ID: 926351448

View in Genome Browser
Species Human (GRCh38)
Location 2:11998935-11998957
Sequence TGGTTGGTGTGCAGGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926351438_926351448 25 Left 926351438 2:11998887-11998909 CCCTGTATTCTTCACAGAGGAGA No data
Right 926351448 2:11998935-11998957 TGGTTGGTGTGCAGGCCAGGGGG No data
926351439_926351448 24 Left 926351439 2:11998888-11998910 CCTGTATTCTTCACAGAGGAGAA No data
Right 926351448 2:11998935-11998957 TGGTTGGTGTGCAGGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926351448 Original CRISPR TGGTTGGTGTGCAGGCCAGG GGG Intergenic
No off target data available for this crispr