ID: 926329314

View in Genome Browser
Species Human (GRCh38)
Location 2:11811471-11811493
Sequence CTAAGTTTAGTCAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926329310_926329314 8 Left 926329310 2:11811440-11811462 CCATTAGGTCACTCTCGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 48
Right 926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 318
926329306_926329314 27 Left 926329306 2:11811421-11811443 CCAGCAGCAAACATTTTCCCCAT 0: 1
1: 0
2: 0
3: 31
4: 238
Right 926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 318
926329305_926329314 30 Left 926329305 2:11811418-11811440 CCACCAGCAGCAAACATTTTCCC 0: 1
1: 0
2: 2
3: 22
4: 268
Right 926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 318
926329309_926329314 9 Left 926329309 2:11811439-11811461 CCCATTAGGTCACTCTCGAGCTG 0: 1
1: 0
2: 0
3: 4
4: 35
Right 926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 318
926329308_926329314 10 Left 926329308 2:11811438-11811460 CCCCATTAGGTCACTCTCGAGCT 0: 1
1: 0
2: 1
3: 4
4: 52
Right 926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926329314 Original CRISPR CTAAGTTTAGTCAGGCAAGA AGG Intronic
901159658 1:7165582-7165604 CTAAAATTAGTCAGGCATGGTGG - Intronic
901365306 1:8742689-8742711 CTAAAATTAGCCAGGCATGATGG + Intronic
901495449 1:9618638-9618660 CAAAAATTAGCCAGGCAAGATGG + Intergenic
901991474 1:13117832-13117854 ATAAGTTTAATCAGTGAAGAAGG + Intergenic
903102396 1:21042659-21042681 TTGAGTTTAGTCAGGCAAATGGG - Intronic
903616452 1:24662293-24662315 CAAAGATTAGTTAGGCATGATGG + Intronic
903971202 1:27119981-27120003 CTAAGTTAACTCAGCCAGGAGGG + Intronic
904117490 1:28173496-28173518 CAAAAATTAATCAGGCAAGATGG + Intronic
904223905 1:28998303-28998325 CTATGTTCAGCCAGGCTAGATGG - Intronic
905146543 1:35891715-35891737 CAAAAATTAGTCAGGCAAGGTGG - Intronic
908072807 1:60482279-60482301 CAAAAATTAGTCAGGCAAGGAGG - Intergenic
908282415 1:62554510-62554532 TTGATTTTAGTCAGGCAAAAAGG - Intronic
908623231 1:66009037-66009059 CTAAGTTTTGGCTGTCAAGAAGG - Intronic
910553506 1:88503279-88503301 TTAAATTTATTCAGGAAAGATGG - Intergenic
910583954 1:88858284-88858306 CTAAATTTAGCCAGGCACGATGG - Intronic
910832870 1:91478117-91478139 CAAAATTTAGCCAGGCATGACGG + Intergenic
912842591 1:113052052-113052074 CAAAAATTAGTCAGGCATGATGG + Intergenic
913696300 1:121329056-121329078 CAAAAATTAGCCAGGCAAGATGG + Intronic
914141262 1:144950999-144951021 CAAAAATTAGCCAGGCAAGATGG - Intronic
914646069 1:149653673-149653695 CTAAAATTAGTCAGGCATGGTGG - Intergenic
915423187 1:155801728-155801750 CAAAGATTAGCCAGGCAAGGTGG + Intronic
916804340 1:168243923-168243945 CTAATCGTAGTCAGGCAACAAGG - Exonic
917535852 1:175873936-175873958 ATAAGTCAAGTCAGGCAAAAAGG - Intergenic
918217496 1:182405247-182405269 ATAAATTTAATCAGGGAAGAAGG + Intergenic
920322541 1:205135486-205135508 AAAAGTTTAGCCAGGCATGATGG + Intergenic
920483623 1:206347422-206347444 CAAAAATTAGCCAGGCAAGATGG + Intronic
921819805 1:219604398-219604420 CAAAAATTAGTCAGGCAAGGTGG - Intergenic
921875795 1:220194543-220194565 CAAAAATTAGTCAGGCATGATGG - Intronic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
923828468 1:237526497-237526519 CAAAGTTTAATCAGGCATGGTGG - Intronic
924222864 1:241896121-241896143 CAAAATTTAGCCAGGCATGATGG - Intergenic
1062965448 10:1603955-1603977 CAAAAATTAGTCAGGCATGATGG - Intronic
1065547356 10:26835285-26835307 CTAAAATTAGTCAGGCACAATGG + Intronic
1066396329 10:35026982-35027004 ATAAGTTTAGTCTGGGAGGAGGG - Intronic
1066510560 10:36091169-36091191 TTAAATTTATTCAGACAAGAAGG + Intergenic
1066688739 10:38005753-38005775 CAAAGTTTAGCCAGGCATGGTGG + Intergenic
1067060511 10:43075921-43075943 CTGAGCTCAGCCAGGCAAGAGGG + Intergenic
1068111881 10:52689719-52689741 CTAAGTGAAGTCAGGCTAGTTGG - Intergenic
1068144217 10:53045518-53045540 CAAAAATTAGTCAGGCATGATGG - Intergenic
1068760717 10:60705973-60705995 CAAAAATTAGCCAGGCAAGATGG - Intronic
1070154653 10:73825952-73825974 CTAAGATTTGTCAGACAAAAAGG - Intronic
1071039253 10:81286754-81286776 CTAAGCCTTGTCCGGCAAGAGGG - Intergenic
1071132242 10:82407914-82407936 CAAAAATTAGTCAGGCATGATGG + Intronic
1072961750 10:99935537-99935559 TTAAGTCTACTCAGGCAAGGTGG - Intronic
1072964579 10:99960823-99960845 TTAAGTCTACTCAGGCAAGGTGG + Intronic
1073169247 10:101489075-101489097 CTAAGTTTTTTCAGGGAAGAGGG - Intronic
1073695435 10:105861138-105861160 CTAACTTTTGTGAGGCAAGAAGG + Intergenic
1075431731 10:122389545-122389567 CAAAAATTAGTCAGGCATGATGG + Intronic
1076375990 10:129985225-129985247 CAAAATTTAGCCAGGCATGATGG + Intergenic
1079641198 11:22807724-22807746 CTAATTTTAGTCAGTTGAGATGG - Intronic
1079701109 11:23549864-23549886 CAAAATTTAGCCAGGCATGATGG - Intergenic
1079776703 11:24540699-24540721 CTAAGTTAACTCTGGAAAGATGG + Intronic
1080288316 11:30641540-30641562 CCAATTTTAGTCAGGCCAAACGG - Intergenic
1080349449 11:31366785-31366807 CTAATTTTAGTCAGTGAGGAAGG - Intronic
1081260287 11:40951380-40951402 CTTAGTTTAATCTGGCAAGTTGG + Intronic
1081307744 11:41534302-41534324 CTAAGTTTGTTCAGTCAGGAAGG + Intergenic
1082285899 11:50317997-50318019 CAAAATTTAGTCAGGCATGGTGG - Intergenic
1082285985 11:50318798-50318820 CAAAATTTAGTCAGGCATGGTGG - Intergenic
1082939315 11:58687332-58687354 TTTAATTTAGCCAGGCAAGATGG - Intronic
1085290347 11:75394710-75394732 CAAAAATTAGTCAGGCATGATGG - Intergenic
1085885656 11:80518616-80518638 CAAAATTTAGCCAGGCATGATGG + Intergenic
1086129664 11:83387807-83387829 ATAAGATTAGCCAGGCATGATGG + Intergenic
1086157570 11:83684501-83684523 TTAAGTATGGTCAGGAAAGACGG - Intronic
1086453953 11:86943469-86943491 CAAAAATTAGTCAGGCATGATGG + Intronic
1088175605 11:107049975-107049997 ATAAAATTAGTCAGGGAAGAAGG + Intergenic
1088241246 11:107775748-107775770 CTAAGTATAACCAGGCATGATGG + Intergenic
1089907718 11:122060525-122060547 CTAAAATTAGTCAGAAAAGAGGG + Intergenic
1091244069 11:134076985-134077007 CAAAAATTAGTCAGGCATGATGG - Intronic
1091765088 12:3114688-3114710 CAAAGATTAGCCAGGCATGATGG + Intronic
1091989320 12:4941845-4941867 CTGATTTTAGTGAGTCAAGAGGG - Intergenic
1092240420 12:6832752-6832774 CAAAAATTAGCCAGGCAAGATGG - Intronic
1092725619 12:11482761-11482783 CAAAAATTAGTCAGGCATGATGG - Intronic
1092778565 12:11964916-11964938 CAAAGATTAGTCAGGCATGGTGG - Intergenic
1094122060 12:26985342-26985364 CAAAAATTAGTCAGGCAAGGTGG + Intronic
1094359279 12:29612562-29612584 CAAAAATTAGTCAGGCATGATGG - Intronic
1094437927 12:30441854-30441876 AATACTTTAGTCAGGCAAGAAGG + Intergenic
1094659483 12:32453384-32453406 CAAAAATTAGTCAGGCATGATGG - Intronic
1096681700 12:53259906-53259928 CAAAAATTAGTCAGGCATGATGG - Intergenic
1097254304 12:57660710-57660732 CTAATTTTAGCCAGGCTAAATGG - Intergenic
1098412223 12:70198719-70198741 CAAAGATTAGTCAGGCATGGTGG + Intergenic
1100550004 12:95638463-95638485 CTAAGGTCAATCAGGCAAGGAGG + Intergenic
1101019726 12:100541567-100541589 TTAACTTTAGTCAGGCACGGTGG - Intronic
1101570336 12:105947827-105947849 CAAAGATTAGCCAGGCATGATGG - Intergenic
1103139792 12:118538427-118538449 CAAAAATTAGTCAGGCACGATGG + Intergenic
1105300441 13:19129324-19129346 CAAAAATTAGCCAGGCAAGATGG + Intergenic
1105389751 13:19964221-19964243 CAAAGATTAGTCAGGCATGGTGG + Intronic
1106112492 13:26789298-26789320 CTGAATTTAGTGAGGCAAGGAGG - Intergenic
1108351025 13:49590877-49590899 CAAAAATTAGCCAGGCAAGATGG + Intergenic
1108943873 13:55996503-55996525 CAAAGTTTAGTGAAGCAATATGG + Intergenic
1110227631 13:73136288-73136310 CAAAAATTAGTCAGGCATGATGG + Intergenic
1110533801 13:76627925-76627947 GTATGTGTAGTGAGGCAAGAAGG - Intergenic
1110912997 13:80986812-80986834 GTTATTTTAGTAAGGCAAGAAGG + Intergenic
1114230470 14:20777041-20777063 CAAAATTTAGTCAGGCATGGTGG - Intergenic
1115491998 14:33966832-33966854 AGAAGTTTAGGCAGGCATGATGG + Intronic
1116182347 14:41551064-41551086 CAAAGTTTAGTCTGGCATGGTGG + Intergenic
1116463527 14:45206437-45206459 CAAAGATTAGCCAGGCATGATGG - Intronic
1119823562 14:77639258-77639280 CAAAATTTAGTCAGGCATGGTGG - Intergenic
1120157220 14:81106790-81106812 CAAAAATTAGTCAGGCATGATGG + Intronic
1120819307 14:88897187-88897209 CAAAGATTAGCCAGGCATGATGG + Intergenic
1121007133 14:90497652-90497674 CAAAATTTAGCCAGGCAAGGTGG + Intergenic
1123709046 15:22973159-22973181 CAAAATTTAGCCAGGCATGATGG + Intronic
1125233516 15:37484539-37484561 TTCAGTTTTGTAAGGCAAGAAGG - Intergenic
1125343973 15:38700403-38700425 CTAGATTTAGTCAGGCAGGAGGG + Intergenic
1126169995 15:45687262-45687284 CAAAAATTAGTCAGGCATGATGG - Intronic
1127054654 15:55119181-55119203 CAAAGATTAGCCAGGCAAGGTGG - Intergenic
1129483514 15:75845565-75845587 CTAAGTTTACTCAGGTAAGTTGG + Intronic
1129830815 15:78668766-78668788 CAAAATTTAGCCAGGCATGATGG + Intronic
1130210590 15:81918359-81918381 CAAAAATTAGTCAGGCATGATGG + Intergenic
1131109416 15:89755827-89755849 CCAAGATTAGTCAGGCATGGTGG - Intergenic
1131140131 15:89970597-89970619 CAAAAATTAGTCAGGCATGATGG + Intergenic
1132420813 15:101666321-101666343 CAAAGTTTAGCCAGGCATGGTGG + Intronic
1133373031 16:5260046-5260068 CAAAAATTAGTCAGGCATGATGG + Intergenic
1133502578 16:6379797-6379819 CTAAGTTTTGTTGTGCAAGAAGG + Intronic
1133595641 16:7288686-7288708 CTAAAATTAGCCAGGCATGATGG + Intronic
1133776643 16:8901465-8901487 CTACATTTAGACAGTCAAGACGG + Intronic
1134754585 16:16655572-16655594 CTAAAATTAGCCAGGCATGATGG - Intergenic
1134991476 16:18703470-18703492 CTAAAATTAGCCAGGCATGATGG + Intergenic
1135078905 16:19417264-19417286 CAAAAATTAGTCAGGCATGATGG + Intronic
1135079329 16:19420748-19420770 CTATGTTCAGACAGGCGAGATGG - Intronic
1135887228 16:26321381-26321403 CTAAAAATAGTCAGGCATGATGG - Intergenic
1136465415 16:30439859-30439881 TTAAGTTTAGCCAGGCATGGTGG - Intergenic
1136531370 16:30871852-30871874 CTAAGTTGAGTGAGACCAGATGG + Intronic
1136535760 16:30898312-30898334 CAAAAATTAGTCAGGCATGATGG - Intronic
1137329754 16:47481150-47481172 CTAGCTTTAGTTAGGCATGACGG + Intronic
1137329883 16:47482871-47482893 CAAAATTTAGTCAGGCATGGTGG - Intronic
1137430608 16:48415283-48415305 GTAGGGTTAATCAGGCAAGATGG + Intronic
1137623596 16:49893278-49893300 CAAAAATTAGTCAGGCATGATGG + Intergenic
1137786970 16:51147258-51147280 CAAAGTCTAGTTAGGCATGAGGG - Intronic
1138461390 16:57150048-57150070 CAAAAATTAGTCAGGCAAGGTGG - Intergenic
1139819564 16:69710178-69710200 CAAAAATTAGTCAGGCATGATGG + Exonic
1140347013 16:74223069-74223091 CAAAAATTAGTCAGGCATGATGG + Intergenic
1141086349 16:81098181-81098203 CAAAGTTTAGCCAGGCATGGTGG + Intergenic
1142344643 16:89546237-89546259 CAAAAATTAGCCAGGCAAGACGG - Intronic
1143193393 17:5056957-5056979 CAAAAATTAGTCAGGCAAGGTGG + Intergenic
1143358614 17:6349762-6349784 CAAAATTTAGCCAGGCATGATGG - Intergenic
1143588376 17:7864085-7864107 CTAAGTTTAGGGAGGCCACATGG + Intronic
1144383154 17:14722982-14723004 CTAAAATTAGTTAGGCATGATGG + Intergenic
1144567050 17:16368374-16368396 AAAAAATTAGTCAGGCAAGATGG + Intergenic
1145263095 17:21366299-21366321 CTAAGTAGAGGGAGGCAAGAGGG - Intergenic
1146228124 17:31085016-31085038 AAAAATTTAGCCAGGCAAGATGG + Intergenic
1149586694 17:57793359-57793381 CAAAAATTAGTCAGGCATGATGG + Intergenic
1149936637 17:60813383-60813405 CAAAGATTAGCCAGGCAAGGTGG - Intronic
1150099655 17:62411612-62411634 CAAAAATTAGTCAGGCATGATGG + Intronic
1150164972 17:62932766-62932788 CAAAAGTTAGTCAGGCATGATGG + Intergenic
1151264959 17:72947687-72947709 CTGAGCTGAGTCAGGCAATATGG - Intronic
1151693068 17:75699037-75699059 TTAAGATTAGTCAGGCATGGTGG + Intronic
1155041331 18:22067795-22067817 CCAAGTTCTGCCAGGCAAGAGGG + Intergenic
1161965518 19:7545757-7545779 CAAAAATTAGTCAGGCACGATGG + Intronic
1162414072 19:10523905-10523927 CAAAATTTAGCCAGGCATGATGG - Intergenic
1163606081 19:18276159-18276181 CAAAAATTAGTCAGGCATGATGG + Intergenic
1163866929 19:19781361-19781383 TTAAGTTTAGCCAGGCATGGTGG + Intergenic
1167170852 19:47830832-47830854 ATAGGTTTAGTCAGGAAAGACGG + Intronic
1168088685 19:54067276-54067298 CAAAATTTAGTCCGGCATGATGG + Intergenic
1168225155 19:54989317-54989339 CAAAAATTAGCCAGGCAAGATGG + Intronic
1168716226 19:58529286-58529308 AAAAGTTTAGCCAGGCATGATGG + Intronic
925129346 2:1483310-1483332 CAAACTTCAGGCAGGCAAGAAGG + Intronic
925320464 2:2962508-2962530 CAAAAATTAGTCAGGCATGATGG + Intergenic
926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG + Intronic
926847277 2:17155692-17155714 CAAAAATTAGTCAGGCATGATGG + Intergenic
927462917 2:23314440-23314462 CTAAGGTTATCCAGGCAAGATGG - Intergenic
928711878 2:34016507-34016529 CAAAAGTTAGTCAGGCATGATGG - Intergenic
928742865 2:34376099-34376121 CAAAATTTAGCCAGGCATGATGG - Intergenic
930148104 2:48028346-48028368 CTAAAATTAGTCGGGCATGATGG + Intergenic
930190455 2:48453969-48453991 CTAAGTTTGGCCAGGCATGGTGG + Intronic
930312378 2:49757480-49757502 CAAAAATTAGTCAGGCATGATGG + Intergenic
932183482 2:69670871-69670893 CAAAATTTAGCCAGGCATGATGG + Intronic
932999153 2:76900074-76900096 CAAAAGTTAGTCAGGCATGATGG + Intronic
933894327 2:86796945-86796967 TTAATTTTAGTCAGGTCAGAGGG + Intronic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934971115 2:98765197-98765219 CAAAAATTAGCCAGGCAAGATGG + Intergenic
935287905 2:101581508-101581530 CAAAAATTAGTCAGGCATGATGG - Intergenic
937201691 2:120208232-120208254 CAAAAATTAGTCAGGCATGATGG + Intergenic
937766035 2:125661571-125661593 CTAACTTTAGTCACCCTAGAAGG + Intergenic
938229051 2:129642121-129642143 ATAATTATAGTCAAGCAAGATGG - Intergenic
939351750 2:141046927-141046949 CAAAAATTAGTCAGGCATGATGG + Intronic
939877091 2:147589761-147589783 CTAATTTTGGCCAGGCATGATGG + Intergenic
940199505 2:151134786-151134808 CAAAATTTAGTCAAGCAAGGTGG + Intergenic
940346603 2:152635637-152635659 CAGAGTTGAGTCAGGCAAGGGGG + Intronic
940681943 2:156797066-156797088 CAAAAATTAGTCAGGCATGAAGG - Intergenic
942102962 2:172604232-172604254 CGAAAATTAGTCAGGCATGATGG - Intronic
942127072 2:172837718-172837740 ATAAATTTAGCCAGGCAAGGCGG - Intronic
943885303 2:193209457-193209479 CTAAAATTAGCCAGGCATGATGG + Intergenic
944027817 2:195193007-195193029 CAAAAATTAGTCAGGCATGATGG + Intergenic
944459755 2:199935494-199935516 ATAAATTTAGTCAGGCATGGTGG - Intronic
944837277 2:203592237-203592259 CAAAAATTAGTCAGGCATGATGG - Intergenic
944971464 2:204997714-204997736 CTAAGTGTAGTAATGCAAGAAGG - Intronic
945239695 2:207665098-207665120 CAAAAATTAGTCAGGCAAGATGG + Intergenic
945413459 2:209541181-209541203 CAAAAATTAGTCAGGCATGATGG - Intronic
945666806 2:212753606-212753628 CTAGGGTTACTCAGGCAAGCAGG + Intergenic
945865514 2:215170452-215170474 CTATGTTTAGTAAAGCAACATGG + Intergenic
947107488 2:226682587-226682609 CAAAAATTAGTCAGGCATGATGG + Intergenic
947801634 2:232932315-232932337 AAAAGTTTAGCCAGGCATGATGG - Intronic
1169047210 20:2543082-2543104 CAAAAATTAGTCAGGCAAGGTGG + Intronic
1169287820 20:4324321-4324343 TTAAGTTGAGTCAGGGAGGAGGG + Intergenic
1176142424 20:63550589-63550611 CAAAAGTTAGTCAGGCATGATGG + Intronic
1177292141 21:19127445-19127467 CAAAAATTAGTCAGGCATGATGG + Intergenic
1177661666 21:24091732-24091754 CTAAGGTAAGTCAATCAAGAAGG - Intergenic
1177841907 21:26244051-26244073 ATAAATTCAGTCAGGCATGATGG - Intergenic
1178378114 21:32085046-32085068 CTCAGTCTGGTCAGGGAAGATGG - Intergenic
1183217035 22:36487416-36487438 AGAAGTTTAGACAGGAAAGATGG + Exonic
1183449729 22:37886414-37886436 CAAAAATTAGCCAGGCAAGATGG + Intronic
1183651907 22:39160819-39160841 CAAAATTTAGTCAGGCATGGTGG + Intergenic
1183865285 22:40699492-40699514 CTAAGGTTGATGAGGCAAGAAGG + Intergenic
1184210318 22:43031462-43031484 CTAAAATTAGTCAGGCATGGTGG + Intergenic
949317932 3:2777314-2777336 CTAAATTTAGTAAAGAAAGATGG + Intronic
949520416 3:4847913-4847935 CTACGTTTGGACAGGCAAGGTGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950243903 3:11397607-11397629 CAAAAATTAGCCAGGCAAGATGG - Intronic
950251251 3:11467526-11467548 CAAAAATTAGTCAGGCACGATGG - Intronic
950766568 3:15277554-15277576 CTAAGCTCAGGCAGGCATGAGGG - Intronic
951195306 3:19817007-19817029 CTATGTTTATTAAGTCAAGATGG + Intergenic
953089694 3:39712733-39712755 CTAATTTTAGTCACGTGAGACGG - Intergenic
955211306 3:56944021-56944043 CTAAAATTAGCCAGGCATGATGG + Intronic
955774854 3:62421974-62421996 GTAAGCTTAGCCAGGCAAGGAGG - Intronic
958118456 3:89253702-89253724 CTGAGTTTAGTCAGTTAATAAGG + Intronic
959049461 3:101511280-101511302 CTAAGTGTAATCAGGTAAAAAGG + Intronic
959727920 3:109565367-109565389 TTTAGTGTAGGCAGGCAAGATGG - Intergenic
960877759 3:122314187-122314209 CTAAGTTTATAGAGGCAGGAGGG - Intergenic
961683556 3:128614792-128614814 CAAAAATTAGTCAGGCATGATGG + Intergenic
961932434 3:130547948-130547970 CAAAATTTAGTCAGACATGATGG - Intergenic
964756820 3:160096361-160096383 CTAAGTTTACTAAGGCCAGGTGG - Intergenic
966389034 3:179432132-179432154 CTATGTTTGGGCAGGCATGATGG + Intronic
966704907 3:182901911-182901933 ATAAATTTAGTGAGCCAAGAAGG - Intronic
970568194 4:17352948-17352970 CAAAGCTGAGACAGGCAAGAAGG + Intergenic
971298024 4:25417273-25417295 ATAAAATTAGTCAGGCAAGGTGG - Intronic
971440855 4:26683525-26683547 CTACTATTAGTCAGGCATGAGGG + Intronic
971491223 4:27214172-27214194 CTAAGTTTATCCAGGCATGGAGG + Intergenic
971763880 4:30804384-30804406 CAAAAATTAGTCAGGCATGATGG + Intronic
972524403 4:39894253-39894275 CAAAAATTAGTCAGGCATGATGG + Intronic
973899225 4:55450613-55450635 CAAAATTTAGCCAGGCATGATGG + Intronic
974637962 4:64590141-64590163 CAAAGATTAGCCAGGCATGATGG + Intergenic
975808153 4:78134905-78134927 CTGAGCTTAGTCAGGCATGAGGG - Intronic
977839891 4:101690182-101690204 CTAAGTTTAACCAGGCCATAGGG + Intronic
979870883 4:125820257-125820279 CTAATTTTATTCAGGGAATAAGG - Intergenic
980124459 4:128760399-128760421 CAAAAATTAGTCAGGCATGATGG - Intergenic
981201070 4:141979998-141980020 CTGATTTTAGCCAGGCCAGACGG - Intergenic
981445209 4:144828746-144828768 CAAAAATTAGTCAGGCATGATGG + Intergenic
981893480 4:149767313-149767335 TCAAGTTTTCTCAGGCAAGATGG - Intergenic
982331100 4:154182973-154182995 CTATGTTTGGCCAGGCATGATGG + Intergenic
988101599 5:26686708-26686730 ATAAGTTTAGTAAAGCAAAATGG + Intergenic
988567222 5:32329131-32329153 CAAAAATTAGTCAGGCATGATGG - Intergenic
988581271 5:32470946-32470968 CTAATCTTAGCCAGGCATGATGG + Intergenic
989631395 5:43485698-43485720 CTAACTTTAGTCAGGTAGTAAGG + Intergenic
990145261 5:52752336-52752358 CCAAGTTTAGTAAAGGAAGAGGG + Intergenic
990825009 5:59889326-59889348 CTAAATTGAGTCAGGCATGGTGG + Intronic
991299391 5:65114293-65114315 CAAAGATTAGCCAGGCATGATGG - Intergenic
991368313 5:65892160-65892182 CAAAATTTAGCCAGGCATGATGG - Intergenic
993042285 5:82827977-82827999 CTTATTTGTGTCAGGCAAGATGG + Intergenic
996129823 5:119769029-119769051 ATAATTTTAGTCACACAAGATGG - Intergenic
997501886 5:134381789-134381811 CAAAAATTAGTCAGGCATGATGG + Intronic
999217799 5:149950177-149950199 CAAAAATTAGCCAGGCAAGATGG + Intergenic
999685819 5:154102080-154102102 CTAAAATTAGCCAGGCAAGGTGG + Intronic
1000662566 5:163953648-163953670 CAAAGTTTAGTAGGGGAAGAGGG - Intergenic
1000763645 5:165257720-165257742 CAAAATTTAGCCAGGCATGATGG - Intergenic
1001427514 5:171633246-171633268 CAAAAATTAGTCAGGCATGATGG - Intergenic
1001492738 5:172167005-172167027 CAAAAATTAGCCAGGCAAGATGG + Intronic
1001512023 5:172330354-172330376 CTAAGGTTAGACAGGCATTATGG + Intronic
1002281569 5:178133171-178133193 CTAATCTTTGTCAGGCAAAAGGG + Intronic
1002549747 5:179978692-179978714 CTAAGTACAGACAGGAAAGATGG + Intronic
1002760849 6:200891-200913 CTAAAATTAGCCAGGCATGATGG - Intergenic
1003766697 6:9245207-9245229 CAAAAATTAGTCAGGCATGATGG - Intergenic
1003840207 6:10112156-10112178 GTAGGTTGACTCAGGCAAGAAGG - Intronic
1004162113 6:13223557-13223579 CTAAATGTACCCAGGCAAGATGG - Intronic
1004608548 6:17216856-17216878 CTAAAATTAGTCAGGCATGGTGG + Intergenic
1006346865 6:33489481-33489503 ATAAAATTAGTCAGGCATGATGG - Intergenic
1006350891 6:33520347-33520369 CAAAATTTAGCCAGGCATGATGG - Intergenic
1006555549 6:34863056-34863078 CAAAGATTAGCCAGGCATGATGG - Intronic
1006674649 6:35753705-35753727 CAAAATTTAGCCAGGCATGATGG - Intergenic
1007533212 6:42561486-42561508 CAAAAATTAGTCAGGCATGATGG + Intergenic
1007799310 6:44378616-44378638 CAAAAATTAGCCAGGCAAGATGG + Exonic
1008129085 6:47700226-47700248 GTAAGTGTAGTCAGTCAGGAAGG - Intronic
1009565834 6:65310189-65310211 CAAAAATTAGTCAGGCAAGGTGG + Intronic
1010193194 6:73214238-73214260 CAAATTCTAGCCAGGCAAGATGG + Intronic
1010797165 6:80130910-80130932 CTACACTGAGTCAGGCAAGATGG - Intronic
1012275952 6:97275848-97275870 TTAATTTTAGTCAGGCATGATGG + Intronic
1013361712 6:109399553-109399575 CAAAAATTAGTCAGGCATGATGG - Intronic
1013961610 6:115907674-115907696 CTTAGTTTTGTCAGCCAAGCTGG - Intergenic
1014041924 6:116838031-116838053 GAAATTTTAGTCAGGCAAGTTGG + Intergenic
1014431679 6:121378258-121378280 ATAGGTTTAGCCAGGCATGATGG - Intergenic
1016198140 6:141371734-141371756 CTAAATTTAGTGAGGCAATTAGG - Intergenic
1016270853 6:142288829-142288851 CAAAAATTAGTCAGGCATGATGG - Intergenic
1017092227 6:150770227-150770249 CCAATTTTAGTAAGCCAAGATGG - Intronic
1017491403 6:154948750-154948772 CAAAAATTAGCCAGGCAAGATGG - Intronic
1017825115 6:158076033-158076055 CTAAAATTAGCCAGGCATGATGG + Intronic
1018318147 6:162577774-162577796 AAAAATTTAGCCAGGCAAGATGG + Intronic
1020201781 7:6085765-6085787 CAAAATTTAGCCAGGCATGATGG - Intergenic
1025989255 7:66483217-66483239 CAAAATTTAGTCAGGCAAGGTGG + Intergenic
1027607682 7:80320668-80320690 CAAAAATTAGTCAGGCATGATGG - Intergenic
1027828789 7:83151525-83151547 CCAAGTTTATTCAGTCAATAAGG + Intronic
1027869478 7:83688324-83688346 CAAAATTTAGCCAGGCATGATGG + Intergenic
1030257983 7:107532207-107532229 CTAAAATTAGTCAGGCATGGTGG - Intronic
1031505764 7:122580300-122580322 CAAAATTTAGCCAGGCAAGGTGG + Intronic
1033073129 7:138222873-138222895 ATAAATATAGTCAGGCATGATGG + Intergenic
1033290169 7:140076787-140076809 CAAAAATTAGTCAGGCATGATGG + Intergenic
1034081374 7:148280764-148280786 CAAAAATTAGCCAGGCAAGATGG + Intronic
1034223312 7:149461490-149461512 CTAACTTAAGTGAGGGAAGACGG + Intergenic
1035028323 7:155841635-155841657 CAAAATTTAGCCAGGCATGATGG - Intergenic
1038545599 8:28423806-28423828 CAAAATTTAGCCAGGCATGATGG + Intronic
1038645227 8:29355521-29355543 CAAAAATTAGTCAGGCATGATGG + Intergenic
1038736510 8:30174485-30174507 CTAAAATTAGCCAGGCATGATGG - Intronic
1038955542 8:32464179-32464201 CTAAGTTTAGCCAGGCGTGATGG - Intronic
1038988805 8:32843552-32843574 CAAAAATTAGTCAGGCATGATGG - Intergenic
1039105078 8:33981493-33981515 CTGAGTTTTGTCTGGCATGATGG - Intergenic
1039162878 8:34642019-34642041 GTAAGTATTGTCAGGGAAGAAGG + Intergenic
1039325824 8:36484425-36484447 TTATCTTTAGACAGGCAAGAGGG + Intergenic
1039488500 8:37929921-37929943 CAAAAATTAGTCAGGCATGATGG + Intergenic
1039634770 8:39152567-39152589 CAAAGATTAGTCAGGCATGGTGG + Intronic
1040338855 8:46429806-46429828 GTAAGTTGAGGCAGGCAAAAGGG + Intergenic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1043703311 8:83318264-83318286 CTAAGTATTGCCAGGGAAGAAGG - Intergenic
1044241918 8:89898631-89898653 CTAAACTTAGTCAGGCATGGTGG + Intergenic
1045198362 8:99952944-99952966 CAAAAATTAGCCAGGCAAGATGG - Intergenic
1046120101 8:109835457-109835479 CTAAGTTTTGGCAGGCAGCAAGG - Intergenic
1046926053 8:119790281-119790303 CAAAAATTAGTCAGGCACGATGG + Intronic
1049021837 8:139962547-139962569 CCAAGTTTATTCTGGCAACATGG - Intronic
1050238593 9:3610779-3610801 CAAAAATTAGCCAGGCAAGATGG - Intergenic
1050891918 9:10835501-10835523 CTAATTTAAATAAGGCAAGAGGG + Intergenic
1052238070 9:26236962-26236984 CACTGTTTAGTCAGGCAAGGTGG + Intergenic
1057246149 9:93455813-93455835 CAAAGATTAGCCAGGCATGATGG - Intronic
1057594710 9:96405167-96405189 CAAAAATTAGTCAGGCATGATGG + Intronic
1057774313 9:97993786-97993808 CAAAAATTAGCCAGGCAAGATGG - Intronic
1057824129 9:98359273-98359295 CAAAATTTAGTCAGGCATGGTGG + Intronic
1060615464 9:125009420-125009442 CAAAAATTAGTCAGGCATGATGG - Intronic
1060850765 9:126873414-126873436 CAAAAATTAGTCAGGCAAGATGG - Intronic
1185790088 X:2922683-2922705 CAAAAATTAGTCAGGCAAGGTGG + Intronic
1186403780 X:9283712-9283734 CAAAGATTAGCCAGGCATGATGG - Intergenic
1187760382 X:22577220-22577242 CAAAACTTAGTCATGCAAGAAGG + Intergenic
1188519512 X:31022055-31022077 CTAAGTATAGGCAGGCATTATGG - Intergenic
1189431156 X:40948941-40948963 CTAATCCTAGCCAGGCAAGATGG + Intergenic
1191837954 X:65485404-65485426 CTAAAATTAGTCAGGCATGGTGG - Intronic
1194269157 X:91788697-91788719 CTACGATTACTCAGGAAAGAAGG - Intronic
1196434333 X:115661296-115661318 AAAAGTTTAGCCAGGCATGATGG + Intergenic
1200586372 Y:5009702-5009724 CTACGATTACTCAGGAAAGAAGG - Intronic
1201284233 Y:12365251-12365273 CAAAAATTAGTCAGGCAAGATGG - Intergenic