGG - Intergenic
950074907 3:10180523-10180545 GAGAGGGGCCAGCATGTGCAAGG + Intronic
951559288 3:23949474-23949496 AATAGGGGCAAACACATCCAAGG - Intronic
953386376 3:42508412-42508434 AAGAGGGGCTACTACTTCCAGGG + Intronic
960316678 3:116186951-116186973 AGGAGGGGCAACCAGGTGGTGGG + Intronic
960944760 3:122958367-122958389 TAGAGGGGAAACCAAGAGCAGGG + Intronic
961539018 3:127588051-127588073 CAGAGGGGCAGCCACTTGCCAGG + Intronic
967701126 3:192593304-192593326 AAGAGGGTCACGCAGGTGCATGG - Intronic
968592568 4:1466265-1466287 CCGAGGGGCACCCACCTGCAGGG - Intergenic
969465604 4:7354444-7354466 AAGAGAGACAACAAGGTGCAGGG + Intronic
975025750 4:69546490-69546512 AAGAAGGCCAAACACATGCATGG - Intergenic
981670215 4:147278236-147278258 AAGAGGGGAGACCAAGTGCAAGG - Intergenic
982424531 4:155242694-155242716 ACGAGGGGCAGGCACCTGCAGGG - Intergenic
982600609 4:157443938-157443960 CAGAGGGGCAAGGACCTGCATGG + Intergenic
985272323 4:188206183-188206205 AATAGGAGAAACCAGGTGCAGGG - Intergenic
998216133 5:140239814-140239836 AAGAGAGGCAAGCCAGTGCAGGG + Intronic
998770739 5:145542099-145542121 AAGAGGGACAACTACTTCCAGGG - Intronic
999861139 5:155647833-155647855 AAGAGGGGCAAAGATGTGCCTGG + Intergenic
1006305831 6:33218010-33218032 AGGAGGGGCCACCCCTTGCAGGG - Intergenic
1007147133 6:39647375-39647397 AAGAGGGGCAGGCAGGTGTATGG + Intronic
1007854838 6:44845465-44845487 AAGAGGGGCAAAGAAGTGCTGGG + Intronic
1013404386 6:109830149-109830171 AAGAGAGAGAACCATGTGCAGGG - Intergenic
1016101521 6:140107098-140107120 AAGAGGGGGAAACACATACACGG - Intergenic
1016243208 6:141955432-141955454 AAGAGAGGCAAGCAAATGCAGGG - Intergenic
1022605558 7:31810715-31810737 AAGAGGGAGATCCAGGTGCATGG - Intronic
1025991924 7:66503489-66503511 AAGAGGGGGACCCCCGTGGAGGG - Intergenic
1026425329 7:70286203-70286225 AAGAACGGCAACCTTGTGCAGGG + Intronic
1027558395 7:79695332-79695354 AAGGGGGGAAACTACGTTCAAGG + Intergenic
1034953542 7:155317493-155317515 CAGAAGGGCACCCACCTGCAGGG - Intergenic
1037753384 8:21696828-21696850 AAGAGAGGAAACCAGGTGAAGGG + Intronic
1039952327 8:42181890-42181912 AAGAAGGGAGACCAGGTGCAGGG + Intronic
1040998744 8:53428378-53428400 AAGAGGAGAAACCAGATGCATGG + Intergenic
1044263789 8:90159122-90159144 AAGAGGGACAACCAGGAGGAGGG + Intergenic
1047380294 8:124355757-124355779 AAGAGGGGCAGGCACCTGCAAGG + Intronic
1048230148 8:132631222-132631244 AATAGGGAAAACAACGTGCATGG + Intronic
1053562735 9:39212478-39212500 AAGAGGGACATACACGGGCAGGG - Intronic
1054134415 9:61406564-61406586 AAGAGGGACATACACGGGCAGGG + Intergenic
1059184171 9:112251177-112251199 AAGAGTGGCAATCAGGTGTAAGG + Intronic
1187361062 X:18628250-18628272 AGGAAGGGCAAGCATGTGCAAGG - Intronic
1193643009 X:84034710-84034732 AAAAAGTGCAACCATGTGCATGG - Intergenic
1200138338 X:153885635-153885657 ATGAGGGGCAGCCACGCCCAGGG + Intronic
1202025119 Y:20513421-20513443 AAGAGGGTCAAGCATGGGCATGG + Intergenic