ID: 926347135

View in Genome Browser
Species Human (GRCh38)
Location 2:11957671-11957693
Sequence CTGTGTGAAGGAAGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926347126_926347135 29 Left 926347126 2:11957619-11957641 CCAGGTGGAAGGTGAGCCCTGAC No data
Right 926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG No data
926347130_926347135 7 Left 926347130 2:11957641-11957663 CCTGTGCTGCAAAGGAGCAGATG No data
Right 926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG No data
926347129_926347135 12 Left 926347129 2:11957636-11957658 CCTGACCTGTGCTGCAAAGGAGC No data
Right 926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG No data
926347125_926347135 30 Left 926347125 2:11957618-11957640 CCCAGGTGGAAGGTGAGCCCTGA No data
Right 926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG No data
926347128_926347135 13 Left 926347128 2:11957635-11957657 CCCTGACCTGTGCTGCAAAGGAG No data
Right 926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926347135 Original CRISPR CTGTGTGAAGGAAGTAGAGT GGG Intergenic
No off target data available for this crispr