ID: 926327129

View in Genome Browser
Species Human (GRCh38)
Location 2:11795094-11795116
Sequence TTATGCAAATGCTTGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926327129_926327134 23 Left 926327129 2:11795094-11795116 CCCTTGATCAAGCATTTGCATAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 926327134 2:11795140-11795162 TTTGGTGCCACAAACACTTATGG 0: 1
1: 0
2: 3
3: 18
4: 129
926327129_926327133 5 Left 926327129 2:11795094-11795116 CCCTTGATCAAGCATTTGCATAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 926327133 2:11795122-11795144 AGTGATGATGGAGTTTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 210
926327129_926327132 0 Left 926327129 2:11795094-11795116 CCCTTGATCAAGCATTTGCATAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 926327132 2:11795117-11795139 GCTACAGTGATGATGGAGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 178
926327129_926327131 -7 Left 926327129 2:11795094-11795116 CCCTTGATCAAGCATTTGCATAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 926327131 2:11795110-11795132 TGCATAAGCTACAGTGATGATGG 0: 1
1: 0
2: 0
3: 6
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926327129 Original CRISPR TTATGCAAATGCTTGATCAA GGG (reversed) Intronic
908039340 1:60091393-60091415 TTGTACAAATGACTGATCAATGG - Intergenic
908064488 1:60388085-60388107 TTGTGCAAATGATTTATTAAAGG + Intergenic
908495014 1:64686006-64686028 GTATTCATATGCTTGATAAAAGG + Intronic
909591790 1:77358471-77358493 TTCTGCAGCTGCTTAATCAATGG - Intronic
909601743 1:77468172-77468194 TTTTGCAAATGCTGCTTCAATGG - Intronic
910518693 1:88092840-88092862 TGATGCAAATGCTTGTAAAACGG + Intergenic
910610056 1:89131565-89131587 ATGTGGAAATGCTAGATCAAAGG + Intronic
911838036 1:102646044-102646066 TTATGAAAATGCTTTGTCACTGG + Intergenic
913086570 1:115442903-115442925 TAATGCAATTTCTTGGTCAAAGG - Intergenic
913546301 1:119872112-119872134 TTATGCACATGCTTGATGATGGG - Intergenic
917993560 1:180410085-180410107 TTATGCCAAAGCCTGATCCAGGG + Intronic
919545273 1:198909682-198909704 TTGTGCTAATCCTTGATCATAGG - Intergenic
921964799 1:221076738-221076760 TGCTGCTACTGCTTGATCAAGGG + Intergenic
922302071 1:224310418-224310440 TAATGAAAAGGCTTGATTAAAGG - Intronic
922584742 1:226725123-226725145 TAATGAACATGCTTGCTCAATGG + Intronic
1063066233 10:2612012-2612034 TCCTGCAAGTGCTGGATCAAGGG - Intergenic
1063955378 10:11260596-11260618 TTATGCAAACGCTGGCTCAGTGG + Intronic
1064366495 10:14713227-14713249 TTATGGAATTGCTGGGTCAAGGG - Intronic
1069592627 10:69651413-69651435 TTCGGCCAATGCTTGTTCAATGG - Intergenic
1070049645 10:72875588-72875610 TGAAGCAAATGCCTGTTCAATGG + Intronic
1071849672 10:89556224-89556246 TTCTGCAAATTATTTATCAATGG - Intronic
1072275095 10:93815146-93815168 TTATGCAAATGCTCATTCAAAGG - Intergenic
1072840780 10:98771649-98771671 TTTTGAAAGAGCTTGATCAAGGG + Intronic
1074351421 10:112740794-112740816 TAATGGAAATGCTGGATCATAGG - Intronic
1077527576 11:3076714-3076736 CTGTCCAAATGTTTGATCAATGG + Intergenic
1078559522 11:12358349-12358371 TGATGCAAGTGATTGAGCAAAGG + Exonic
1078959290 11:16246078-16246100 TTATTTAAATGATTGATCCAGGG + Intronic
1079824863 11:25178225-25178247 TTCTCAAAATGCTTGATCAAGGG + Intergenic
1080147207 11:29000937-29000959 TTTTTCAAATTCTTGTTCAAGGG + Intergenic
1083517364 11:63272822-63272844 TTATGCAAATGTTTCCTCAAAGG - Intronic
1086789156 11:91013840-91013862 TTATGCAAATATTTTGTCAAAGG + Intergenic
1087607144 11:100390716-100390738 TAATGGAATTGCTGGATCAAAGG - Intergenic
1087639169 11:100736864-100736886 ATATGTAAAGCCTTGATCAAAGG - Intronic
1088389648 11:109300066-109300088 TGATACAAATGCTTGGTCACTGG + Intergenic
1089850397 11:121491007-121491029 TTGTGCACATCCTGGATCAAGGG - Intronic
1090701111 11:129296449-129296471 GTATGCAAGTGCTTCCTCAAAGG + Intergenic
1096663739 12:53148361-53148383 TAATGCTAATGCTAAATCAAGGG + Intergenic
1097979461 12:65722837-65722859 TTATGAAAAAGCTTGAAAAATGG + Intergenic
1099115042 12:78613577-78613599 TAATCCAAATGTTTGATAAATGG - Intergenic
1099834621 12:87893884-87893906 AAATGAAATTGCTTGATCAAAGG - Intergenic
1100411074 12:94320572-94320594 ATAAGCAAATGCTTGTTAAATGG - Intronic
1101019647 12:100540585-100540607 TGATGTAAATGTTTTATCAATGG + Intronic
1101382183 12:104223706-104223728 TTTTCCCAGTGCTTGATCAAGGG - Intronic
1107216803 13:37931049-37931071 TTATGCAGCTTCTTGATAAAAGG + Intergenic
1107752974 13:43589016-43589038 TCATGCAAATGTTTTATGAAAGG - Intronic
1107847439 13:44531349-44531371 ATATGCAAATGCATTATCAATGG + Intronic
1108070312 13:46622127-46622149 TTATACAAATGTTTTATCACAGG - Intronic
1109794566 13:67293154-67293176 TTATGTATATGTTTGATCTATGG - Intergenic
1109845523 13:67985249-67985271 TGATGGAAATGCTTGACCAGAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112862657 13:103851664-103851686 TTATTCAAATGCATGATTAGAGG - Intergenic
1114653592 14:24302453-24302475 TTCTGCTAATTCTTGATCACTGG + Intronic
1114995573 14:28347725-28347747 TTATGGGAATGATTTATCAAAGG - Intergenic
1115195502 14:30794373-30794395 TTCTGCATATGCTTTATAAATGG - Intergenic
1116492343 14:45519791-45519813 ATATGCAAAGGCCTGATGAATGG - Intergenic
1118649644 14:67876854-67876876 ATATGCAAATGATTCATCCAGGG + Intronic
1121059536 14:90892815-90892837 TTATGAAAATGTTAGTTCAAAGG + Intronic
1121144409 14:91571634-91571656 TTATTCAAATACATCATCAAAGG + Intergenic
1124003992 15:25781755-25781777 CTATGCATTTGCTTGTTCAATGG - Intronic
1126188597 15:45855312-45855334 TTCTGCAAATGCTGGGGCAATGG + Intergenic
1127307211 15:57719128-57719150 ATATACAGATGCTTGATCTATGG - Intronic
1138092401 16:54186527-54186549 TTTGGCAAATGCTAGTTCAAAGG - Intergenic
1139207332 16:65042060-65042082 TTAGGCAAATGCTTAATAATTGG + Intronic
1140265109 16:73413716-73413738 GTATGCAAATACTTGTTCAGTGG - Intergenic
1143869383 17:9947237-9947259 TTGTGCAATTGCTGGGTCAAAGG - Intronic
1146092527 17:29894233-29894255 TTATGCAAAGGCTCAATAAATGG + Intronic
1146660459 17:34662214-34662236 TGAAGCAAATGCTTCATTAAGGG - Intergenic
1147362504 17:39940266-39940288 TTCTGAAACTGCTTGTTCAAAGG + Intergenic
1147542029 17:41368395-41368417 TTTTGCAAAGGCATGAACAAGGG - Intronic
1148197423 17:45724238-45724260 TTTTTCAAATGCATGCTCAAGGG - Intergenic
1149044407 17:52227609-52227631 TTATGAAAAAGCTTGCTCATGGG + Intergenic
1150040302 17:61853020-61853042 TTATGAACATTCTTGTTCAAAGG - Intronic
1153571252 18:6475672-6475694 TTTTGAGAGTGCTTGATCAAGGG - Intergenic
1155547882 18:26933570-26933592 TTAAGCAAAATCTTGATCATGGG - Intronic
1155701696 18:28752286-28752308 TTATGCACATGATTGAATAAAGG + Intergenic
1156518427 18:37700579-37700601 TTTAGCAGATGCTTGAGCAATGG - Intergenic
1156584264 18:38414300-38414322 ATATGCAAAGGCTGCATCAATGG - Intergenic
1156933074 18:42668861-42668883 TTCAGGAAATGCTTGATAAAAGG - Intergenic
1158110457 18:53935081-53935103 TTTTGCAAATGGCTGCTCAAAGG - Intergenic
1158891561 18:61876849-61876871 TTATGCAAATGCTTTATATGGGG + Intronic
1159700426 18:71619713-71619735 TTCTGCAAAAAATTGATCAAGGG - Intergenic
926327129 2:11795094-11795116 TTATGCAAATGCTTGATCAAGGG - Intronic
926861157 2:17310329-17310351 TTGTACAAAGGCTTCATCAACGG + Intergenic
928957527 2:36886018-36886040 TTATGCAAATTGTTTAGCAATGG - Intronic
929706833 2:44222461-44222483 TTGTGCAACTACTTGATCAGTGG - Intronic
931536637 2:63284892-63284914 ATGTGCAAATGCTTGTTCTAGGG - Intronic
936371570 2:111906196-111906218 TTATGCAAATGCTTTCTGACAGG + Intronic
937623285 2:124014685-124014707 TTATGCAAATGGTTCAAAAATGG + Intergenic
938992835 2:136647012-136647034 TGAAGCAAATGCTTTATCCAAGG + Intergenic
939211061 2:139175354-139175376 ACATGAAAATGCTTGATTAAAGG - Intergenic
941055532 2:160783700-160783722 TCATGAAGATGCTGGATCAAGGG + Intergenic
941153351 2:161942226-161942248 CTATGAAAATGCTTTATGAAGGG + Intronic
941735552 2:168971513-168971535 TTAGACAAATGCTTAATAAAAGG + Intronic
942480505 2:176382736-176382758 TTAAACAAATGCTTAATCAGAGG + Intergenic
944258294 2:197647681-197647703 TTATGTAAATGCTTGAGTAAAGG + Intronic
1170471032 20:16668511-16668533 TTTTGCAAATGCTTCATGAATGG + Intergenic
1171509989 20:25674405-25674427 TTATGAAAAGGCTTGATAGAGGG - Exonic
1172351944 20:34249951-34249973 TTTTCCAAAAGCCTGATCAAAGG + Intronic
1177593623 21:23206927-23206949 TTATGAAAGAGCTTGATGAAGGG - Intergenic
1177832030 21:26149791-26149813 TTTTATAAATGATTGATCAATGG + Intronic
1177916283 21:27091774-27091796 TTATGAAAATATTTGATTAAAGG - Intergenic
1184314839 22:43678053-43678075 TAATGCAAATGCTTGACCCTGGG - Exonic
1185026960 22:48420047-48420069 CTAAACAAATGCTTGATCCATGG + Intergenic
949667738 3:6360337-6360359 TTATGCAAATCTTTTATCATTGG + Intergenic
951296219 3:20938581-20938603 TTATCCAAATACATGTTCAATGG - Intergenic
952522579 3:34176019-34176041 ATATGCATATGTTTGAGCAAAGG + Intergenic
952662164 3:35865008-35865030 TTAAGACAATGCTTGATCATGGG + Intergenic
952877577 3:37959738-37959760 TTGTGGAAATGCTAGGTCAAAGG + Intronic
952926190 3:38321337-38321359 TTAGGCCAATGCTTGAACAGTGG - Intergenic
958178375 3:90025160-90025182 TTATGTAAATACATAATCAAAGG + Intergenic
958930870 3:100206695-100206717 TTAAATAAATGCTTGATAAAGGG - Intergenic
959517392 3:107284492-107284514 TTATTCTAATGCTTTAGCAAAGG + Intergenic
960549387 3:118957107-118957129 CTATGCAAATCCTTGTCCAAGGG + Intronic
960734533 3:120764058-120764080 TCATGCAAATGTTTGGACAAGGG - Intronic
965564179 3:170094000-170094022 TAATGCAAAAGCTTGAGCATGGG - Exonic
966131700 3:176648323-176648345 TTATGTAAATGGTTGATGGATGG + Intergenic
970920063 4:21383702-21383724 TTATGCAAATGCCTATTCATTGG + Intronic
971028355 4:22610297-22610319 TTAAGCAAAATCTTGATCATGGG - Intergenic
971870243 4:32226314-32226336 TCATTCAAATGCCTGGTCAATGG - Intergenic
972541922 4:40046713-40046735 TTCTGTAAATGCTTGTTAAAAGG - Intergenic
974361053 4:60879959-60879981 TCATACAAATGCTAGAGCAAAGG - Intergenic
975144846 4:70955782-70955804 TTATGCAAAATTTTGATAAAGGG + Intronic
978709636 4:111763973-111763995 TTATAAAAATGCTAGATAAAGGG + Intergenic
979615944 4:122742922-122742944 TTCTGCAATTCCTTGATCACAGG - Exonic
979650822 4:123129023-123129045 TTAAGCAAATACTTTAACAAAGG - Intronic
981772607 4:148327639-148327661 TAGTGCATATGCTTGAACAAAGG + Intronic
983467541 4:168113565-168113587 TTATACAAGGGCTTGATGAAAGG - Intronic
987701821 5:21409721-21409743 TCATGCACATGGATGATCAAAGG + Intergenic
991923391 5:71680066-71680088 ATATGCAAAGGCTTGAAAAAGGG - Intergenic
996611797 5:125391378-125391400 TTATACAAATGCATGAACACTGG - Intergenic
999935666 5:156483264-156483286 TAAGGCAAGTGCTTGATCATGGG - Intronic
1001110773 5:168894390-168894412 TTATGCCATTGCTTGGTCCATGG + Intronic
1001479791 5:172080617-172080639 TTATGCCAAAGCCTGATCCAGGG + Intronic
1004009534 6:11668990-11669012 TCATGCACATGGATGATCAAAGG + Intergenic
1004726080 6:18312527-18312549 TTATGCAAATTCCTTATCATTGG + Intergenic
1004943102 6:20581962-20581984 TTATACATATGCTTTATAAAGGG - Intronic
1005187497 6:23179724-23179746 TTATCCAAATGTCTAATCAAGGG + Intergenic
1006968550 6:38015457-38015479 TTCTGGAAATGCTTGTTCAAAGG + Intronic
1008157276 6:48031695-48031717 TTGGGGAAATGCTTCATCAATGG - Intronic
1013984330 6:116171791-116171813 TTATGCAAATGGTTGTACCAAGG - Intronic
1015202235 6:130595862-130595884 GTATGTAAATGTTTGAACAAAGG + Intergenic
1016780984 6:147958095-147958117 TTGTGCAAATGCTGCATCACTGG - Intergenic
1017588296 6:155950606-155950628 TTATGGAAATGTTTGATCATAGG - Intergenic
1020691203 7:11356650-11356672 ATATGTGACTGCTTGATCAATGG - Intergenic
1024874207 7:54003291-54003313 TTATTCAAATGATTAATAAAAGG - Intergenic
1025309054 7:57904118-57904140 TTTTGCAACTGCTCAATCAAAGG + Intergenic
1027463816 7:78489297-78489319 TTATTTAAATGCTTGATTCAAGG + Intronic
1030975113 7:116112337-116112359 CTATGAAAATGTTTGAACAAAGG - Intronic
1032692522 7:134303164-134303186 TTATGGAAATTCCTGCTCAATGG + Intronic
1035540979 8:437966-437988 TTTTTAAAATGCTTGATAAAAGG + Intronic
1039124453 8:34185498-34185520 TTATGCAAATGATAAAACAAAGG - Intergenic
1041228966 8:55730194-55730216 TTAGGCATATACTTGATCATGGG - Intronic
1041467390 8:58170370-58170392 TGATGTAAATGCTTGATAAATGG - Intronic
1042031077 8:64476214-64476236 TTAAACAAATGCTTCTTCAAAGG + Intergenic
1042253845 8:66783443-66783465 TTTTGCAAATGCTACACCAAAGG - Intronic
1042807892 8:72791663-72791685 TGATGAAGATGCTTCATCAAAGG - Intronic
1045277332 8:100720703-100720725 TTAGAGAAATGCTTGATCTAGGG + Intronic
1048366679 8:133744518-133744540 TTATGCAGCTCCTTGATCAGGGG - Intergenic
1050108285 9:2188491-2188513 GTATTCAAATGCTAGAACAAAGG - Intronic
1050613158 9:7373947-7373969 TTATGCTATTTCTTGATTAAGGG + Intergenic
1051966486 9:22834965-22834987 ATTTGCAAATACTTGATCAGGGG - Intergenic
1052456858 9:28710567-28710589 TTGTGCAAATACTTGTTCAGGGG + Intergenic
1052605515 9:30693669-30693691 TTATACAAATGTTTCAACAAAGG + Intergenic
1186583707 X:10849016-10849038 TTATGCAAATCTTTGTTGAAGGG + Intergenic
1188570493 X:31579724-31579746 TTATTCAAAAGATTGAACAATGG + Intronic
1190516330 X:51227226-51227248 TTATGCAAGTGCTTAATGAGTGG - Intergenic
1193402300 X:81059944-81059966 TTATGAAAATACTTGATTGAAGG + Intergenic
1194773955 X:97939847-97939869 AAATGCAAATGCTTCCTCAAAGG - Intergenic
1195569979 X:106387566-106387588 TTATGCAAATGATTTATGTAAGG + Intergenic
1195719824 X:107856350-107856372 TCATGCAAATTCTAAATCAAGGG - Intronic
1195738746 X:108040529-108040551 AAATGGAATTGCTTGATCAAAGG - Intergenic
1198538852 X:137614769-137614791 TTCTTCAAATGTTTGATGAAAGG - Intergenic
1199326356 X:146502920-146502942 TTTTGAAAGTGCTTGATCAAGGG + Intergenic
1199930308 X:152511620-152511642 TTAAGCAATTGATTGATGAAGGG + Intergenic
1201917108 Y:19193909-19193931 TCATGCAATTTCTGGATCAAGGG - Intergenic