ID: 926339877

View in Genome Browser
Species Human (GRCh38)
Location 2:11896133-11896155
Sequence TGGTGTAGGAAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926339872_926339877 -5 Left 926339872 2:11896115-11896137 CCCTTCAAAGTCAAAGACTGGTG No data
Right 926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG No data
926339870_926339877 10 Left 926339870 2:11896100-11896122 CCAGGCTTTAGAGGTCCCTTCAA No data
Right 926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG No data
926339873_926339877 -6 Left 926339873 2:11896116-11896138 CCTTCAAAGTCAAAGACTGGTGT No data
Right 926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926339877 Original CRISPR TGGTGTAGGAAGAAGGAGGA TGG Intergenic
No off target data available for this crispr