ID: 926333311

View in Genome Browser
Species Human (GRCh38)
Location 2:11843888-11843910
Sequence TTGGATATGTACTCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926333311_926333317 24 Left 926333311 2:11843888-11843910 CCTGACACAGAGTACATATCCAA No data
Right 926333317 2:11843935-11843957 TAGTTTTTTTTTTTTTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926333311 Original CRISPR TTGGATATGTACTCTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr