ID: 926331900

View in Genome Browser
Species Human (GRCh38)
Location 2:11832510-11832532
Sequence GTGGATGTCAAGGGCATCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926331900_926331912 29 Left 926331900 2:11832510-11832532 CCGGAGATGCCCTTGACATCCAC No data
Right 926331912 2:11832562-11832584 ACTTTGGCTCAGAGGAGGCCTGG No data
926331900_926331911 24 Left 926331900 2:11832510-11832532 CCGGAGATGCCCTTGACATCCAC No data
Right 926331911 2:11832557-11832579 ACTTGACTTTGGCTCAGAGGAGG No data
926331900_926331908 13 Left 926331900 2:11832510-11832532 CCGGAGATGCCCTTGACATCCAC No data
Right 926331908 2:11832546-11832568 CTTTGACCTTGACTTGACTTTGG No data
926331900_926331910 21 Left 926331900 2:11832510-11832532 CCGGAGATGCCCTTGACATCCAC No data
Right 926331910 2:11832554-11832576 TTGACTTGACTTTGGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926331900 Original CRISPR GTGGATGTCAAGGGCATCTC CGG (reversed) Intergenic
No off target data available for this crispr