ID: 926328125

View in Genome Browser
Species Human (GRCh38)
Location 2:11802993-11803015
Sequence TCAGCTACAAGAAGACTCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926328121_926328125 -3 Left 926328121 2:11802973-11802995 CCTCCCTCTTCTGCCTAATGTCA 0: 1
1: 0
2: 2
3: 27
4: 226
Right 926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 130
926328118_926328125 19 Left 926328118 2:11802951-11802973 CCAAGCCATCAAACGCAGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 130
926328119_926328125 14 Left 926328119 2:11802956-11802978 CCATCAAACGCAGGCCACCTCCC 0: 1
1: 0
2: 0
3: 14
4: 138
Right 926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 130
926328123_926328125 -7 Left 926328123 2:11802977-11802999 CCTCTTCTGCCTAATGTCAGCTA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 130
926328122_926328125 -6 Left 926328122 2:11802976-11802998 CCCTCTTCTGCCTAATGTCAGCT 0: 1
1: 0
2: 3
3: 20
4: 232
Right 926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 130
926328120_926328125 0 Left 926328120 2:11802970-11802992 CCACCTCCCTCTTCTGCCTAATG 0: 1
1: 0
2: 1
3: 49
4: 547
Right 926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926328125 Original CRISPR TCAGCTACAAGAAGACTCTC CGG Exonic
904994377 1:34619635-34619657 TAGGTTACAAAAAGACTCTCTGG - Intergenic
912951110 1:114121115-114121137 TGAGATCCCAGAAGACTCTCTGG - Intronic
923121309 1:230994436-230994458 TCAGCTACAAGAATGTACTCAGG - Intronic
924133364 1:240936282-240936304 TCAGACAGAGGAAGACTCTCCGG + Intronic
924456940 1:244226389-244226411 TTAGGTACTAAAAGACTCTCTGG - Intergenic
924920102 1:248619959-248619981 TGGGCTACAAGAGGACTCTAAGG - Intergenic
1065283359 10:24163544-24163566 TAAGCTTCAAGAAAACTCTAGGG - Intronic
1066428225 10:35328516-35328538 TAAGCAACAAGAAGACTCTGTGG + Intronic
1070476546 10:76834756-76834778 TCAGCTTTAAGCAGACTATCGGG + Intergenic
1073567547 10:104548039-104548061 TCAGCTCCAAGAAGACACTGAGG + Intergenic
1073790089 10:106931149-106931171 TCTTCTCCTAGAAGACTCTCAGG + Intronic
1073876875 10:107934438-107934460 TCAACTCCAAGAAGAATCTCTGG - Intergenic
1075345077 10:121676081-121676103 TCAGCTCCAAGAAAGCTGTCTGG - Intergenic
1075554750 10:123422235-123422257 TCATCTACAATAAGACCCTGTGG - Intergenic
1084923657 11:72493784-72493806 TCAGCTGAAAGAAGTCCCTCAGG - Intergenic
1085529857 11:77184745-77184767 TCAGCCACCAAAAGACTTTCAGG - Intronic
1088623149 11:111707555-111707577 TCAGCATCCAGAAGGCTCTCAGG - Intronic
1089689043 11:120175135-120175157 CCAGCTGCAAGAAGACTCAAGGG + Intronic
1090096800 11:123750258-123750280 TGAATTACAAGAAGACTTTCAGG - Intergenic
1091102643 11:132889446-132889468 TCAGCTACAACATGACTATGTGG - Intronic
1091618467 12:2067554-2067576 TCAGCACCCAGAAGACCCTCTGG - Intronic
1092507939 12:9124164-9124186 TCAGAGACAAGAGGATTCTCGGG + Intergenic
1094227398 12:28061213-28061235 TCACCTGGAAGAAGACTCTGTGG - Intergenic
1094777994 12:33754331-33754353 TCAATTAAAAGAAGACTCTATGG + Intergenic
1095054322 12:37581898-37581920 TCAGCCCAAAGAAGACTCTGCGG - Intergenic
1095801298 12:46271879-46271901 GGGGCTACAAGAAAACTCTCAGG - Intergenic
1097185334 12:57193572-57193594 GCCGCTGCAAGAAGACTTTCCGG + Exonic
1098352147 12:69574146-69574168 TCAGGTTCAAGAAGAATCTGAGG - Exonic
1100199194 12:92280287-92280309 TGATCTACAATCAGACTCTCTGG + Intergenic
1100869018 12:98891005-98891027 TAAGCCACAAGAACATTCTCTGG - Intronic
1103178308 12:118884484-118884506 TCAGCAACAAGAACAGTTTCAGG + Intergenic
1105859476 13:24396066-24396088 TCAGCTCCAAGATGTCTGTCTGG - Intergenic
1106561561 13:30851105-30851127 TCAGCTACAAGAAGAGTGCCTGG + Intergenic
1108389370 13:49933262-49933284 TCAACTACAATCAGAATCTCAGG + Intronic
1110163240 13:72405030-72405052 TCAGCTTCAAGAAGAATCAATGG - Intergenic
1112974806 13:105304221-105304243 TCAGCTACAAGAAAACCCATTGG + Intergenic
1113017037 13:105839038-105839060 TCAGCTAACTGAAGATTCTCAGG + Intergenic
1113236148 13:108277518-108277540 TCAGATCCAAGAACCCTCTCCGG - Intronic
1113684354 13:112271878-112271900 TCAGCTGCAAGAAGACTTGGAGG + Intergenic
1114330859 14:21635513-21635535 TCACCTTCAAGAAGGCTTTCCGG + Intergenic
1118152025 14:63199906-63199928 TCAGCAACCAGCAGGCTCTCAGG + Intergenic
1119784553 14:77302727-77302749 TCAGCTTCAAGACAAGTCTCTGG + Intronic
1127702429 15:61514303-61514325 TCTTCCTCAAGAAGACTCTCTGG - Intergenic
1128625208 15:69194380-69194402 CCAGCTGCAAGAACACTCTAAGG - Intronic
1129525001 15:76208240-76208262 GCAACTACCAGAAGACTCTGTGG - Intronic
1137867279 16:51913379-51913401 TCAGCTACAAGAAGAAACTGAGG - Intergenic
1140237641 16:73173454-73173476 TCAGGCACAAGCAGACTCCCTGG - Intergenic
1140874794 16:79140826-79140848 TGAGTGACAAGAAGACTCTCCGG - Intronic
1143248549 17:5505270-5505292 TGAGCTCCCAGAAGCCTCTCAGG - Intronic
1144129168 17:12229263-12229285 TGAGCTGTAGGAAGACTCTCAGG - Intergenic
1144797403 17:17901558-17901580 TCAGCTTCAGGACTACTCTCTGG + Intronic
1146842202 17:36163930-36163952 TCAGCTCCCAGTAGACGCTCTGG + Intergenic
1146854511 17:36251889-36251911 TCAGCTCCCAGTAGACACTCTGG + Intronic
1146866108 17:36336487-36336509 TCAGCTCCCAGTAGACGCTCTGG - Intronic
1146870413 17:36375781-36375803 TCAGCTCCCAGTAGACGCTCTGG + Intronic
1146877769 17:36426862-36426884 TCAGCTCCCAGTAGACGCTCTGG + Intronic
1147068977 17:37937099-37937121 TCAGCTCCCAGTAGACGCTCTGG - Intergenic
1147073295 17:37976405-37976427 TCAGCTCCCAGTAGACGCTCTGG + Intergenic
1147080502 17:38016636-38016658 TCAGCTCCCAGTAGACGCTCTGG - Intronic
1147084816 17:38055943-38055965 TCAGCTCCCAGTAGACGCTCTGG + Intronic
1147096448 17:38140596-38140618 TCAGCTCCCAGTAGACGCTCTGG - Intergenic
1147100764 17:38179909-38179931 TCAGCTCCCAGTAGACGCTCTGG + Intergenic
1149845353 17:60006373-60006395 TCAGCTCCCAGTAGACGCTCTGG + Intergenic
1150083697 17:62262956-62262978 TCAGCTCCCAGTAGACACTCTGG + Intergenic
1154999419 18:21672132-21672154 TCTGGTACAAGAAAACTGTCAGG - Intronic
1159291942 18:66434556-66434578 TCACCTACAGGAAGACTTTGAGG - Intergenic
1164033495 19:21432799-21432821 TCAGCTAAAGGAAGAGACTCTGG + Intronic
1168725544 19:58579699-58579721 TCAGCTTCATGAAGGCTCTGTGG - Intergenic
926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG + Exonic
927018931 2:18997603-18997625 TCAGCTACAAGAGCACTAGCTGG + Intergenic
927923180 2:26989707-26989729 TCTGCTGCCAGGAGACTCTCCGG + Intronic
933286777 2:80393357-80393379 TCATCTCCAAGAAGACACCCTGG - Intronic
936056564 2:109266402-109266424 TCCGATACAACAAGACTCGCAGG + Intronic
936379557 2:111972361-111972383 TGAGCTTCAGGGAGACTCTCAGG + Intronic
937887689 2:126911282-126911304 CCAGCTGCTAGAAGACTCACTGG + Intergenic
941024404 2:160442635-160442657 TCAGATATAAAAAGACTCTTAGG + Intronic
943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG + Intergenic
946461935 2:219876606-219876628 TGAGATACAAGAAACCTCTCGGG + Intergenic
1169667826 20:8058088-8058110 ACAGCTGCAAGGAGACTCTGAGG + Intergenic
1173345485 20:42195559-42195581 ACAGCTACAAAAACACTCTCAGG - Intronic
1173802338 20:45902302-45902324 TCAGCGCCAAGATGGCTCTCCGG - Exonic
1174758264 20:53181326-53181348 CCAGCTCCAAGAAGAGTGTCTGG + Intronic
1177335471 21:19719944-19719966 TCTGCTACTAGTAGACTCTATGG - Intergenic
1178113128 21:29389697-29389719 TCAATTACTAGAAGACTCTGAGG - Intronic
1181457199 22:23066608-23066630 TCAGCTAAAAGAAGAGTCTCGGG + Intronic
1184369379 22:44072911-44072933 TCAGCTCCAGGAAGCCTCTCTGG + Intronic
1184659395 22:45958934-45958956 CCAGCTGCAAGGAGTCTCTCAGG + Intronic
949746046 3:7293272-7293294 TTAGCAACAAGAAGAATCTCAGG - Intronic
950693299 3:14677990-14678012 TCAGCTACAAGATCAAGCTCAGG + Intronic
958000552 3:87743516-87743538 TCAGCTACATGAGGACTCATTGG - Intergenic
960527659 3:118728409-118728431 AGAGCTACTTGAAGACTCTCAGG + Intergenic
961909982 3:130304363-130304385 TCAGCACCAAGAAGACAGTCAGG - Intergenic
963628257 3:147701099-147701121 TCAGCTTCAGGGAGAGTCTCAGG + Intergenic
971428382 4:26538314-26538336 TGAGCTACAAGTAGACTGACAGG + Intergenic
971903496 4:32695108-32695130 TTAGCTTAAAGAAGACTATCTGG - Intergenic
976109999 4:81662348-81662370 TAAGCAACAGAAAGACTCTCAGG + Intronic
977615599 4:99084708-99084730 TGAGGTACAAGAACCCTCTCTGG + Intronic
978358481 4:107903229-107903251 TCAGCTCAATGGAGACTCTCAGG + Exonic
981441440 4:144787517-144787539 TCTGTTTCAAGAGGACTCTCTGG + Intergenic
986235966 5:5910441-5910463 TCAGCTTCAAGAAGGCTATTTGG + Intergenic
988705366 5:33721236-33721258 CAAGCTCCCAGAAGACTCTCCGG - Intronic
1000233019 5:159332778-159332800 TGAGCTACGAAAAGACTTTCTGG - Intergenic
1001021599 5:168187539-168187561 GCAGCCACAAGAAGCTTCTCAGG - Intronic
1001477899 5:172064126-172064148 ACAGCTACAGGAAGCCTCGCTGG + Intronic
1002295018 5:178225511-178225533 CCAGCAGCAAGAAGATTCTCAGG + Intronic
1003294058 6:4808063-4808085 TCAGCTACCACAGGACACTCAGG + Intronic
1003954803 6:11151893-11151915 TAAGCAACAAGAATCCTCTCTGG + Intergenic
1004594512 6:17086483-17086505 TCACCTACAAGAATAATCTTAGG - Intergenic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1007261006 6:40563092-40563114 TCAGCTTCAAGTCAACTCTCAGG - Intronic
1008816856 6:55578999-55579021 TCAGCTACCAGCAGCTTCTCCGG - Exonic
1018411840 6:163557283-163557305 TGAGGTACAAGGAGACTTTCTGG + Intronic
1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG + Intergenic
1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG + Intergenic
1024780456 7:52842053-52842075 TCAGGGACAGGAGGACTCTCAGG - Intergenic
1034044029 7:147908515-147908537 TCAGCTTCAAGAAGGGGCTCTGG - Intronic
1036586353 8:10127597-10127619 TAAGCTACAGGAAGGATCTCTGG - Intronic
1039104497 8:33975433-33975455 TCAGCTCCATGAGGACTGTCGGG - Intergenic
1039136379 8:34327956-34327978 TCAATTCCAAGAAGACTCTGTGG + Intergenic
1041780751 8:61576128-61576150 GCAGCTACAAGAGGTCTCACAGG - Intronic
1041963917 8:63651853-63651875 TCTGCTATAAGAATACTATCAGG + Intergenic
1044389708 8:91635469-91635491 TAAGCTACAAAAAGCCTCTGTGG + Intergenic
1044569190 8:93699375-93699397 TCTGCTTCAAGAAACCTCTCTGG - Intronic
1052939515 9:34121490-34121512 TCTGCTACAAGAACAGTCCCTGG + Intronic
1056161764 9:83903290-83903312 TCAGCTTCAAGGAGAATGTCTGG - Exonic
1056623730 9:88236892-88236914 CCAGATACAAAAATACTCTCAGG + Intergenic
1058378828 9:104356663-104356685 TCTGCTTCACGAAGTCTCTCGGG + Intergenic
1059492570 9:114681392-114681414 TCAGTTACAAGCACATTCTCTGG + Intergenic
1059670060 9:116483030-116483052 GCAGCTACAAGAAGGGTGTCTGG + Intronic
1187787281 X:22905912-22905934 TCAGTTTCTAGAGGACTCTCAGG + Intergenic
1188607445 X:32049463-32049485 TCTGATACAAAAAGGCTCTCTGG + Intronic
1190149910 X:47936802-47936824 GAAGCTAAAAGCAGACTCTCCGG + Intronic
1194316850 X:92387755-92387777 TCACCTGCCAGAAGGCTCTCAGG + Exonic
1194338287 X:92677008-92677030 ACTGCTACAAGAAAACTATCAGG - Intergenic
1196204122 X:112919764-112919786 CAAGGTACAAGAATACTCTCTGG - Intergenic
1198120784 X:133590454-133590476 TCAGAAAGAAGAAGACTCTAAGG + Intronic
1200625022 Y:5501077-5501099 TCACCTGCCAGAAGGCTCTCAGG + Intronic
1200646689 Y:5793791-5793813 ACTGCTACAAGAAAACTATCAGG - Intergenic
1201050965 Y:9934790-9934812 TCAGCCACAAGAAGACTGCTGGG - Intergenic