ID: 926336750

View in Genome Browser
Species Human (GRCh38)
Location 2:11869004-11869026
Sequence CTCCCACAGCACCGAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926336747_926336750 -10 Left 926336747 2:11868991-11869013 CCTGGAATTTACTCTCCCACAGC No data
Right 926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926336750 Original CRISPR CTCCCACAGCACCGAGGGAA AGG Intergenic
No off target data available for this crispr