ID: 926329233

View in Genome Browser
Species Human (GRCh38)
Location 2:11811068-11811090
Sequence CTGGGTCCCACCTGTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926329226_926329233 3 Left 926329226 2:11811042-11811064 CCTTTATCCACTGACACCTCCTA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 926329233 2:11811068-11811090 CTGGGTCCCACCTGTCCTTCTGG 0: 1
1: 0
2: 3
3: 27
4: 291
926329227_926329233 -4 Left 926329227 2:11811049-11811071 CCACTGACACCTCCTATTCCTGG 0: 1
1: 0
2: 4
3: 37
4: 351
Right 926329233 2:11811068-11811090 CTGGGTCCCACCTGTCCTTCTGG 0: 1
1: 0
2: 3
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926329233 Original CRISPR CTGGGTCCCACCTGTCCTTC TGG Intronic
900510830 1:3060310-3060332 CTTGGTCACCCGTGTCCTTCTGG - Intergenic
900632789 1:3645898-3645920 CCGGCTCGCACCTTTCCTTCAGG - Intronic
901218360 1:7567323-7567345 CTGGCCCTCCCCTGTCCTTCAGG - Intronic
901335216 1:8443425-8443447 CTGAGTCTCACCTGTCACTCAGG - Intronic
901674375 1:10874429-10874451 CTGGGTCCCACCTGGCTACCTGG - Intergenic
901763915 1:11488104-11488126 CTGGGTCTCTCCTGGCCTTTGGG + Intronic
904330401 1:29754730-29754752 CTGGGTCTCACCTGTCTTTGAGG - Intergenic
904562252 1:31406752-31406774 CTGGTGCCCACCTGTCTTCCTGG + Intergenic
905208696 1:36358352-36358374 CTTGGTCCCCCCTCTCCTCCAGG + Exonic
905676055 1:39825947-39825969 TTGGCTCCCACCTGTTCTGCAGG - Intergenic
906117790 1:43367486-43367508 CTTGGTCCCTCCTGGCCTGCCGG - Exonic
906152222 1:43594241-43594263 TTGGCTCCCACCCTTCCTTCAGG + Intronic
906152241 1:43594291-43594313 TTGGCTCCCACCCTTCCTTCAGG - Intronic
906537685 1:46560727-46560749 CTGGGTCTCACTTGTCCCTCTGG + Intronic
906556662 1:46719250-46719272 CTGGGTCCCACCTGCCGATTAGG + Intergenic
907311008 1:53538983-53539005 CTGGATCCCACCTGTCCACTTGG - Intronic
908740646 1:67323841-67323863 CTGGTACCCAGCTGTCATTCTGG - Intronic
911413711 1:97543924-97543946 TTGAGTCCCACTTGTCCTTCAGG - Intronic
912576952 1:110680813-110680835 CTGGCTCTGACCTGTCATTCTGG + Intergenic
913109905 1:115648464-115648486 ATGGGTCCCAACTGCCCTCCAGG - Intronic
916053437 1:161051691-161051713 CTGGGCCCCACCAGCCCCTCTGG + Exonic
916248391 1:162710861-162710883 CAGGGTCCTACCTTTCCTGCAGG + Intronic
917284656 1:173411304-173411326 CTGGGTTCCAGCTGTAGTTCTGG + Intergenic
920044275 1:203123493-203123515 CCTGGTCCCACCTACCCTTCAGG - Intronic
920390881 1:205600029-205600051 TTGGGGGCCACCTTTCCTTCTGG - Intronic
920422180 1:205842434-205842456 CTGGTTCCCACTTATCCTTGAGG - Intronic
921304566 1:213782863-213782885 CTGCGTCCCATGTGGCCTTCAGG - Intergenic
922696987 1:227735719-227735741 CTGGGTCCCACCGTTCTCTCCGG - Intronic
922797957 1:228350932-228350954 CTGGGCCCCACCTGATCTGCGGG - Exonic
922803181 1:228373274-228373296 CTGGGTCCCAGCTGCCCTGTGGG - Intronic
923124000 1:231019934-231019956 CTCGGTCCCTCCTGTCGTGCAGG + Exonic
923133657 1:231098711-231098733 CTGGGGGCCACCCGTCCTGCTGG + Intergenic
924718648 1:246602640-246602662 CTGGGTCCAACTTGTACTTATGG + Intronic
1062925432 10:1312704-1312726 CTGGTTCCCACCTGCCCATGCGG - Intronic
1063874745 10:10462323-10462345 CTGGGTCCCGCCCCTTCTTCCGG - Intergenic
1067225230 10:44372013-44372035 CTGCGTGTCACCTGTGCTTCGGG - Intronic
1067756711 10:49011201-49011223 CTGGGCCTCAGCTGTCCTCCAGG + Intergenic
1067849698 10:49746878-49746900 CTGGCTCACACCTGCCCTGCAGG - Exonic
1069548290 10:69344452-69344474 CTGAGACCCACCTGTCCATTAGG - Intronic
1069605046 10:69733569-69733591 CTGGGGCTCATCTCTCCTTCTGG + Intergenic
1069812933 10:71175787-71175809 CTGGGTCCCACCAGGCATACAGG + Intergenic
1070330079 10:75410058-75410080 TAGGGTCCCACCTATCTTTCAGG + Intergenic
1071812421 10:89198162-89198184 CTGGCTCCCTCTTGTCATTCAGG + Intergenic
1072240528 10:93491559-93491581 ATGGCTCCCAGCTGTTCTTCTGG + Intergenic
1072337912 10:94416142-94416164 CTGGGTTTCACCTGTGCTACTGG + Intronic
1074357357 10:112798225-112798247 CTGGGGTCCACCTCTCCTGCTGG - Intronic
1076846831 10:133073290-133073312 CTGGCACCCACTTGTCCTTGAGG - Intronic
1077119423 11:899941-899963 CCGGGTCCCACCTGGCCGTCTGG - Intronic
1077318267 11:1928801-1928823 CTGGGTCTCATCTGTCCCCCCGG - Intronic
1077393825 11:2311617-2311639 CTGGTCCCCACCTGCCGTTCAGG + Intronic
1077607915 11:3624799-3624821 CTGGCTCCCACTCCTCCTTCAGG + Intergenic
1077987290 11:7366047-7366069 CTGTGGCCCAGCTGTCCTCCAGG + Intronic
1078182140 11:9020729-9020751 GTGAGACTCACCTGTCCTTCTGG - Intronic
1078508689 11:11969600-11969622 CTGGGGCCCAGCAGACCTTCTGG + Intronic
1078850334 11:15157593-15157615 CTGGGCTCCACCTCTCCTACTGG - Intronic
1079087562 11:17457652-17457674 CTGGGTCCCAGCTTTCCCTGGGG + Intronic
1079814568 11:25039421-25039443 CTGGGGCCCATCAGTCCTACAGG - Intronic
1080582977 11:33658561-33658583 CTGGGTGCCTCCTGCCCTGCTGG + Intronic
1080678507 11:34450673-34450695 ATAGGTCCTACCTGTACTTCAGG + Intronic
1081439357 11:43063362-43063384 CTGGACCCCACCTGTCCCACTGG + Intergenic
1081794850 11:45812093-45812115 CTGAGTGGCACCTGTCCCTCTGG + Exonic
1082934584 11:58643171-58643193 CATGATCCCAGCTGTCCTTCAGG - Intronic
1083195112 11:61081450-61081472 CTGGGGCCCACGTGTCGTTCTGG + Intergenic
1083614509 11:64019573-64019595 CCGGGTGCCACCTGTGCCTCGGG - Intronic
1084665678 11:70574955-70574977 ATGAGTCCCATCTGTCCTTCAGG + Intronic
1086080792 11:82900742-82900764 CCGAAGCCCACCTGTCCTTCAGG + Intronic
1089173053 11:116528586-116528608 GTGGCTCACACCTGTACTTCCGG + Intergenic
1089285949 11:117408317-117408339 CCTGGTCACACCTGTCCTTAGGG - Intronic
1089733854 11:120536288-120536310 TTGGGCCCAACTTGTCCTTCAGG - Intronic
1090142228 11:124277363-124277385 CTGGAGCACACCTGTCCTGCAGG + Intergenic
1091537381 12:1424595-1424617 CTGGGTCTCTCCTGTCTTCCTGG - Intronic
1091916687 12:4275111-4275133 GGGGCTCCCACCTCTCCTTCAGG - Intronic
1092172544 12:6383188-6383210 CTAACTCCCACCTGTCCTTGAGG - Intronic
1092190391 12:6515494-6515516 CTGAGTCCCATCTGTTCCTCAGG + Intronic
1092580707 12:9837996-9838018 CTGGGACCCACTTGTCTTTTGGG - Intronic
1095403857 12:41845612-41845634 CTTGCTCCCACCTGCCCTTTAGG + Intergenic
1095509145 12:42930272-42930294 CTGCCTCCCACCTGTGCTCCTGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1101299957 12:103469056-103469078 CTGGCTCACACCTGACCTCCTGG + Intronic
1101815620 12:108143900-108143922 ATGGGACCCACCTGTCCTGGAGG - Intronic
1103267014 12:119639123-119639145 CTGGTTCCCATTTCTCCTTCTGG + Intronic
1104664182 12:130635738-130635760 CTGGGCCCCATCTTTCCATCTGG - Intronic
1104954753 12:132458758-132458780 CTGCGTCCCACCTGCCCGTGAGG + Intergenic
1105026306 12:132851568-132851590 CGGGTTCCTATCTGTCCTTCAGG - Intronic
1105246185 13:18652518-18652540 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
1106287928 13:28334406-28334428 CTTGGTCCCATCTCTCCTACGGG - Intronic
1106853119 13:33817021-33817043 TTGGGTCCCTCATTTCCTTCAGG - Intergenic
1108040287 13:46333517-46333539 CAGGTTCACACCTGTGCTTCCGG + Intergenic
1110701323 13:78552165-78552187 CTGGCTCCCTCATCTCCTTCAGG - Intergenic
1112025990 13:95411673-95411695 CTGGCTCCCACCCGCCCTTCTGG + Intergenic
1113566065 13:111320415-111320437 CTGAGTCCCACCTTCCCTGCAGG - Intronic
1113768177 13:112893896-112893918 CGGGGTCCCACCTGCCCCCCTGG - Intergenic
1118616918 14:67580232-67580254 CTGGGTACCACCTGACATCCAGG - Intronic
1120443083 14:84562770-84562792 CTGGGACCCATCAGTCCTGCTGG + Intergenic
1121831234 14:97054072-97054094 CTGGCTCTCTTCTGTCCTTCTGG - Intergenic
1122461184 14:101897055-101897077 CTGGGCCCGCCCTGTCCTGCCGG + Intronic
1123756118 15:23398990-23399012 CTGGATCCCACCTGTCATTCGGG - Intergenic
1124713175 15:32031290-32031312 TTGGGTCCCACCTTTCTCTCAGG + Intronic
1125057151 15:35374850-35374872 CTTGCTACCACCTGTCCCTCTGG + Intronic
1126638687 15:50803683-50803705 CAGGTTGCCACCTGTGCTTCTGG - Intergenic
1127781395 15:62319744-62319766 AGGTGTCCCACCTGTCCATCAGG + Intergenic
1129821525 15:78605372-78605394 GTGGGTCCCACAGGTCCTGCTGG - Intronic
1129942471 15:79510280-79510302 CCAGATCACACCTGTCCTTCGGG + Intergenic
1130661557 15:85834897-85834919 CTGGATCTCATCTGTCCATCTGG + Intergenic
1132563757 16:611085-611107 CTGCGTCCCACCCATCCTGCAGG - Intronic
1132994642 16:2816888-2816910 CTAGGCCCCACCCGGCCTTCAGG + Intergenic
1134460212 16:14423730-14423752 CTGGACCCCACCTCTCATTCGGG + Intergenic
1137280506 16:46973120-46973142 CTCGGTCCAACCTGTTTTTCCGG + Intronic
1137433290 16:48435491-48435513 CTGGGTCCCAGGTTTCCATCAGG - Intronic
1137735363 16:50719599-50719621 CAGGGTCACACCTTTCCCTCTGG - Intronic
1137756422 16:50905992-50906014 CAGGGACCCTCCTGTGCTTCCGG - Intergenic
1137902090 16:52279824-52279846 CTGGGCACCACTGGTCCTTCAGG - Intergenic
1137985762 16:53106453-53106475 CTGCCTTCCAGCTGTCCTTCGGG - Intronic
1138301382 16:55932636-55932658 CTGGCTCCTTCCTATCCTTCAGG - Intronic
1139192459 16:64880299-64880321 CTGGGTCTCAGCAGTCCTGCTGG - Intergenic
1142131340 16:88432919-88432941 CTGGATGCCACCTGGCCTTTTGG + Exonic
1142264783 16:89058650-89058672 CTGGGTCCCTCCTGGCCCACAGG + Intergenic
1143886455 17:10068422-10068444 CTGAGTCCCATGAGTCCTTCTGG - Intronic
1144373534 17:14616343-14616365 CTGGCTCCCACGTGTCCTCAAGG - Intergenic
1144428779 17:15171322-15171344 CTGGGTTCTACTTGTCCCTCTGG - Intergenic
1146464518 17:33075645-33075667 CTGGTTCCCACCAGGCCTTCTGG + Intronic
1146493769 17:33302432-33302454 CTGGCTCTCACCTCTGCTTCAGG + Intronic
1148113685 17:45162231-45162253 CCAGGTCCCAGCTGTGCTTCTGG + Intronic
1148480446 17:47956535-47956557 CTGGTCCCCACATGTCCTCCTGG - Intronic
1150804241 17:68306595-68306617 AAGGGTCTCACCTCTCCTTCTGG + Intronic
1151227670 17:72658719-72658741 CTGGGTCCCACCTGTGCACCTGG - Intronic
1151687131 17:75654385-75654407 CTGGGACACAGCTGTCTTTCCGG + Intronic
1151800502 17:76376712-76376734 CTGGTTCCCAGCTTTCCTTTTGG + Intronic
1151872387 17:76845105-76845127 CTGGGTCCCATGAGCCCTTCTGG - Intergenic
1152025947 17:77809308-77809330 CTGCGGCCCACCTGGCCTTCTGG - Intergenic
1153230502 18:2930895-2930917 CTGGGGCCCAGCTGCCCTTCTGG - Intronic
1153799877 18:8659584-8659606 CTGGAGCCCACCTGGCCTCCGGG - Intergenic
1154442732 18:14407148-14407170 GTGGGGCCCAGCAGTCCTTCAGG - Intergenic
1154937791 18:21078553-21078575 CTGGGACCCATCAGTCCTGCTGG + Intronic
1156349991 18:36295795-36295817 TTCAGTCCCACCTGTCCTTTGGG - Intergenic
1156507499 18:37607654-37607676 CAGGCTCCCACCTGTTCGTCTGG + Intergenic
1157173776 18:45432288-45432310 CTGGGTCCCGCCTGCCCCTGTGG - Intronic
1157615216 18:48983003-48983025 CTGGGTCCCTCCTGGCCTTGAGG + Intergenic
1159439811 18:68463820-68463842 CTGGATCCCTCCTTTACTTCAGG + Intergenic
1159895205 18:73989671-73989693 CAGGGCCCCATCTGTCCTCCTGG + Intergenic
1162754242 19:12847681-12847703 TCGGGTCCCACCTCACCTTCGGG - Exonic
1163271374 19:16256216-16256238 CTGGCTCCCAAGTATCCTTCTGG + Intergenic
1164446343 19:28320562-28320584 CTGGGTCTCTCCTCTCATTCAGG - Intergenic
1164909417 19:31993268-31993290 ATGGCTCCTACCTGTCCTGCAGG + Intergenic
1165120793 19:33557136-33557158 CTAGGTCCCACATGGCCTTTGGG + Intergenic
1165739117 19:38195254-38195276 CTGGGTCACTCTTGTCCTTCAGG + Intronic
1165864766 19:38930201-38930223 CTGGGTACCTCCTGTCCTTTAGG - Intronic
1166125872 19:40715085-40715107 CTGGGGCCCTCCTGTGCTTCCGG + Intronic
1167773862 19:51542312-51542334 CTAGGTCCCAATTGTCCTTCAGG - Intergenic
925100020 2:1236361-1236383 CTGGGGAGCACCTGTCCCTCAGG - Intronic
926329233 2:11811068-11811090 CTGGGTCCCACCTGTCCTTCTGG + Intronic
926750645 2:16196234-16196256 TTGGGTCCCTTCTGTCATTCCGG + Intergenic
927893303 2:26765694-26765716 GTGGGCCCCACCTGTTCCTCTGG + Intronic
929247817 2:39721723-39721745 GTGGATCACACCTGTCATTCCGG + Intergenic
930607459 2:53507320-53507342 CTGGGTCCAGCATGTCCTTCAGG + Intergenic
930608023 2:53512125-53512147 CTGGGTGCAGCATGTCCTTCAGG - Intergenic
931221999 2:60296539-60296561 CTGGGCCCCAACTGACCATCTGG + Intergenic
933720576 2:85395015-85395037 CTGGCCCCCTCCTGTCCTCCTGG - Intronic
933920586 2:87041394-87041416 CTGGGACCCATCAGTCCTGCTGG - Intergenic
933931038 2:87152392-87152414 CTGGGACCCATCAGTCCTGCTGG + Intergenic
934002411 2:87728504-87728526 CTGGGACCCATCAGTCCTGCTGG + Intergenic
935790512 2:106585801-106585823 CTGGGTCACACCCTTCCTTAAGG - Intergenic
936362084 2:111813040-111813062 CTGGGACCCATCAGTCCTGCTGG - Intronic
937661281 2:124432384-124432406 CTGGGTCCCTCCTTTCCCTGGGG + Intronic
938683211 2:133712862-133712884 TGGGGTCCCAGCTGTGCTTCAGG - Intergenic
939101481 2:137899390-137899412 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
940991181 2:160098176-160098198 CTTGGTCCCACCTGCCTTCCAGG - Intergenic
941810229 2:169748271-169748293 CTGCGTCCTTCCTGTCATTCCGG - Intronic
944121540 2:196245937-196245959 CTGGGTCCCACCCCACATTCTGG - Intronic
945320013 2:208410374-208410396 CTGGGGCCCACCCCTCCTACTGG + Intronic
946155697 2:217805182-217805204 CTGGGTCACTCCAGTCCTGCGGG - Intronic
946176379 2:217924224-217924246 CTGTGTCCTTCCTGTCCTTCTGG + Intronic
946178025 2:217933744-217933766 CTGAGCCCCACCCATCCTTCTGG + Intronic
948575972 2:238949953-238949975 CAGGTTGCCAACTGTCCTTCTGG + Intergenic
948623097 2:239249119-239249141 GTTGATCCCACATGTCCTTCAGG - Intronic
1168967276 20:1906484-1906506 CTGGCTCGCTCCTCTCCTTCAGG - Intronic
1169001650 20:2172276-2172298 CTGGTTTCCTCTTGTCCTTCTGG + Intronic
1169422357 20:5470782-5470804 CTGGGACCTTCCTGACCTTCTGG + Intergenic
1170324358 20:15139871-15139893 CTGGGTTGCAGCTGACCTTCTGG + Intronic
1170577514 20:17675604-17675626 CTGGCTCCCTCATCTCCTTCAGG - Intronic
1171556067 20:26083445-26083467 CTGGGTCCCAGGTGATCTTCAGG + Intergenic
1172152624 20:32801125-32801147 CTGTGTCCCTGCTGTCATTCAGG + Intronic
1172327091 20:34044688-34044710 TTAGGTCCAATCTGTCCTTCTGG - Intronic
1172504746 20:35453352-35453374 CTGGTACCTTCCTGTCCTTCAGG - Intronic
1173231348 20:41201275-41201297 CTGGCTCTCACCTGAGCTTCTGG + Intronic
1173358058 20:42313795-42313817 CTGCCTTCCACCTGTCCATCTGG - Intronic
1174094614 20:48078370-48078392 CTTGCTCCCTCCTTTCCTTCGGG - Intergenic
1174210609 20:48875232-48875254 CTGCTTCCCACTTGGCCTTCAGG - Intergenic
1175088849 20:56485225-56485247 CTGGCTCCCTCGTGCCCTTCGGG - Intronic
1175175509 20:57109392-57109414 CTGGGACCCTCCAGGCCTTCTGG - Intergenic
1175199995 20:57270361-57270383 CTGGGCCCCAGCTGGCCTGCAGG - Intergenic
1175465455 20:59187766-59187788 CTGGGTACAACGTTTCCTTCTGG - Intergenic
1176262349 20:64188675-64188697 CTGGGGCCCACCTGCCCACCAGG - Intronic
1176453353 21:6884045-6884067 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
1176654714 21:9578151-9578173 CTGGGTCCCAGGTGATCTTCAGG - Intergenic
1176831528 21:13749093-13749115 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
1178339407 21:31773367-31773389 CTGTCTCCCATCTGTCCATCTGG - Intergenic
1178600121 21:33987565-33987587 CAAGGTCCTACCTGTCCTGCAGG - Intergenic
1179268313 21:39825579-39825601 CTTCTTCCCACCTGTGCTTCAGG + Intergenic
1179422972 21:41250780-41250802 CTGGGTCCCAGCTGGCGTGCTGG + Exonic
1179730680 21:43365666-43365688 CTGGGTCTGACCTGTCCTTGGGG + Intergenic
1180875529 22:19173471-19173493 CTGGGGCGCACCTGCCCTTAAGG - Intergenic
1180938393 22:19641173-19641195 CTGGCTCCCTCCTTCCCTTCGGG + Intergenic
1181522395 22:23457097-23457119 CTGGGGCTCACCTGCCCCTCTGG - Intergenic
1184524911 22:45016479-45016501 CTGGGACCCACCTGCCCTGTGGG + Intergenic
1185275245 22:49947860-49947882 CAGGCTCCCTCCTGTCCTCCGGG + Intergenic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
951010567 3:17673333-17673355 CAGGGTCTCACCTGTCACTCAGG + Intronic
951301977 3:21009493-21009515 CTCTGTCCCACCTGGCCTACAGG - Intergenic
952233497 3:31455622-31455644 CTGGGTCCCACTCCTCTTTCTGG - Intergenic
954700065 3:52446316-52446338 CTGGGACCCTCCTTTGCTTCTGG + Intergenic
954735626 3:52705077-52705099 CTGGGTCCCAGCTGGCTCTCCGG - Intronic
961830813 3:129622145-129622167 CTGGATTCCACCTCGCCTTCCGG - Intergenic
962401013 3:135058698-135058720 CTGGGCCCCAGCTGTACTGCAGG - Intronic
962759100 3:138492574-138492596 CTGGGTGCCCACTGCCCTTCAGG - Intergenic
962772943 3:138630066-138630088 CTGGGACCCACCTTTCATGCTGG + Intronic
965796874 3:172448900-172448922 CCGGGTGTGACCTGTCCTTCCGG - Intergenic
968973796 4:3810688-3810710 CAGGGTCCCAGCTCTGCTTCAGG - Intergenic
969414579 4:7050234-7050256 GTGGTTCCCTCCTGTCCTTTAGG + Intronic
969549711 4:7856646-7856668 CTACGTCCCACCTGGCCTTCAGG + Intronic
969566601 4:7982315-7982337 CTGGGTGTCCCCTTTCCTTCAGG + Intronic
969618982 4:8269629-8269651 CAGGGCCCCGCCTGGCCTTCCGG - Intergenic
973066692 4:45804300-45804322 ATGGGTCACACCGGGCCTTCTGG - Intergenic
973970255 4:56206277-56206299 CTGGGTCCCAGATGTCCTTATGG - Intronic
974080467 4:57206987-57207009 CTGGGTCCTTCCTCTGCTTCAGG - Intergenic
975494555 4:75023811-75023833 CTGGGTCCCATCTGCCCCTGAGG + Intronic
976146047 4:82043895-82043917 CTGGTTTCCACCTGGCCATCGGG - Intronic
979990217 4:127366646-127366668 GAGGGTCCCACCTGTCACTCTGG - Intergenic
980981406 4:139657475-139657497 CTGGTTCTCACCTTTGCTTCTGG - Intergenic
981434744 4:144707313-144707335 CTGGTGCCCACCTTTTCTTCTGG - Intronic
982255046 4:153443455-153443477 CTGGCCCCAACCTGTCCTCCAGG - Intergenic
984141008 4:176003687-176003709 CTGGCTCACACTTGTACTTCTGG + Intergenic
985111240 4:186547578-186547600 CTGGATTCCACGTGTCCTCCTGG + Intronic
985879168 5:2625496-2625518 CTGGGTCCCTCCTCTGCCTCAGG - Intergenic
988616671 5:32781721-32781743 CTGGGTCTCATCTGTATTTCTGG + Intronic
995402868 5:111761254-111761276 ATGGATCCCACCTCTCCTTCTGG + Intronic
996749583 5:126875246-126875268 CTGGGGCCCAGGTGTGCTTCTGG + Intronic
997370371 5:133356025-133356047 CTGGGTCCCAGGGGGCCTTCTGG + Intronic
997838432 5:137216150-137216172 CTGAGTCCCTCCTGTCATTTAGG - Intronic
998194991 5:140061065-140061087 CTGGCTCCCTCTTGTCATTCAGG + Intergenic
998470904 5:142382968-142382990 CTGGCTCTCTGCTGTCCTTCCGG - Intergenic
998601553 5:143590564-143590586 CTGGGTCTCACCTGTCACCCAGG + Intergenic
999266158 5:150268270-150268292 CTGGGTCCGGCCTCACCTTCCGG + Intronic
1000303702 5:159977187-159977209 CTGGGTTCCATGTGTCCTTTGGG - Intergenic
1001035224 5:168292260-168292282 CAGGGTCCTACCTGTCCCGCGGG - Exonic
1001981838 5:176043537-176043559 CTGGGGCCCAGGTGTCCTTCAGG + Intergenic
1002184994 5:177450260-177450282 CTGGGTCACACCTGGACTTGAGG - Intronic
1002235625 5:177800520-177800542 CTGGGGCCCAGGTGTCCTTCAGG - Intergenic
1003632750 6:7802831-7802853 CTGGGGCCCATCTGGCCTTCTGG + Intronic
1006332883 6:33405040-33405062 CCGGGTCCGCCCTGTCCTGCCGG + Exonic
1006440280 6:34049565-34049587 CTGGGACCCACGTGGCCTTGTGG - Intronic
1006673226 6:35743035-35743057 CTGACTCCAACCTGTCCTGCGGG + Intronic
1008441868 6:51540824-51540846 CTGGGTGTCACATGTCCCTCCGG - Intergenic
1008460634 6:51765528-51765550 CTGGTTCCCACCCATCCTTCAGG + Intronic
1008639248 6:53444508-53444530 CTGGGTTCCACCTCCTCTTCTGG - Intergenic
1009437807 6:63636923-63636945 CTGTGTCCCTCCTTTCCCTCAGG + Intronic
1009937614 6:70252139-70252161 CGGGGTCCCACCTCTCCTGGAGG + Exonic
1010356516 6:74940238-74940260 TTGGCTCTCAACTGTCCTTCAGG + Intergenic
1011361180 6:86526726-86526748 CTGGGGCACATCTGTCCTGCAGG - Intergenic
1014005190 6:116409834-116409856 CTGGTTCCTATCTGTCCTTCAGG - Intronic
1015398800 6:132765270-132765292 CTGGGTCCAGCCTGTAGTTCTGG - Intergenic
1015925636 6:138307857-138307879 CTGGGTCCCATGAGTCTTTCTGG - Intronic
1016809365 6:148244727-148244749 CTGGGTCACAGCTGTGCTGCCGG + Intergenic
1017824508 6:158071546-158071568 CAGGGTCACACTTCTCCTTCAGG + Intronic
1017958176 6:159197483-159197505 GTGGGTCCCACGTGACTTTCAGG - Exonic
1018554896 6:165038811-165038833 CTGCCTCCCACCTGTCCCTGTGG - Intergenic
1018872931 6:167796802-167796824 CTGTGTCCCGCCTTTCCTCCTGG + Exonic
1019348945 7:544199-544221 CTGGGCCCCACCTGCCTGTCTGG - Intergenic
1019588934 7:1819465-1819487 CTGGGGCTCACCTGCCCCTCTGG + Intronic
1020154097 7:5707993-5708015 GTGGCTCCCACCTGTCATCCTGG - Intronic
1020445518 7:8262616-8262638 GTGGCTCCCACCTGTCCGCCAGG - Intronic
1020469756 7:8522787-8522809 CTAGGTGCACCCTGTCCTTCTGG + Intronic
1024039083 7:45535565-45535587 CTGGGTTCCACCTGTCCTTTTGG - Intergenic
1024418147 7:49132247-49132269 CTGGGTCCCCTCAGTCCTCCAGG - Intergenic
1025281335 7:57628009-57628031 CTGGGTCCCAGGTGATCTTCAGG - Intergenic
1025303394 7:57837498-57837520 CTGGGTCCCAGGTGATCTTCAGG + Intergenic
1026571593 7:71536256-71536278 CTGGGTCTCACCTTTTCTCCAGG + Intronic
1029274197 7:99394404-99394426 CTGGTTCTCAGCTGTCCTGCAGG - Intronic
1030621815 7:111798261-111798283 CTGGGACCCATCAGTCCTGCTGG - Intronic
1031997955 7:128245253-128245275 CTGGGGAACGCCTGTCCTTCAGG + Intronic
1034978615 7:155461830-155461852 CTGGGCCCCTCCTGTCCTCAGGG + Intronic
1035710290 8:1708592-1708614 CTGGAACCCACTTGTCCTCCTGG - Intergenic
1035911509 8:3571850-3571872 CTGCGTCTCACGTCTCCTTCTGG + Intronic
1037814115 8:22102914-22102936 CTGGCTCAGACCTGCCCTTCCGG - Exonic
1038109446 8:24479326-24479348 CAGTTTCCCACCTGTCCTCCAGG + Intronic
1040079006 8:43269298-43269320 GTGGTTCCCCCCTGTCTTTCAGG + Intergenic
1041236894 8:55812257-55812279 CTGGGTCACGCCTGTACTCCTGG + Intronic
1046321406 8:112581906-112581928 CTGTGTCCCTCATTTCCTTCAGG - Intronic
1047164988 8:122428186-122428208 CTGGGTCTTACCTTTCCATCAGG - Intergenic
1048141897 8:131803011-131803033 CAGGGTCTCACCTGTCCCCCAGG + Intergenic
1048320164 8:133393430-133393452 GTGAGTCCTACCTGTCCTTTGGG - Intergenic
1048551282 8:135435950-135435972 CTTATTCCCACCTGTCTTTCAGG + Intergenic
1048842485 8:138577980-138578002 CTGGCTCCCACGTGTCCTGAGGG - Intergenic
1049213894 8:141399023-141399045 CTGGGTCCCTCCTGTGACTCAGG + Intronic
1049510350 8:143024124-143024146 CTGGAAACCACCTGTCCTTGGGG - Intergenic
1049578617 8:143400853-143400875 CTGGGTCACAGCTGTTCCTCAGG - Intergenic
1049937852 9:516840-516862 CTGGGGGGTACCTGTCCTTCAGG + Intronic
1053313421 9:37033975-37033997 CGCGGTCCTACCTGTCCTGCTGG + Exonic
1055792534 9:79937972-79937994 CTGAGTCCCTTCTGCCCTTCTGG - Intergenic
1056251436 9:84752381-84752403 CTGTGTCTCACCTGCCTTTCTGG - Intronic
1057349517 9:94283616-94283638 CTGCCTCCCACCTGTCCATGAGG + Intronic
1059435812 9:114275657-114275679 CTGGGTCTCCCCTGTCCCCCTGG - Exonic
1060512242 9:124242547-124242569 CTGGGTCCCAGGTGAACTTCAGG + Intergenic
1061402634 9:130376686-130376708 CTGGCTCTCACCTCTGCTTCCGG + Intronic
1061789075 9:133049067-133049089 GTGGGTCCCTCCTGTTCCTCAGG + Intronic
1061855147 9:133437927-133437949 CTGGGGCCTACCTGTCCTATCGG + Intronic
1062177330 9:135171060-135171082 CTGGCTCCTTCCTGTCCTACTGG - Intergenic
1062290332 9:135791568-135791590 CTGGCTCCCAGCTGCCCTCCTGG + Intronic
1062293705 9:135811928-135811950 CTGGGTTCCAGCCGTCCTTGTGG - Intronic
1062347175 9:136120214-136120236 GTGGCTCACACCTGTCATTCCGG + Intergenic
1062361303 9:136189580-136189602 CGGGGTCCCCCCAGTCTTTCAGG - Intergenic
1203515827 Un_GL000213v1:470-492 GTGGGGCCCAGCAGTCCTTCAGG - Intergenic
1203632435 Un_KI270750v1:81609-81631 CTGGGTCCCAGGTGATCTTCAGG - Intergenic
1186334562 X:8572754-8572776 CTGGGTCCCACCTGCACTCAGGG - Intronic
1187233006 X:17440513-17440535 CTGGCTTCCATCTGTCCTTGAGG - Intronic
1191104088 X:56761529-56761551 CGGGTTGCCACCTGTCCATCTGG + Intergenic
1191126765 X:56964103-56964125 TTTGGTTCCACATGTCCTTCAGG - Intergenic
1193000023 X:76553458-76553480 CTGGGACCCATCAGTCTTTCTGG + Intergenic
1196722953 X:118871842-118871864 CTGGGAGCCACGAGTCCTTCTGG - Intergenic
1197758871 X:130014224-130014246 CTGGGAGACACCTGTCCTGCAGG - Exonic
1198448205 X:136739747-136739769 CTGGCTCCCTCATCTCCTTCAGG - Intronic
1198797718 X:140416645-140416667 CTGGCTCCCTCTTTTCCTTCAGG + Intergenic